ID: 1121254564

View in Genome Browser
Species Human (GRCh38)
Location 14:92521631-92521653
Sequence GAGGCTTCCTGAGCCTCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 5, 3: 19, 4: 234}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121254561_1121254564 -7 Left 1121254561 14:92521615-92521637 CCTTCCACCATGATTGGAGGCTT 0: 3
1: 157
2: 681
3: 3529
4: 5789
Right 1121254564 14:92521631-92521653 GAGGCTTCCTGAGCCTCACCAGG 0: 1
1: 0
2: 5
3: 19
4: 234
1121254556_1121254564 -1 Left 1121254556 14:92521609-92521631 CCTTCCCCTTCCACCATGATTGG 0: 2
1: 136
2: 1293
3: 3453
4: 5419
Right 1121254564 14:92521631-92521653 GAGGCTTCCTGAGCCTCACCAGG 0: 1
1: 0
2: 5
3: 19
4: 234
1121254559_1121254564 -5 Left 1121254559 14:92521613-92521635 CCCCTTCCACCATGATTGGAGGC 0: 2
1: 8
2: 83
3: 982
4: 1609
Right 1121254564 14:92521631-92521653 GAGGCTTCCTGAGCCTCACCAGG 0: 1
1: 0
2: 5
3: 19
4: 234
1121254555_1121254564 0 Left 1121254555 14:92521608-92521630 CCCTTCCCCTTCCACCATGATTG 0: 41
1: 1283
2: 3172
3: 5238
4: 6574
Right 1121254564 14:92521631-92521653 GAGGCTTCCTGAGCCTCACCAGG 0: 1
1: 0
2: 5
3: 19
4: 234
1121254552_1121254564 8 Left 1121254552 14:92521600-92521622 CCTGCTCCCCCTTCCCCTTCCAC 0: 3
1: 128
2: 591
3: 1663
4: 5068
Right 1121254564 14:92521631-92521653 GAGGCTTCCTGAGCCTCACCAGG 0: 1
1: 0
2: 5
3: 19
4: 234
1121254553_1121254564 2 Left 1121254553 14:92521606-92521628 CCCCCTTCCCCTTCCACCATGAT 0: 12
1: 464
2: 1339
3: 2460
4: 3899
Right 1121254564 14:92521631-92521653 GAGGCTTCCTGAGCCTCACCAGG 0: 1
1: 0
2: 5
3: 19
4: 234
1121254554_1121254564 1 Left 1121254554 14:92521607-92521629 CCCCTTCCCCTTCCACCATGATT 0: 55
1: 872
2: 2541
3: 4956
4: 6547
Right 1121254564 14:92521631-92521653 GAGGCTTCCTGAGCCTCACCAGG 0: 1
1: 0
2: 5
3: 19
4: 234
1121254560_1121254564 -6 Left 1121254560 14:92521614-92521636 CCCTTCCACCATGATTGGAGGCT 0: 2
1: 8
2: 86
3: 1068
4: 1730
Right 1121254564 14:92521631-92521653 GAGGCTTCCTGAGCCTCACCAGG 0: 1
1: 0
2: 5
3: 19
4: 234
1121254550_1121254564 29 Left 1121254550 14:92521579-92521601 CCTTTCTCGCCATGTGACATACC 0: 1
1: 6
2: 43
3: 283
4: 683
Right 1121254564 14:92521631-92521653 GAGGCTTCCTGAGCCTCACCAGG 0: 1
1: 0
2: 5
3: 19
4: 234
1121254551_1121254564 20 Left 1121254551 14:92521588-92521610 CCATGTGACATACCTGCTCCCCC 0: 11
1: 168
2: 498
3: 1054
4: 1710
Right 1121254564 14:92521631-92521653 GAGGCTTCCTGAGCCTCACCAGG 0: 1
1: 0
2: 5
3: 19
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121254564 Original CRISPR GAGGCTTCCTGAGCCTCACC AGG Intronic
