ID: 1121255643

View in Genome Browser
Species Human (GRCh38)
Location 14:92528317-92528339
Sequence AACAGTACGGTGTGGTGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 76}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121255636_1121255643 26 Left 1121255636 14:92528268-92528290 CCATCGTGGCTGAGTGTAGCTGT 0: 1
1: 0
2: 1
3: 7
4: 107
Right 1121255643 14:92528317-92528339 AACAGTACGGTGTGGTGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121255643 Original CRISPR AACAGTACGGTGTGGTGGTC AGG Intronic
901413894 1:9104081-9104103 AACAGTGCTGTGTGGTCCTCAGG + Exonic
901632457 1:10654595-10654617 CACAGGACGGGATGGTGGTCAGG + Intronic
901803865 1:11725491-11725513 AACAGAAATGTGGGGTGGTCAGG + Exonic
902699051 1:18159083-18159105 GACAGCACGATGTGATGGTCAGG - Intronic
903542012 1:24101874-24101896 AACAGGACAGTGGGGTGGCCTGG + Intronic
905016551 1:34782113-34782135 CACAGTACAGTCTGGGGGTCAGG + Intronic
912445398 1:109732225-109732247 AGCAGCACTGTGTGGTGCTCAGG - Intronic
919457843 1:197840911-197840933 AACAGTATGGTCTTGTGGCCGGG - Intergenic
920338476 1:205260283-205260305 AACAGGACTCTGTGATGGTCTGG + Intronic
922755211 1:228092742-228092764 GACAGTACTGGCTGGTGGTCTGG + Intronic
1071013884 10:80971584-80971606 AACTTTATGGTGTGGTGGTTCGG + Intergenic
1084188418 11:67487601-67487623 AGCAGGCTGGTGTGGTGGTCTGG - Intronic
1086131953 11:83410219-83410241 AACAAGACGGTGTGTTGGACTGG + Intergenic
1087087082 11:94230724-94230746 CACAGTCCGGTGTGGTGGCATGG - Intergenic
1088291497 11:108243068-108243090 ATCAGTTGGGTGTGGTGGTGTGG + Intronic
1090641945 11:128737256-128737278 AATAGTGTGGTGAGGTGGTCAGG - Intronic
1091755050 12:3045847-3045869 AACAGCAGGGAGAGGTGGTCAGG + Intergenic
1105028531 12:132866402-132866424 AACATTCCGGTGTGGTGTTCCGG - Intronic
1110664487 13:78100829-78100851 AACAGTTGGGTGTGGTGGCCAGG - Intergenic
1118350903 14:64972047-64972069 AGCAGTACGATGTGCTGTTCCGG - Exonic
1120975337 14:90243257-90243279 GACAGTAAGGTGTGGGGGTTAGG - Intergenic
1121255643 14:92528317-92528339 AACAGTACGGTGTGGTGGTCAGG + Intronic
1121729621 14:96177265-96177287 AACAATGTGGTGTCGTGGTCAGG + Intergenic
1125082590 15:35692907-35692929 AAGGGTAGGGAGTGGTGGTCAGG + Intergenic
1127046819 15:55034712-55034734 AATGGGACGGTGTGGGGGTCCGG - Intergenic
1137376063 16:47952845-47952867 AGCAGTAGGGTGAGGGGGTCAGG + Intergenic
1140904106 16:79395822-79395844 AACAGTAGGGAGAGGTGGTCTGG + Intergenic
1143396243 17:6600233-6600255 ATCAGTAGTGTGTGGTGGTCTGG + Intronic
1151336226 17:73441202-73441224 AACAGGACAGGGTGGTGGTGGGG - Intronic
1152031264 17:77844978-77845000 ACCAGCACAGGGTGGTGGTCGGG - Intergenic
1155402212 18:25451152-25451174 AATAGTACGGTGTTGAGGTGTGG - Intergenic
1160850841 19:1191309-1191331 ATCAGTTGTGTGTGGTGGTCTGG - Intronic
1161670141 19:5602702-5602724 AACAGTATGGTGTGGTCCTGTGG - Intronic
1161714471 19:5867493-5867515 ATCAGTAGGGTGGGGTGGGCAGG + Exonic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1165660639 19:37577886-37577908 AACAGTACGGTCTGTGGCTCCGG - Intronic
1167037740 19:47004061-47004083 AAAAGTAGGGTGCGGTGGCCAGG + Exonic
925087919 2:1125821-1125843 GACAGTAGGGTGTGGTGTACAGG + Intronic
