ID: 1121256241

View in Genome Browser
Species Human (GRCh38)
Location 14:92532401-92532423
Sequence AGGCATCTAGAGCTTAACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121256241_1121256247 12 Left 1121256241 14:92532401-92532423 CCATTGTTAAGCTCTAGATGCCT 0: 1
1: 0
2: 1
3: 6
4: 122
Right 1121256247 14:92532436-92532458 TCCTCACAACTAATCCCATGGGG 0: 1
1: 0
2: 1
3: 23
4: 129
1121256241_1121256245 10 Left 1121256241 14:92532401-92532423 CCATTGTTAAGCTCTAGATGCCT 0: 1
1: 0
2: 1
3: 6
4: 122
Right 1121256245 14:92532434-92532456 GGTCCTCACAACTAATCCCATGG 0: 1
1: 0
2: 1
3: 14
4: 96
1121256241_1121256246 11 Left 1121256241 14:92532401-92532423 CCATTGTTAAGCTCTAGATGCCT 0: 1
1: 0
2: 1
3: 6
4: 122
Right 1121256246 14:92532435-92532457 GTCCTCACAACTAATCCCATGGG 0: 1
1: 0
2: 0
3: 2
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121256241 Original CRISPR AGGCATCTAGAGCTTAACAA TGG (reversed) Intronic
901594630 1:10375159-10375181 AGGCATATAGCACTTCACAAAGG - Intronic
902789870 1:18760449-18760471 AGGCCTCTAAAGCTTACCAGTGG + Intergenic
910991059 1:93056948-93056970 ATGCATCTGGAGCTCAAGAAAGG - Intergenic
917128452 1:171714330-171714352 AGGCATTTATAGTATAACAATGG - Intronic
918684096 1:187393854-187393876 TGGAATCTTGAGCCTAACAATGG + Intergenic
918769369 1:188534690-188534712 TGGCATCTAGTGCATAAGAAGGG - Intergenic
1067141552 10:43661518-43661540 AAGCATCTAGAGGATAACACAGG - Intergenic
1070638676 10:78149848-78149870 ATGCATCTAGAGCTGAGCAGAGG + Intergenic
1071089994 10:81907038-81907060 AGGCATCTCAAATTTAACAAAGG - Intronic
1078031525 11:7756432-7756454 AGTCATGCATAGCTTAACAATGG - Intergenic
1078733300 11:13996132-13996154 AAGCACCTAGAGCCTCACAAGGG + Intronic
1079635824 11:22739263-22739285 CGGCATCTATTGCTTAAGAAAGG + Intronic
1080281504 11:30562646-30562668 AGGCACCTACAGCTTATTAAGGG + Intronic
1080426329 11:32158164-32158186 AGGCTTCTAGATCTTTTCAAAGG - Intergenic
1080972691 11:37298324-37298346 AGTCATGTATTGCTTAACAATGG - Intergenic
1083357743 11:62079721-62079743 AGGAATCTAGGGCTCAACACAGG + Intergenic
1085321694 11:75578296-75578318 AGGCATGTGGAGCTTAGCCAAGG - Intergenic
1090599490 11:128355658-128355680 AGGCATGTATTGCTTAACAATGG + Intergenic
1091017975 11:132071440-132071462 AGGCATCAAGGGCTTAATACAGG - Intronic
1095310662 12:40693114-40693136 AGGGAGCTAGATCTTAACAGAGG - Intronic
1098420157 12:70287664-70287686 TGGAATCTAGATCTAAACAAAGG - Intronic
1100859570 12:98790201-98790223 AGCCATCTTGAGCTTATGAAGGG + Intronic
1104216090 12:126735340-126735362 AGCCATAGAGAGCTTTACAAAGG - Intergenic
1109714992 13:66210205-66210227 AGGAATAAAGAGTTTAACAAAGG - Intergenic
1110352717 13:74528347-74528369 AGGCTTCTAGAGAGTAGCAAAGG - Intergenic
1112344654 13:98578900-98578922 AGTCATGTATTGCTTAACAATGG + Intergenic
1112812015 13:103229553-103229575 AGCCTTCTATGGCTTAACAATGG - Intergenic
1112946150 13:104929508-104929530 AGTCATGCATAGCTTAACAATGG + Intergenic
1114861409 14:26527950-26527972 AGGTAACTAGAGCCTAAAAACGG + Intronic
1116383406 14:44300217-44300239 AGGCACCTAGAGATAAATAATGG + Intergenic
1121256241 14:92532401-92532423 AGGCATCTAGAGCTTAACAATGG - Intronic
1123779054 15:23607364-23607386 AGGCATGTATAACTTAACCACGG - Intronic
1125839674 15:42787819-42787841 AGTCATGTATCGCTTAACAACGG + Intronic
1127222367 15:56893288-56893310 AGGTAACAAGAGCTTAATAAAGG + Intronic