900140849 1:1139034-1139056 GAGGCATCCTGAGCTGCATCCGG + Intergenic
900325526 1:2106892-2106914 GGGGCTTGCTGAGAGTCACCTGG - Intronic
900429427 1:2594812-2594834 GAAGCTTCCTGAGGCTCCGCTGG + Exonic
900430393 1:2598635-2598657 GACCCTCCCTGGGCCTCACCTGG + Exonic
900449332 1:2697809-2697831 CAGGCTGTCTGATCCTCACCCGG - Intronic
900452800 1:2758760-2758782 CAGGCTGTCTGATCCTCACCCGG - Intronic
900454651 1:2768248-2768270 CAGGCTGCCAGATCCTCACCTGG + Intronic
900456168 1:2775873-2775895 CAGGCTGCCAGATCCTCACCTGG + Intronic
900534228 1:3169134-3169156 GACACTTTCTGAGCCTCAGCTGG + Intronic
901409424 1:9072030-9072052 GAGTCCCCCTCAGCCTCACCCGG + Intronic
902044050 1:13512518-13512540 GCAGCTTCCCGAGCCTAACCTGG - Intronic
903145746 1:21370902-21370924 GAGGCTCCCTGAGCTTGACCTGG - Intergenic
903543539 1:24109979-24110001 TCCGCTTCCTGAGCCTCCCCTGG - Intronic
903658487 1:24963178-24963200 CAGCCTTCCTTGGCCTCACCAGG + Intronic
903977644 1:27161528-27161550 CAGGCTTCCTGAGGCTGTCCTGG - Intronic
904264654 1:29311339-29311361 GAGGCCTCCTGAGCCCCAACGGG - Intronic
904488600 1:30844262-30844284 GGGGCTTCCTGGGCCACAGCAGG - Intergenic
905626562 1:39493403-39493425 CAGGCTTCCTGGGCCTGTCCTGG - Intronic
905670333 1:39787053-39787075 CAGGCTTCCTGGGCCTGTCCTGG + Intronic
907288206 1:53395722-53395744 GAGGCTTCCTGGAGCTCAGCTGG - Intergenic
911559530 1:99387587-99387609 GAGGCACCATGAGCCACACCCGG + Intergenic
915517266 1:156420832-156420854 GAGGCCTCCCCAGCCTCGCCGGG + Intronic
919116461 1:193286073-193286095 GAGGCTTCCTGACCCTAGACTGG - Intergenic
920173816 1:204087912-204087934 GGGGCTTCCAGAGTCCCACCTGG + Intronic
922240368 1:223751604-223751626 GAGGCTTCCCAGGCCTCAGCCGG + Intronic
1063208200 10:3854825-3854847 GAGGCTTGTGCAGCCTCACCTGG + Intergenic
1063381584 10:5589265-5589287 TGGGCTTCCTGTGCCTCACCCGG - Intergenic
1063449541 10:6142290-6142312 GGGGCTTCCTCATCCTCTCCAGG + Intergenic
1063946104 10:11177946-11177968 GCGGCTTACTGAGCCTCACAGGG - Intronic
1064581300 10:16795850-16795872 GAGGGTGCCGGTGCCTCACCTGG - Intronic
1065845231 10:29737470-29737492 GCGGCTGCCTCAGCATCACCTGG - Intergenic
1066147000 10:32570614-32570636 GTGGCTTCCTGAGCCACACTAGG + Intronic
1066188815 10:33036935-33036957 CAGGCTTTCTGAGCCTGACAGGG - Intergenic
1067200585 10:44168507-44168529 GAGGCTGCCTGTGCCTCTCTCGG - Intergenic
1067776304 10:49167225-49167247 AAGGCTCCCTGAAGCTCACCTGG + Intronic
1069411029 10:68153536-68153558 GAGGCTTTCTCAGCCTCGTCAGG + Intronic
1070311243 10:75275653-75275675 CAGGCAGCCTGGGCCTCACCTGG + Intergenic
1071495035 10:86162329-86162351 GAGGGTCCCTGGGCCTCAGCAGG - Intronic