931417683 2:62097109-62097131 GACAGTAAGGTGTGGGGGTTAGG + Intronic
936268076 2:111026129-111026151 AACAGTACGGTATTGGGGTAAGG - Intronic
948770894 2:240250853-240250875 AACGGGACAGTGTGGTGGCCAGG - Intergenic
1170527361 20:17252654-17252676 AACAGTACTCTGTGGTGGAGTGG - Intronic
1172392761 20:34577026-34577048 AAAAGTACAGTGTGGTAGGCAGG - Intronic
1173366667 20:42392011-42392033 AGCAGTACAGTGTGGTGGCAAGG - Intronic
1174249014 20:49204269-49204291 AAAAATAGGGTGTGGTGGTGAGG - Intergenic
1174254470 20:49243952-49243974 AACACTTTGGTGTGGTGGTATGG + Exonic
1179122043 21:38556815-38556837 AACAGTCCAGTATGGGGGTCTGG - Intronic
1180951481 22:19722530-19722552 AACAGTCCGGTCTGGTGTCCAGG - Exonic
1185034545 22:48465134-48465156 AACAGTGCGGTGTGGGGGCCTGG - Intergenic
953040458 3:39251215-39251237 AACAGACCTGTGTTGTGGTCTGG + Intergenic
962845471 3:139270295-139270317 AACTGTACAGTGTGGTGAGCAGG + Intronic
965917254 3:173865048-173865070 AACTTAATGGTGTGGTGGTCTGG + Intronic
970394425 4:15651860-15651882 AAGAGTAGGCTGTGGTTGTCAGG - Intronic
977526623 4:98153723-98153745 AACACCATGGTCTGGTGGTCTGG + Intergenic
979013271 4:115397580-115397602 AAGAGTAGGGTTTGGTGGTGGGG - Intergenic
982905062 4:161057631-161057653 AATAGTATGGTTTGGTTGTCTGG - Intergenic
983632094 4:169859870-169859892 AACAGCACGGGGTGAGGGTCAGG + Intergenic
988297021 5:29378505-29378527 AAAAGCACTGTGTGGGGGTCAGG + Intergenic
999697867 5:154202339-154202361 CACAGCTCGGTGTGGTGGCCAGG + Intronic
1000328111 5:160187510-160187532 AACAGCACGGGGTGGGGGTTGGG + Intronic
1000500678 5:162045370-162045392 AACAGTACGGAGTAGTGGTGAGG + Intergenic
1002663627 5:180807280-180807302 GACAGTAGGGTATGGTGGCCTGG - Intronic
1004975257 6:20958302-20958324 AACAGCAAGGTGTGAAGGTCTGG - Intronic
1015847105 6:137532152-137532174 AAAAGCAAGGTGTGGTGGTTAGG + Intergenic
1017179242 6:151534525-151534547 GAAAATATGGTGTGGTGGTCAGG + Intronic
1018030889 6:159840715-159840737 GACAGAAATGTGTGGTGGTCAGG + Intergenic
1019993133 7:4706405-4706427 AACAGCAAGGGGAGGTGGTCAGG + Intronic
1021641779 7:22744574-22744596 CACAGCACTGTGTGGTGGTGTGG + Intergenic
1022840104 7:34156141-34156163 TACAGGACGGTCTGATGGTCAGG - Intergenic
1023995310 7:45156023-45156045 AACAGTAGGATGGGGTTGTCAGG - Intergenic
1026618930 7:71933250-71933272 AAGAGTAGGGTGAGGTGGCCAGG + Intronic
1028174214 7:87634469-87634491 AACAGTCAGGCGTGGTGGTGGGG + Intronic
1032270189 7:130398137-130398159 CACAGGCCGGTGTGGTGGCCAGG + Exonic
1032940349 7:136781329-136781351 AACAGTAGTGGGTGGGGGTCAGG + Intergenic
1041395323 8:57384384-57384406 AAGAGTTAGGTGTGGTGTTCAGG + Intergenic
1041460113 8:58102054-58102076 AAAAGTAAGATGTGATGGTCTGG - Intronic
1043674058 8:82927328-82927350 AACATTACAGAGTGGTGGTGGGG - Intergenic
1044740450 8:95321213-95321235 AACAGAAGGGGCTGGTGGTCAGG - Intergenic
1048327252 8:133449320-133449342 AACACCAAGGTGTGGAGGTCTGG + Intergenic
1049995813 9:1032638-1032660 AACAGTAGGGTGGGGTGGGGTGG + Intergenic
1055267744 9:74517421-74517443 AAAGGTACGGCGTGGTGGTGTGG + Intronic
1055428640 9:76220918-76220940 AACAGTTCTCTGTGGTGGTGGGG - Intronic
1061171848 9:128962228-128962250 AAGAGTATGGTGTGTTGGTCAGG - Intronic
1190055935 X:47181163-47181185 AACAGGAAGGTGTGGGGGTGGGG - Intronic