1130021918 15:80238990-80239012 AGTCATGTGGTGCTTAACAACGG - Intergenic
1133186367 16:4101933-4101955 CGGCAGCTAGAGTTTAACCAGGG + Intronic
1137697331 16:50469916-50469938 AGGCAGCGACAGCTTAATAAAGG - Intergenic
1140358247 16:74323886-74323908 AGGCAGAAAGAGCTTAACCAAGG + Intergenic
1141055945 16:80814367-80814389 AGGTACCTAAAGGTTAACAAAGG - Intergenic
1142991310 17:3732944-3732966 AGGCATCTAGAGGGGAACTAGGG - Intronic
1144806988 17:17974547-17974569 AAGCACCTAGGGCTTAATAAGGG - Intronic
1145732422 17:27200887-27200909 AGGCAGCTAGAGCCACACAAGGG + Intergenic
1146227238 17:31077759-31077781 AGGCAGCTAGAGCCACACAAGGG - Intergenic
1152058925 17:78053909-78053931 AGTCATGCATAGCTTAACAATGG + Intronic
1153133876 18:1890408-1890430 AGGAATTTAGAGATAAACAAGGG + Intergenic
1155812557 18:30255901-30255923 AGGCATGCATTGCTTAACAATGG - Intergenic
1155965287 18:32029907-32029929 AAGCATCTAGAGGTTGAGAATGG + Intronic
1160309711 18:77778149-77778171 AGGTATCAAGAGCTCATCAATGG + Intergenic
1166644819 19:44524028-44524050 GGGCATCTCGAGCTTCACATTGG + Exonic
1168701655 19:58443494-58443516 AGGCCTCTAGAGCTGGACAAGGG - Intergenic
929409855 2:41685885-41685907 AGGCTTATAGAGCTTAACGAAGG - Intergenic
929771650 2:44897421-44897443 AGGCATCTCAAGTTTAACATTGG + Intergenic
933270728 2:80230197-80230219 AGGCATGCATTGCTTAACAATGG - Intronic
933632614 2:84674341-84674363 AGGGAACTGGAGCTTAGCAATGG - Intronic
934519159 2:95008516-95008538 GGGCATCCAGAGCTTGTCAAGGG - Intergenic
935153781 2:100464078-100464100 AGGCCTCTTGAGCTTTGCAACGG - Intergenic
937734588 2:125274182-125274204 AGGCACAGAGAGGTTAACAAAGG + Intergenic
939836440 2:147135137-147135159 TGGCAATTAGATCTTAACAATGG + Intergenic
939982465 2:148797841-148797863 AGGCATGTAGTACTTAAGAAGGG - Intergenic
940520772 2:154744627-154744649 AGACATCTAAACGTTAACAAGGG - Intronic
942473198 2:176284408-176284430 AAACTTCTAGAGGTTAACAAGGG - Intronic
947380560 2:229541213-229541235 AGGCATCCACAGCTGAGCAAAGG + Intronic
1181843312 22:25684400-25684422 TGGCATCTATAGCTTAATTAGGG + Intronic
951478589 3:23135134-23135156 AGGCCTCTAGAGCTTAGCAATGG + Intergenic
953936418 3:47047799-47047821 AGTCATGTATTGCTTAACAAGGG + Intronic
954005832 3:47589751-47589773 AGGCATATAGAACTTACCAAAGG - Intronic
956985863 3:74699629-74699651 AGGCACTTAGTGCTTATCAAAGG - Intergenic
962146350 3:132843952-132843974 ATGCATCTAGGACTTTACAAGGG - Intergenic
963227004 3:142872481-142872503 AGGCATGTAAAGCTTCTCAAGGG + Intronic
965007889 3:163049392-163049414 AGTCATGTATTGCTTAACAATGG - Intergenic
969095667 4:4730454-4730476 AAGCATCTGAAGCTTAACCAGGG + Intergenic
970299632 4:14667766-14667788 AGTCATGCATAGCTTAACAACGG - Intergenic
970676158 4:18452798-18452820 AGACAACTACATCTTAACAAAGG + Intergenic
971638047 4:29089074-29089096 AGGCAACTAAATCATAACAAGGG + Intergenic
980380571 4:132009844-132009866 AAGCATCTGGAGCTTAAAATTGG - Intergenic
981433997 4:144698526-144698548 AGTCATGAATAGCTTAACAATGG - Intronic
983365128 4:166776631-166776653 TGGCAGGTACAGCTTAACAAAGG + Intronic
983912446 4:173255237-173255259 AGCCATCTAGAACCTATCAAGGG - Intronic
984981985 4:185291105-185291127 AGGCATTTAGAACGTAACAGAGG - Intronic
986847232 5:11769523-11769545 ATTCTTCTAGAGCTTAAAAATGG + Intronic
988284698 5:29196752-29196774 TGGCAAATAGAGCTTTACAAAGG + Intergenic
988718528 5:33852950-33852972 AGGGGTCTAGAACTTAACAGAGG + Intronic