1072698028 10:97618568-97618590 GAGACTTCCTGAGGCTCTGCTGG + Intronic
1073318741 10:102600909-102600931 GAGGCATCCTGATCATCCCCTGG + Intronic
1075381442 10:122022011-122022033 GAAGCTTCCTGACACCCACCTGG - Exonic
1075418727 10:122285266-122285288 ATGGCCTCTTGAGCCTCACCTGG + Intronic
1077237324 11:1488049-1488071 TGGACGTCCTGAGCCTCACCGGG - Intronic
1077400223 11:2351971-2351993 GGGGCAGCCTGAGCCACACCTGG + Intergenic
1077554808 11:3220795-3220817 GAGGGTGCCAGTGCCTCACCTGG + Intergenic
1077555156 11:3222450-3222472 GTGGCTGCCTGGGCCTGACCGGG - Intergenic
1078543681 11:12230974-12230996 GAGGCTTTTAGATCCTCACCAGG - Intronic
1081392222 11:42542382-42542404 GAGGATTCCTGTGCATGACCAGG - Intergenic
1081522346 11:43894931-43894953 GAGGCTTCTTGAGTCTCCCCAGG + Intronic
1081859000 11:46321278-46321300 GGGACTACCTGACCCTCACCTGG + Exonic
1081881362 11:46455655-46455677 TATGCTTTCTGAGGCTCACCAGG - Intronic
1085459158 11:76682755-76682777 AGGGCTTCCTCAGACTCACCTGG + Intergenic
1085654422 11:78299821-78299843 GAGACTTCCTTAGCCTCTCTAGG + Intronic
1089364026 11:117910061-117910083 GGGGCTGCCTGAGCCTGTCCTGG - Intronic
1089579231 11:119471066-119471088 GAGGCTGGCTGAGCCTCTGCAGG - Intergenic
1091076449 11:132622556-132622578 GAGGCCTCCTGACCCACATCAGG - Intronic
1091681973 12:2533678-2533700 GAGGCTGCCCTAGCCCCACCTGG - Intronic
1103620420 12:122183786-122183808 AAGCCTTCCTGGGCCACACCTGG - Intronic
1103839178 12:123848879-123848901 GGGGCTTCATGTGTCTCACCTGG - Exonic
1104616209 12:130271420-130271442 GAAGCTTTGTCAGCCTCACCTGG + Intergenic
1104908777 12:132229611-132229633 GAGGCCGCCTGTGCCTCAGCGGG + Intronic
1105816878 13:24044121-24044143 GTGGCTGCCTGAGCCTGGCCCGG + Intronic
1111940566 13:94602179-94602201 GCGACTTCCCCAGCCTCACCTGG + Intronic
1112929137 13:104713511-104713533 GTGGCATCCTGAGCTTCACCTGG + Intergenic
1113035543 13:106043919-106043941 GAGGTTTCCTGCTCCCCACCTGG - Intergenic
1113759460 13:112837337-112837359 GAGGCTTCCTGAGCCGTCCGTGG - Intronic
1113907894 13:113828824-113828846 GAGGCCACCTGATCCTCACCTGG + Intronic
1113907948 13:113829008-113829030 GAGACCACCTGATCCTCACCTGG + Intronic
1113907971 13:113829100-113829122 GAGGCCACCTGATCCTCACCTGG + Intronic
1113907998 13:113829192-113829214 GAGACCACCTGATCCTCACCTGG + Intronic
1113908021 13:113829284-113829306 GAGGCCACCTGATCCTCACCTGG + Intronic
1113908033 13:113829330-113829352 GAGACCACCTGATCCTCACCTGG + Intronic
1113908080 13:113829512-113829534 GAGACCACCTGATCCTCACCTGG + Intronic
1113908122 13:113829696-113829718 GAGTCCACCTGATCCTCACCTGG + Intronic
1113908135 13:113829742-113829764 GAGTCCACCTGATCCTCACCTGG + Intronic
