ID: 1121257920

View in Genome Browser
Species Human (GRCh38)
Location 14:92544654-92544676
Sequence CCTCGACTTGTGGCATGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 47}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121257914_1121257920 11 Left 1121257914 14:92544620-92544642 CCAGGGTGCCTGGGCTCTGCTCC 0: 1
1: 2
2: 7
3: 78
4: 733
Right 1121257920 14:92544654-92544676 CCTCGACTTGTGGCATGCTCTGG 0: 1
1: 0
2: 0
3: 2
4: 47
1121257915_1121257920 3 Left 1121257915 14:92544628-92544650 CCTGGGCTCTGCTCCACTCCACA 0: 1
1: 0
2: 15
3: 46
4: 487
Right 1121257920 14:92544654-92544676 CCTCGACTTGTGGCATGCTCTGG 0: 1
1: 0
2: 0
3: 2
4: 47
1121257916_1121257920 -10 Left 1121257916 14:92544641-92544663 CCACTCCACATTTCCTCGACTTG 0: 1
1: 0
2: 0
3: 5
4: 134
Right 1121257920 14:92544654-92544676 CCTCGACTTGTGGCATGCTCTGG 0: 1
1: 0
2: 0
3: 2
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121257920 Original CRISPR CCTCGACTTGTGGCATGCTC TGG Intronic
901852208 1:12022762-12022784 CCTCGAATTGCGGCTTCCTCTGG + Intronic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
913541606 1:119826348-119826370 CCTCGATTTTTGGTTTGCTCAGG + Intergenic
1075347255 10:121692308-121692330 CGTCCACATGTGGCAAGCTCAGG - Intergenic
1076813091 10:132899235-132899257 CCTGGGCATGTGGCTTGCTCAGG + Intronic
1081298390 11:41420259-41420281 CCTCTATTTGTGGCATGGTGAGG - Intronic
1081379123 11:42393462-42393484 CCTATACTTGTGCCATGCTTTGG - Intergenic
1085530543 11:77189720-77189742 CCTCGTCTTGGGGCAGGCCCTGG + Intronic
1100855909 12:98757103-98757125 CCTCTCCTTGTGGCTAGCTCAGG - Intronic
1105645978 13:22317792-22317814 CCTCTCCTTTTGCCATGCTCTGG + Intergenic
1109657134 13:65407816-65407838 CCTCTACTTCTATCATGCTCAGG + Intergenic
1109821148 13:67656958-67656980 GCAGGACTTGTGGCATGTTCGGG + Intergenic
1121257920 14:92544654-92544676 CCTCGACTTGTGGCATGCTCTGG + Intronic
1139569368 16:67801243-67801265 CAGAGAATTGTGGCATGCTCTGG - Intronic
1143496595 17:7316021-7316043 CCGTGACTCGTGGCATGCGCAGG - Exonic
1155859973 18:30885497-30885519 CTTCGACTTGTGACATACACAGG - Intergenic
1161686394 19:5704715-5704737 CCCTGACTCATGGCATGCTCAGG + Intronic
935281981 2:101526227-101526249 CCTGGTATTGTGGCATGCTTGGG + Intergenic
935737729 2:106119708-106119730 CCTCTACCTGTGGCTTGATCTGG - Intronic
936299769 2:111295694-111295716 CCTGGACCTGGGGCCTGCTCAGG - Intergenic
936398542 2:112148874-112148896 GCTGGACTTGTGGCTTGCTTTGG - Intronic
943013988 2:182489210-182489232 TCTAAACTTGAGGCATGCTCAGG - Intronic
944558995 2:200916367-200916389 CCGCTACTTGTGGGATGCTGAGG + Intronic
1175876793 20:62233998-62234020 CCTCTCCTAGTGGCATCCTCAGG - Intronic
1179619003 21:42600139-42600161 CCTCGACCTGCTGCAGGCTCAGG + Intergenic
953596238 3:44317276-44317298 CCTAGCATTGTGGCAGGCTCTGG + Intronic
954048069 3:47950017-47950039 CCTCGGCTGGTGCCATCCTCAGG + Intronic
955937956 3:64120778-64120800 CCTGGGAGTGTGGCATGCTCAGG - Intronic
968078246 3:195828873-195828895 CCTGGACTTGTGCCAGGCACCGG + Intergenic
968932558 4:3588954-3588976 CCTCTGCATGTGGCATGTTCAGG - Exonic
969484975 4:7467148-7467170 GGACCACTTGTGGCATGCTCTGG - Intronic
975230023 4:71922333-71922355 CCTTGACTAGTGGCATGGTTTGG - Intergenic
991953439 5:71969511-71969533 CCTCTACTTGTGTCATCCACTGG + Intergenic
1001970136 5:175948839-175948861 CCTGGACTCCTGGCATGCTGTGG + Intronic
1002247302 5:177894925-177894947 CCTGGACTCCTGGCATGCTGTGG - Intergenic
1007922317 6:45621435-45621457 CCCTGAATGGTGGCATGCTCAGG + Intronic
1008061394 6:47001000-47001022 CCTCCACCTGTGACATGCACTGG - Intronic
1015683339 6:135832450-135832472 CCTTGCCTTGTGTCAGGCTCTGG - Intergenic
1016870486 6:148811375-148811397 GCTAGACTTGTGGCTTGCTGTGG - Intronic
1026628518 7:72017594-72017616 CCTGGTCTTTTTGCATGCTCAGG - Intronic
1033238260 7:139655683-139655705 CCTGGACTTGTGGGTTGCTTAGG - Intronic
1035112857 7:156497801-156497823 CCTTGATCTGCGGCATGCTCAGG - Intergenic
1038269790 8:26065920-26065942 CCTCTACATCTGGCATCCTCAGG + Intergenic
1041462811 8:58130584-58130606 CCTGTTTTTGTGGCATGCTCAGG - Intronic
1051161029 9:14207489-14207511 CCTCAATTTGTGGCATGCTATGG - Intronic
1054457565 9:65442942-65442964 CCTCTGCATGTGGCATGTTCCGG + Intergenic
1057048540 9:91904334-91904356 GCTAAACTTGTGGCATCCTCAGG - Intronic
1062100735 9:134727148-134727170 GCTCGTCTTGTGGCTTGGTCTGG + Intronic
1062212794 9:135373650-135373672 CCCCGACTTGTGACAAGCTGCGG - Intergenic
1189337505 X:40179093-40179115 CCTCAACTTGTGGCAAGCCCAGG + Intergenic