994004882 5:94826314-94826336 AAGCCTCTTGAGCTTCACAAAGG + Intronic
994972967 5:106766306-106766328 AGACCTCTAAAGCTCAACAAAGG + Intergenic
995233169 5:109794170-109794192 AGGCATTTGGAGCTTAACGGCGG + Intronic
996036152 5:118761423-118761445 AGGCATCTGGCACTTAATAATGG + Intergenic
1000747555 5:165053538-165053560 AGTCATGTATAGTTTAACAATGG - Intergenic
1008235477 6:49042138-49042160 AGACTTCTAGAGCATAACATAGG - Intergenic
1008628410 6:53340803-53340825 AGTCATGTATAGCTTGACAATGG - Intronic
1010054397 6:71547727-71547749 AGTTATCAAGAGCTTATCAAGGG - Intergenic
1011401812 6:86970815-86970837 AGGCTTGTTGAGCTTCACAAAGG - Intronic
1011443196 6:87408916-87408938 TGGCATGTAGAGTATAACAAAGG - Intronic
1012420326 6:99057600-99057622 AGGCATCTTGACCTTAATACAGG - Intergenic
1016155352 6:140800181-140800203 AGTCATCTAGTGCTTAAAAGGGG - Intergenic
1016520918 6:144945567-144945589 AGGTATTTTGAGCTTAACAAAGG + Intergenic
1020435542 7:8158414-8158436 AGGCATTCAGAACTTCACAATGG + Intronic
1023775559 7:43602814-43602836 AGGCAGCTGGAGCTTAAGAAAGG - Intronic
1024610573 7:51060626-51060648 AGGAATCAAGAGGTTAAAAAGGG + Intronic
1027501851 7:78961759-78961781 AGTCATGTGTAGCTTAACAAAGG + Intronic
1028368684 7:90065744-90065766 AGTCATGTATTGCTTAACAATGG - Intergenic
1029369597 7:100140306-100140328 AGCCTTGTAGAGCTTCACAAAGG + Intergenic
1030046058 7:105497120-105497142 AGCCATTTAGACATTAACAATGG + Intronic
1030448740 7:109681748-109681770 AGGAATCTACATTTTAACAATGG + Intergenic
1030711104 7:112750201-112750223 AGTCATGTATTGCTTAACAATGG - Intergenic
1033398493 7:140998900-140998922 AGTCATATATTGCTTAACAATGG + Intergenic
1034120085 7:148619151-148619173 ATGGAACTAGAGCTTTACAAAGG + Intergenic
1034604057 7:152294279-152294301 AGGCATCAAAAAATTAACAATGG - Intronic
1035577184 8:715397-715419 AGCCACCAAGAGCTTAACATGGG + Intronic
1036083672 8:5588916-5588938 AGTCATGTGCAGCTTAACAATGG + Intergenic
1039956647 8:42212504-42212526 AGGAACCTATAGCTTATCAAAGG - Intergenic
1041756448 8:61318407-61318429 AGGAATACAGAGCTGAACAAGGG + Intronic
1041995973 8:64058610-64058632 AGTCATGTGTAGCTTAACAATGG - Intergenic
1043045181 8:75314241-75314263 AGCCATCTATACCTTATCAAAGG - Intergenic
1047051085 8:121114230-121114252 AGTAATCTAGAGCTTAAGATGGG - Intergenic
1047173153 8:122514629-122514651 AGCCACCTAGAGCTTTACAGAGG - Intergenic
1047548772 8:125846864-125846886 ACGCATATATAACTTAACAATGG - Intergenic
1051049118 9:12910570-12910592 TGGCATCTAGACCTTAACCCAGG + Intergenic
1052847818 9:33352698-33352720 AAGCATCTAGTACTTATCAAAGG + Exonic
1055492838 9:76824019-76824041 AGGCATCCAGAGACTAGCAAAGG + Intronic
1055656557 9:78455482-78455504 AGTCATATACCGCTTAACAATGG + Intergenic
1058332769 9:103784503-103784525 AGGCATCAAGAGGGTAAAAAGGG + Intergenic
1058571366 9:106348947-106348969 AGGCATGTAGAGTTATACAATGG - Intergenic
1186147026 X:6635275-6635297 AGTCATCAATAGCTTAAGAATGG - Intergenic
1192128170 X:68522014-68522036 GGGCATCTGAAGCTTATCAAAGG - Intronic
1195968105 X:110447781-110447803 AGGGATGTAGAGTTTGACAAGGG - Intronic
1197396947 X:125939267-125939289 AGGCCTCTATAGCTTAAGGATGG - Intergenic
1198147424 X:133871415-133871437 AGGCATGAAGATCTTAACTAGGG - Intronic
1199229121 X:145414815-145414837 AAGCAACTAGAGCTTAATAGTGG - Intergenic
1201628182 Y:16038684-16038706 AGTCATCAATAGCTTAAGAATGG - Intergenic
1202049435 Y:20765298-20765320 AGGAAACTAGAGCTTCACTAAGG - Intronic