1113908149 13:113829788-113829810 GAGGCCACCTGATCCTCACCTGG + Intronic
1118842429 14:69523261-69523283 GAGGCTGCCTCAGAATCACCTGG - Intronic
1118842555 14:69524116-69524138 GAGCCCTCCTGAGCCCCATCAGG + Intronic
1119730881 14:76950514-76950536 CAGGCATCCTGAGCAGCACCAGG - Intergenic
1121121126 14:91376538-91376560 GAGCCTCCCTGTGCCCCACCAGG - Intronic
1121254564 14:92521631-92521653 GAGGCTTCCTGAGCCTCACCAGG + Intronic
1121312311 14:92941782-92941804 GAAGCTTGCTGTGCCTCAGCAGG + Exonic
1121569405 14:94936207-94936229 CTGGCTTCCTGAGCCTCTGCTGG - Intergenic
1121949991 14:98163423-98163445 GATGCTTCCTTCGCCTCAACGGG - Intergenic
1122199044 14:100110951-100110973 GCTGCTTCCTGAGCCCTACCAGG - Intronic
1122277990 14:100605059-100605081 GCAGCTTCCACAGCCTCACCCGG - Intergenic
1122600222 14:102917656-102917678 GAAGTTTGCTGAGCCTCACCTGG + Intergenic
1123050797 14:105541048-105541070 GCGGCTCCGTGAGCCTCATCAGG + Intergenic
1124177349 15:27438851-27438873 GGAGCTTTCTCAGCCTCACCTGG + Intronic
1126351055 15:47745198-47745220 CAGGCTTCCTGGTACTCACCTGG + Intronic
1127397573 15:58554962-58554984 CATGCTTTCTGAGGCTCACCAGG - Intronic
1127979510 15:64024361-64024383 CAGGCTTTCTGAGCCTCCCCAGG - Intronic
1128783517 15:70378478-70378500 GTGGCTCCCTCAGCCTCGCCTGG - Intergenic
1129848642 15:78779588-78779610 GGGGCTCCCTGAGCCTCCCTGGG + Intronic
1130253281 15:82314358-82314380 GGGGCTCCCTGAGCCTCCCTGGG - Intergenic
1132372340 15:101307595-101307617 GAGGCTTCCCGCAGCTCACCTGG + Intronic
1132390676 15:101436162-101436184 GGGCCTTCCTGAGCCACAGCAGG - Intronic
1132691913 16:1185536-1185558 TAGGCTTTCTGAGCATCTCCAGG - Intronic
1132696506 16:1204508-1204530 GAAGCCTCCTGAGACTCCCCAGG - Intronic
1134510951 16:14846476-14846498 GAGGGTTCCTGGGCTCCACCTGG + Intronic
1134698594 16:16244967-16244989 GAGGGTTCCTGGGCTCCACCTGG + Intronic
1134973241 16:18549706-18549728 GAGGGTTCCTGGGCTCCACCTGG - Intronic
1136483965 16:30559279-30559301 GAGGCGTCCTGAGCAGCACATGG - Intergenic
1138699838 16:58850882-58850904 GAGGCTTCCTAGGCCTCAGAGGG - Intergenic
1140254608 16:73324190-73324212 GAGGCTTGCTGAAATTCACCTGG + Intergenic
1140894731 16:79314839-79314861 GAGCCTCCCTGAGCCTCCTCAGG + Intergenic
1140992950 16:80232010-80232032 GCCTCTTCCTGAGCCTCACTCGG + Intergenic
1141169563 16:81682624-81682646 GTGCCTTCCTGAGCCCCGCCTGG - Intronic
1141542709 16:84738465-84738487 GAGGCTTCCTGAGACACACATGG + Intronic
1141621860 16:85240551-85240573 GAGGCTCTCTGAGCCTCACCTGG + Intergenic
1142198226 16:88748579-88748601 CAGGCTGCCAGAGCCTCAGCAGG + Intronic
