ID: 1121262052

View in Genome Browser
Species Human (GRCh38)
Location 14:92573541-92573563
Sequence CTTAGATTCAAGGGAGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 346}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121262052_1121262065 30 Left 1121262052 14:92573541-92573563 CCAGCACCTCCCTTGAATCTAAG 0: 1
1: 0
2: 0
3: 31
4: 346
Right 1121262065 14:92573594-92573616 AAACTCAGGTAAGATCAAAAGGG 0: 1
1: 4
2: 16
3: 61
4: 352
1121262052_1121262064 29 Left 1121262052 14:92573541-92573563 CCAGCACCTCCCTTGAATCTAAG 0: 1
1: 0
2: 0
3: 31
4: 346
Right 1121262064 14:92573593-92573615 GAAACTCAGGTAAGATCAAAAGG 0: 1
1: 0
2: 7
3: 39
4: 267
1121262052_1121262063 16 Left 1121262052 14:92573541-92573563 CCAGCACCTCCCTTGAATCTAAG 0: 1
1: 0
2: 0
3: 31
4: 346
Right 1121262063 14:92573580-92573602 CTGTTTAGTAGCAGAAACTCAGG 0: 1
1: 0
2: 1
3: 16
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121262052 Original CRISPR CTTAGATTCAAGGGAGGTGC TGG (reversed) Intronic
900492046 1:2955155-2955177 CCTAGATGCAATGGAGGTACAGG + Intergenic
902467798 1:16628862-16628884 CTTAGAGTGGATGGAGGTGCTGG + Intergenic
902581911 1:17413132-17413154 GGTAGATTCACGGGAGGTGTTGG + Exonic
905151248 1:35930130-35930152 CTGACATTCAAGTGAGGTGGGGG + Intergenic
905470961 1:38191323-38191345 CTTGAATTCAAGGGGGGTGGTGG - Intergenic
906835837 1:49082866-49082888 CCTAGATACAATGGAGGTACAGG + Intronic
907350257 1:53823816-53823838 CTCAGATTGCAGGGAGGTGAGGG + Intronic
907439340 1:54469241-54469263 CCTAGATACAATGGAGGTACAGG - Intergenic
907584812 1:55607844-55607866 CCTAGATACAATGGAGGTACAGG + Intergenic
908006572 1:59734567-59734589 CTGAGATTCAAGGGATGCACAGG - Intronic
908047259 1:60184335-60184357 CTTAGATACAATGGGGGTACAGG + Intergenic
908309123 1:62857999-62858021 TTTAAATTCAAGGAAGGGGCAGG - Intronic
908624694 1:66027648-66027670 CCTAGATACAATGGAGGTACAGG + Intronic
909421708 1:75474134-75474156 CTAAGATTCAAGGCAGGAGATGG + Intronic
909507536 1:76410561-76410583 CTTATATTCAAGTTGGGTGCAGG - Intronic
909608016 1:77526183-77526205 CTTAGAATCAAGGCCTGTGCAGG + Intronic
909756968 1:79239314-79239336 CCTAGATACAATGGGGGTGCAGG + Intergenic
910057555 1:83050541-83050563 CCTAGATACAATGGGGGTGCAGG + Intergenic
910623816 1:89285011-89285033 CTGAGATACAATGGAGGTACAGG - Intergenic
910642631 1:89480401-89480423 CTTAGATACAATGGGGGTACAGG + Intergenic
910727033 1:90350033-90350055 CCTAGATACAATGGAGGTACAGG - Intergenic
911524988 1:98973830-98973852 TTAAGATCCAAGTGAGGTGCCGG + Intronic
911941381 1:104052161-104052183 CCTAGATACAATGGGGGTGCAGG + Intergenic
912043140 1:105417216-105417238 CCTAGATACAATGGAGGTACAGG - Intergenic
912084573 1:105982611-105982633 CCTAGATACAATGGAGGTACAGG - Intergenic
912327727 1:108784767-108784789 CCTAGATACAATGGAGGTACAGG + Intronic
912511524 1:110193324-110193346 CTTAGACTTTAGGGTGGTGCTGG + Intronic
914230615 1:145762090-145762112 CCTAGATACAATGGAGGTACAGG - Intronic
915710843 1:157896739-157896761 CCTAGATACAATGGAGGTACAGG + Intronic