1144484257 17:15651836-15651858 GAGGCAGCCTGAGCCTGAGCCGG - Exonic
1144524907 17:15981021-15981043 GAGTCTTCCCCATCCTCACCAGG + Exonic
1144745603 17:17612137-17612159 AAGGCTTCCTGAGAAGCACCAGG - Intergenic
1145302238 17:21648826-21648848 GAGGCTTCCTGCACCCCACATGG + Intergenic
1147624381 17:41890342-41890364 GAGTCTTTCTGAGCCTCCTCTGG + Intronic
1150416902 17:64995397-64995419 GAGGCTTCCGCAGCCTCCCGAGG + Intergenic
1150794766 17:68228528-68228550 GAGGCTTCCGCAGCCTCCCAAGG - Intergenic
1151380966 17:73725564-73725586 GCAGCTTCCTTAGCCTCATCAGG - Intergenic
1151451799 17:74202745-74202767 CAGGCTTCCCAAGCCTCCCCAGG + Intergenic
1151983308 17:77526897-77526919 GAGGCTCTCTGAGCCACACAAGG + Intergenic
1157918604 18:51693889-51693911 GATGGTTCCTGAGTCACACCTGG + Intergenic
1158954358 18:62524360-62524382 GAGGCTCCGTGCGCCTTACCTGG - Exonic
1159065646 18:63565312-63565334 GAGAAGTCCTGAGCCACACCAGG - Intronic
1160103625 18:75947767-75947789 GATGCTGCCTCAGCCTCAGCTGG + Intergenic
1160505366 18:79423653-79423675 CCTGCATCCTGAGCCTCACCCGG + Intronic
1160986449 19:1841156-1841178 GGGGGTCCCTGAGCCTCACGGGG - Intronic
1161057557 19:2198318-2198340 GAGCCATCCTGAGCCTCTGCAGG - Intronic
1161965150 19:7543625-7543647 GAGGCTTCCTGACTTTCAGCTGG - Intronic
1161981263 19:7631660-7631682 GAGGCATCCTGGGTCTCACTCGG - Exonic
1162853819 19:13452783-13452805 CAGCCTTCCTGAGCCTGGCCCGG + Intronic
1163398120 19:17075871-17075893 GAGGCTGCCTGGTACTCACCTGG - Exonic
1164500480 19:28815344-28815366 GGGGCTGCCTGAGCCACAGCTGG + Intergenic
1165064467 19:33220984-33221006 GAGGCTACCTGGGTCTCCCCGGG - Intronic
1165305684 19:35000999-35001021 GGGGCTTCCTGCGTCTCTCCAGG + Intronic
1167277088 19:48545259-48545281 GAGGTTGCCTGAGCCTCAAGGGG + Intergenic
925413708 2:3655211-3655233 CAGGCTTCCGGAACTTCACCTGG + Intergenic
926137645 2:10347723-10347745 GAGGCTTCCTGTGTTTCACGGGG + Intronic
926418503 2:12674495-12674517 GACGTTTCCTGAGCATCAGCAGG - Intergenic
931228459 2:60353575-60353597 GAGGTTTCCTGAGCCTCAGCTGG - Intergenic
932346043 2:70995563-70995585 GAGGGTTCCTGAGGGGCACCTGG + Intergenic
932417649 2:71583512-71583534 GAGGCTTCCTGGGGCTGAGCAGG - Intronic
933571973 2:84024748-84024770 CAGGATTCCTAAGCCTTACCAGG - Intergenic
934781195 2:96970751-96970773 GTAGCTTCCTGAGCCCCCCCAGG + Exonic
935425471 2:102914093-102914115 GATGCATCCACAGCCTCACCAGG - Intergenic
935530086 2:104221579-104221601 CAGGCTTCCTTAGCCACCCCAGG - Intergenic
936093191 2:109513945-109513967 GAGGCTGCCTGGGCTCCACCCGG - Intergenic
937125914 2:119474882-119474904 CAGGCCTCCTGAGCCTCCACAGG - Intronic
942110251 2:172674826-172674848 TGGGCTTCCTGAGCCTCTCCCGG + Intergenic
944128407 2:196319334-196319356 GAGGCTTCCTCATTCTCAACAGG + Exonic
944852932 2:203738500-203738522 GAGACTTTCTGAGCCTCAAATGG - Exonic
946122983 2:217532643-217532665 GAGGCCTCCCCAGCCTCACATGG + Intronic
948354027 2:237362761-237362783 GAGGCTTCCTCATTCTCCCCAGG - Intronic
1171462030 20:25303400-25303422 GTGGCCTCCTGAGCCTGACGTGG + Intronic
1172104530 20:32508769-32508791 GGAGCTACCAGAGCCTCACCAGG + Intronic
1172167779 20:32909464-32909486 GAGGAATCCTTAGCCTCGCCTGG + Intronic
1172939217 20:38643371-38643393 GAGCTATCCTGGGCCTCACCAGG + Intronic
1173671818 20:44804306-44804328 TAACCTTCCTGAGCCTCATCTGG - Intronic
1174367814 20:50067050-50067072 GGCTCTTCCTGAGCCTCCCCTGG + Intergenic
1174380201 20:50151379-50151401 CAGGCATTCTGAGCCTCCCCAGG - Intronic
1175072243 20:56344328-56344350 GAGGCTTCCTGAGCCACGGCTGG - Intergenic
1175297803 20:57921220-57921242 GAGGATTGCTCATCCTCACCAGG + Intergenic
1175949787 20:62577149-62577171 GAGCCTTCCTGACCCCCAGCCGG - Intergenic
1176091623 20:63320894-63320916 GAGACTTCCAGACCCGCACCTGG - Intronic
1178408814 21:32347418-32347440 GAGCCTGCCTGAGACACACCTGG - Exonic
1179515048 21:41900529-41900551 GGGGCTTCCTGAGCCCCTCCAGG - Intronic
1179992155 21:44953676-44953698 CTGGCCTCCTGAGCCACACCTGG - Intronic
1180259670 21:46660596-46660618 GAGACTTCCTGAGCCTGACCTGG - Intronic
1180729559 22:17971369-17971391 GAGGCCTCCTCAGCCTCAGCAGG + Intronic
1180954080 22:19733660-19733682 GAGGGTTCCTGTACCCCACCAGG - Intergenic
1181285943 22:21752623-21752645 GAGGCTTCGGGGGCCTCACAGGG + Intergenic
1181626122 22:24123397-24123419 GAGGCTACCTGAGGCACACTTGG - Intronic
1181778683 22:25177966-25177988 GCGTCTTCCAGAGCCACACCAGG - Intronic
1181846976 22:25718378-25718400 GAGGCTGCCTTAGACTTACCCGG - Exonic
1182833239 22:33320853-33320875 GAGGCTGCCAGTGACTCACCGGG - Intronic
1183069644 22:35387173-35387195 CAGGCTGCCCGACCCTCACCTGG - Exonic
1183319037 22:37154035-37154057 CAGGCTTCCTGTGTCTGACCTGG - Intronic
1184685409 22:46094579-46094601 GGGGCTGCCTGAGCCTCCCAAGG - Intronic
1184758843 22:46533561-46533583 GCGGGTTCCTGAGGCTCTCCAGG + Intronic
1185208074 22:49551592-49551614 GATGACTCCTGAGCCTCACAGGG + Intronic
950155465 3:10718346-10718368 GAAGCTTCCTGTGCCTACCCGGG + Intergenic
950814509 3:15686112-15686134 GAGGCGTCCTGAGCAACAACAGG + Exonic
951537591 3:23753747-23753769 GAGGGTCAATGAGCCTCACCTGG - Intergenic
952213999 3:31257304-31257326 GAAGCTTCTTGGGCCACACCTGG + Intergenic
952303078 3:32121390-32121412 GAGGCTTAGTGGGCCTTACCCGG - Intronic