916987608 1:170208150-170208172 CTTAGATACAATGGGGGTACAGG - Intergenic
918098512 1:181353743-181353765 CCTAGATTCAAGGGATGAGTGGG + Intergenic
918246914 1:182668665-182668687 CTGAGATTCAAGGTGGGAGCAGG - Intronic
918800253 1:188961550-188961572 CTTAGATACAATGGAGGTACAGG - Intergenic
918886146 1:190197485-190197507 CTTAGATACAATGGGGGTACAGG + Intronic
918935052 1:190911586-190911608 CCTAGATACAATGGAGGTACAGG + Intergenic
920808121 1:209254235-209254257 CTTAGTTTCAAGAGAGGGGCTGG + Intergenic
920900644 1:210106963-210106985 CTTAGATGCAATGGAGGTACAGG + Intronic
920928482 1:210365249-210365271 CTAACATTCAAGGGATGGGCTGG - Intronic
921610487 1:217207120-217207142 CCTAGATACAATGGAGGTACAGG - Intergenic
921934058 1:220779667-220779689 CTTAGCTACAAGGGAAGTGTGGG + Intronic
922115288 1:222607529-222607551 CCTAGATACAATGGGGGTGCAGG + Intergenic
1063481412 10:6379973-6379995 CCTAGATACAAAGGAGGTACAGG + Intergenic
1064440334 10:15347933-15347955 CCTAGCTTCAAGAGAGGTGGTGG - Intronic
1065906870 10:30262804-30262826 CCTAGATACAATGGAGGTACAGG - Intergenic
1069094950 10:64248745-64248767 CCTAGATACAATGGAGGTACAGG + Intergenic
1069226044 10:65945638-65945660 CTTGGATAAAAGGGAGATGCAGG + Intronic
1071818198 10:89253766-89253788 CTTAGATACAATGGGGGTACAGG + Intronic
1071899734 10:90107440-90107462 CCTAGATTCAATGGAGGCACAGG - Intergenic
1072591097 10:96829476-96829498 CTTACATTCTAGGGAGGGGCAGG - Intergenic
1073066869 10:100766194-100766216 CTTTGGATCAAGGGAAGTGCAGG + Intronic
1073153525 10:101328364-101328386 CCTAGATGCAATGGGGGTGCGGG - Intergenic
1073623361 10:105072070-105072092 CTGAGATTCCTGGGAAGTGCTGG + Intronic
1073990874 10:109261187-109261209 CCTAGATACAATGGAGGTACAGG + Intergenic
1075736171 10:124665957-124665979 CTTACCTGCAAGGTAGGTGCAGG - Intronic
1075826061 10:125357942-125357964 CCTAGATACAATGGAGGTACAGG + Intergenic
1076527629 10:131122298-131122320 CTTAGTTTCAAGGAAGGGGCTGG + Intronic
1077984948 11:7342349-7342371 CCTAGATACAATGGAGGTACAGG + Intronic
1078365118 11:10700066-10700088 CCTAGATACAATGGGGGTGCAGG - Intergenic
1079147513 11:17867246-17867268 CTTAGATACAATGGGGGTACAGG + Intronic
1079475549 11:20825640-20825662 CCTAGATACAATGGAGGTACAGG - Intronic
1079500168 11:21094090-21094112 CCTAGATTCAATGGGGGTACGGG + Intronic
1079511576 11:21216726-21216748 CTTAGATACAATGGGGGTACAGG - Intronic
1079556110 11:21760493-21760515 CCTAGATACAATGGATGTGCAGG + Intergenic
1079744485 11:24107412-24107434 CTTAGATACAATGGGGGTACAGG - Intergenic
1080564867 11:33498700-33498722 CCTAGATTCAAAGGGGGTGAAGG + Intergenic
1080959776 11:37145284-37145306 CCTAGATACAATGGAGGTACAGG + Intergenic
1082652004 11:55805726-55805748 CCTAGATACAATGGGGGTGCAGG + Intergenic
1082711824 11:56561717-56561739 CTAAGATACAAGGGAGTTACAGG - Intergenic
1083085124 11:60134793-60134815 CTTAGATACAACGGAGGTACAGG - Intergenic
1083324654 11:61867092-61867114 CTTAGATTCAGGGGAAGGGCAGG + Exonic
1083393548 11:62372838-62372860 GGTAGATTCATGGGAGGTGTTGG - Intronic
1083755130 11:64788235-64788257 CCTACATTCAAGGCAGGTGTTGG - Intergenic