954116264 3:48468490-48468512 GAGGCTGCCTGATCCCCAACAGG + Exonic
954955829 3:54517701-54517723 GGGGACTCCTGAGCCTCACAGGG + Intronic
956478442 3:69648486-69648508 GTGACTTCCTGAGCCAGACCTGG + Intergenic
958194700 3:90229200-90229222 GAAGCTTCCTGAGGCACACAGGG + Intergenic
960317974 3:116201258-116201280 GATGCTGCCTGAGCTTTACCAGG - Intronic
960660456 3:120052428-120052450 AAAGATTCATGAGCCTCACCAGG + Intronic
965743573 3:171901924-171901946 GAAGCTTCCAGAGCCTCACCAGG + Intronic
966942994 3:184758676-184758698 GTGACTGCCTGAGCCTGACCCGG + Intergenic
967831393 3:193923206-193923228 GATGCATACTCAGCCTCACCAGG + Intergenic
968489257 4:881293-881315 GAGGCTGCTCCAGCCTCACCAGG + Intronic
968919907 4:3517133-3517155 CAGGCTCCCTTAGCCTGACCTGG - Intronic
969527200 4:7709879-7709901 GAGGCTCCCAGAGCCTTCCCTGG + Intronic
973271899 4:48270063-48270085 GACGCTCCCTGAAACTCACCGGG - Intergenic
977571833 4:98636997-98637019 GAGGGTTCCTAAGCCTGACAAGG - Intronic
981012028 4:139934932-139934954 CAGGTTTCCTTAGCATCACCTGG + Intronic
981952146 4:150422705-150422727 GTGGGTTCCAGAGGCTCACCTGG - Intronic
985071307 4:186169411-186169433 GAGGCCACATGTGCCTCACCTGG - Intronic
986666811 5:10111818-10111840 AGGGCTTCCTGAGCCTGGCCTGG + Intergenic
991557770 5:67914762-67914784 CAGCCTTCCTGGGCCTCACTTGG - Intergenic
992489948 5:77233146-77233168 CAAGCTTGCTGAGCCTCACAGGG - Intronic
995585287 5:113642403-113642425 GTGGCAGCCTGAGCCACACCTGG - Intergenic
1003200925 6:3959673-3959695 GAGACTTCCTGGGCATCACTGGG + Intergenic
1003318870 6:5035354-5035376 GAGACTTCCTGGGCATCACTGGG - Intergenic
1003873831 6:10420509-10420531 GGGGCTCCCGGAGCCGCACCTGG + Intergenic
1004401439 6:15292564-15292586 GGTGCTCTCTGAGCCTCACCGGG - Intronic
1006114124 6:31766226-31766248 GAGGGTTCATGAGCCTCACCTGG + Exonic
1006833415 6:36982734-36982756 GAGACTTCCTGCTCCTCACATGG - Intronic
1008343983 6:50403526-50403548 TAAGCTGCCTGAGCCTCACTTGG - Intergenic
1011496301 6:87940064-87940086 GAGGCTTCCTGAAGCTGAGCTGG - Intergenic
1011658921 6:89577268-89577290 GAGGCATAATGAGCCTCACTTGG - Intronic
1012192983 6:96303454-96303476 GTAGCTGCTTGAGCCTCACCAGG - Intergenic
1013747608 6:113364506-113364528 GAGGGTTCCTCAGCCTCCCTCGG + Intergenic
1013794410 6:113869580-113869602 GAGGCTTCCCCAGCCACACGTGG + Intergenic
1015021939 6:128487227-128487249 GTGGGTTCCTGAGCTACACCAGG - Intronic
1016461175 6:144281552-144281574 GCAGCTTCCTGGGCCCCACCAGG + Intergenic
1017207177 6:151815805-151815827 GAGCCTTGCTCAGCCTCAGCTGG - Intronic
1017993741 6:159512298-159512320 TAGGCTTCCTCAGCCACTCCAGG - Intergenic
1019117409 6:169776408-169776430 CAGGCATCATGATCCTCACCTGG - Intronic
1022840300 7:34157810-34157832 GGGGCTTCCTGAGGCTCCCACGG - Intergenic
1023048489 7:36231542-36231564 GTGTCTTCCTGAGACTCTCCTGG - Intronic
1023919783 7:44619101-44619123 GAGGCTTCCATACCCTCCCCAGG - Intronic
1023986595 7:45100737-45100759 GTGGCTTCATGAGCCACACAAGG - Intronic
1025279310 7:57615383-57615405 GAGGCTTCCTGCACCCCACATGG + Intergenic
1025305421 7:57850117-57850139 GAGGCTTCCTGCACCCCACATGG - Intergenic
1026202260 7:68224464-68224486 GAGCCTTCCAGAGCCTGGCCAGG + Intergenic
1030094733 7:105888111-105888133 CAAACTTCCTGAGACTCACCTGG - Intronic
1031560640 7:123233882-123233904 CAGGCTTCCTGGTCCACACCAGG - Intergenic
1035167419 7:156999999-157000021 GAGGCTTCCTGAGGACCCCCCGG - Intronic
1035274081 7:157736995-157737017 GAGGCTTCCCGAGTCTCCCGGGG + Intronic
1035917839 8:3644384-3644406 GAGGCTTCCAGGGCTTCTCCAGG - Intronic
1036815166 8:11896971-11896993 CAGTCTTCCTCAGCCACACCGGG + Intergenic
1039977862 8:42382556-42382578 AAGGCCTCCTGAGCGGCACCTGG + Intergenic
1045189557 8:99869331-99869353 GAGGCATCCTGCTCCTCAGCAGG + Intronic
1045292176 8:100843022-100843044 GAGGCTGCCTAAGCCCCATCTGG + Intergenic
1047401950 8:124555693-124555715 TAGGCTTTCTGAGCAGCACCAGG - Intronic
1052638085 9:31128584-31128606 GAGACTTCCTGAGCACCACTGGG - Intergenic
1055654394 9:78438772-78438794 CAGGCTTCCTCAACCTCAGCAGG + Intergenic
1057329532 9:94100290-94100312 GATGTTTCCTGAGGCTCTCCAGG - Intronic
1059333110 9:113548884-113548906 CAGGCTTCCTGAGAGTCGCCTGG + Intronic
1061407163 9:130398728-130398750 GTGGCTTCCTGAGACGCACAGGG + Intronic
1062029583 9:134356175-134356197 GAAGCTGCCTCACCCTCACCTGG + Intronic
1203745957 Un_GL000218v1:40883-40905 GAGCCTCCCTGACCCTCTCCTGG - Intergenic
1203564157 Un_KI270744v1:78599-78621 GAGCCTCCCTGACCCTCTCCTGG + Intergenic
1185636861 X:1559241-1559263 GTGGCTTCCACAGACTCACCAGG + Intergenic
1185892736 X:3835387-3835409 GTCGCTCCCGGAGCCTCACCTGG + Intronic
1185897844 X:3873807-3873829 GTCGCTCCCGGAGCCTCACCTGG + Intergenic
1185902963 X:3912238-3912260 GTCGCTCCCGGAGCCTCACCTGG + Intergenic
1187895127 X:23973535-23973557 GGAGCTGCCTGGGCCTCACCTGG + Intergenic
1187913851 X:24134812-24134834 GGAGCTGCCTGGGCCTCACCTGG + Intergenic
1188005271 X:25012510-25012532 AGCGCTTCCTGAGCCTCGCCGGG + Intronic
1189733857 X:44049414-44049436 GTGGATGCCTGAACCTCACCTGG + Intergenic
1192690110 X:73353842-73353864 CAGGCTGCCTGTGCCTCAGCAGG + Intergenic
1199474760 X:148232821-148232843 GAGGCTTTCTGGGCCTCTCCAGG - Intergenic
1199798975 X:151230783-151230805 GTTTCTTCCTGAGCCTCTCCTGG - Intergenic