1083987643 11:66226782-66226804 CTTAGATGCAGGGAAGGTACTGG - Intronic
1085593866 11:77790638-77790660 CCTAGATACAATGGGGGTGCAGG + Intronic
1086309830 11:85522802-85522824 CCTAGATTCAATGGGGGTACAGG - Intronic
1086375268 11:86193828-86193850 CTCAGATTTAAGGCAGGTGTGGG + Intergenic
1087255469 11:95948184-95948206 CCTAGATACAATGGGGGTGCAGG + Intergenic
1088013315 11:105030036-105030058 CTTAGTTTCAAGAAAGGTGAAGG + Intronic
1088175892 11:107052092-107052114 CTTAGATACAATGGAGGTACAGG - Intergenic
1088377468 11:109158535-109158557 CTTAGATTCAAGGGATGGGATGG - Intergenic
1090088031 11:123668355-123668377 CTCAGATTTAAGGGAGGAGGAGG + Intergenic
1091351745 11:134903369-134903391 CCAATATTCTAGGGAGGTGCTGG - Intergenic
1093324677 12:17759524-17759546 CCTAGATACAATGGAGGTACAGG + Intergenic
1094785696 12:33846262-33846284 CCTAGATACAATGGAGGTACAGG + Intergenic
1095729768 12:45493645-45493667 CTTAGATTCAGGGGGTGTGAGGG + Intergenic
1096425741 12:51501179-51501201 TTTAGATTCAGGGCATGTGCAGG + Intronic
1098676430 12:73294918-73294940 CCTAGATACAATGGTGGTGCAGG - Intergenic
1099096235 12:78378516-78378538 CCTAGATACAATGGGGGTGCAGG + Intergenic
1099407532 12:82282212-82282234 CTTAGATACAATGGTGGTACAGG - Intronic
1099694196 12:85997540-85997562 CCTAGATACAATGGAGGTACAGG + Intronic
1100038540 12:90282388-90282410 ATTAGATATAATGGAGGTGCAGG - Intergenic
1100531471 12:95465652-95465674 CTTAGGTTTGAGGCAGGTGCTGG + Intergenic
1100929028 12:99585165-99585187 CCTAGATACAATGGAGGTCCAGG + Intronic
1100973126 12:100092902-100092924 AGTAGATTTAAGGGAGGTGAGGG - Intronic
1101712510 12:107281720-107281742 CCTAGATACAATGGAGGTACAGG + Intergenic
1102447063 12:113011349-113011371 CTTAGTTTCAAGGAAGGAGTTGG + Exonic
1102876496 12:116453238-116453260 CTCAGATTCTAGAGAAGTGCTGG - Intergenic
1103779214 12:123388524-123388546 CTGTGACTCAAGGGATGTGCAGG - Intronic
1104067285 12:125316353-125316375 CTTAGAATCAGGGCAGGGGCAGG - Intronic
1104543169 12:129685983-129686005 CTTAGATACAATGGAGGTACCGG - Intronic
1104858250 12:131911919-131911941 CTGAGAGTCAACGGAGGGGCTGG - Intronic
1105672785 13:22638787-22638809 CTTTGATTCAGGTGAGGTGAGGG + Intergenic
1105884826 13:24632694-24632716 CTTAGTCTCAAGGGAGGTGATGG + Intergenic
1106929920 13:34652738-34652760 CATAGATACAATGGAGGTACAGG - Intergenic
1109721162 13:66277828-66277850 CTTAGATACAATGGGGGTACAGG - Intergenic
1109875963 13:68404983-68405005 CTTAGATACAATGGGGGTACAGG + Intergenic
1110008889 13:70306484-70306506 CCTAGATACAATGGGGGTGCAGG - Intergenic
1110496418 13:76173671-76173693 CCTAGATACAATGCAGGTGCAGG + Intergenic
1111155018 13:84310302-84310324 CCTAGATGCAACGGAGGTACAGG - Intergenic
1111268361 13:85849732-85849754 CCTAGATACAATGGAGGTACAGG + Intergenic
1112769786 13:102782475-102782497 CCTAGATACAATGGAGGTACAGG - Intergenic
1112799239 13:103092468-103092490 CTTAGATACAATGGGGGTACAGG + Intergenic
1113047439 13:106170915-106170937 CTTAGATGCCAGGGAGGGCCTGG + Intergenic
1113252836 13:108472861-108472883 CCTAGATGCAATGGGGGTGCAGG - Intergenic
1114320873 14:21546330-21546352 CCTAGATACAATGGAGGTACAGG + Intergenic
1114917699 14:27288513-27288535 CTTAGATACAATGGGGGTACAGG + Intergenic
1115085702 14:29512757-29512779 CCTAGATACAGTGGAGGTGCAGG + Intergenic
1115942306 14:38622781-38622803 CTTAGATACAATGGGGGTACAGG - Intergenic
1115989925 14:39141131-39141153 CTTAGATACAATGGGGGTACAGG + Intergenic
1116071192 14:40047599-40047621 CCTAGATACAATGGAGGTACAGG + Intergenic
1116287229 14:42988485-42988507 CCTAGATGCAATGGAGGTACAGG - Intergenic
1116780951 14:49236829-49236851 CCTAGATACAATGGAGGTACAGG - Intergenic
1117476581 14:56101756-56101778 CCTAAATTAAAGTGAGGTGCGGG + Intergenic
1117908127 14:60611479-60611501 CCTAGATACAATGGAGGTACAGG + Intergenic
1118046415 14:61975990-61976012 CTTAGATACAATGCAGGTACAGG + Intergenic
1118239698 14:64044351-64044373 CTTAGATACAATGGGGGTACAGG - Intronic
1118524068 14:66620851-66620873 CCTAGATACAATGGAGGTACAGG + Intronic
1119101164 14:71881175-71881197 CCTAGATGCAAGGGGGGTACAGG - Intergenic
1120457859 14:84755036-84755058 CCTAGATTCAATAGAAGTGCAGG - Intergenic
1120817957 14:88883101-88883123 CCTAGATACAATGGAGGTACAGG + Intergenic
1120920986 14:89755314-89755336 CCTAGATACAATGGAGGTACAGG + Intergenic
1121262052 14:92573541-92573563 CTTAGATTCAAGGGAGGTGCTGG - Intronic
1123894672 15:24816643-24816665 CTTGGCTTCTGGGGAGGTGCAGG - Intergenic
1125546924 15:40512688-40512710 CCCAGATTCAAGGGAGGTGGGGG - Intergenic
1126539234 15:49803901-49803923 CCTAGATACAATGGAGGTACAGG + Intergenic
1126873143 15:53010858-53010880 CCTAGATACAATGGAGGTTCAGG + Intergenic
1129549310 15:76430647-76430669 CTTAGATGCAATGGAGGTACAGG - Intronic
1131220999 15:90584017-90584039 ATGAGAATCAAAGGAGGTGCTGG + Intronic
1133455579 16:5939668-5939690 CCTTGACTCAAGGGAGGTGGTGG + Intergenic
1134185295 16:12080281-12080303 CTTTGATTCAAGGGTGAAGCAGG + Intronic
1135586736 16:23677606-23677628 CTTAGCTGCAAGGCAGGTGAAGG + Intergenic
1136559804 16:31032690-31032712 CTCAGATGCAAGGCAGGGGCTGG + Intergenic
1143973571 17:10813521-10813543 CTGAGATTCAAAGGATGGGCAGG + Intergenic
1146063416 17:29618558-29618580 CTGAGATGCAAGGGAGGGGAGGG + Intronic
1146451842 17:32981069-32981091 CCTAGATACAATGGAGGTACAGG + Intronic
1148169516 17:45507590-45507612 CTTGGATAGCAGGGAGGTGCTGG - Intergenic
1148800901 17:50225181-50225203 CCTAGATACAATGGAGATGCAGG + Intergenic
1149776541 17:59362426-59362448 TTTAGTATCAAGGGAGCTGCTGG + Intronic
1150400706 17:64854079-64854101 CTTGGATAGCAGGGAGGTGCTGG - Intergenic
1151002948 17:70399734-70399756 CCTAGATACAATGGAGGTACAGG - Intergenic
1152267485 17:79304797-79304819 CTAAGATTCTCGGAAGGTGCTGG + Intronic
1153262981 18:3241999-3242021 CCTAGATACAAGGGGGGTACAGG - Intergenic
1153797324 18:8636157-8636179 CTCAGCTTCAAGGGAAGGGCTGG - Intronic
1157842988 18:50976841-50976863 CTTAGATACAATGGGGGTACAGG + Intronic
1158223101 18:55169891-55169913 CTTAGATACAATGGAAGTACAGG - Intergenic
1159761223 18:72429523-72429545 CCTAGATACAATGGAGGTACAGG + Intergenic
1160627101 18:80218304-80218326 CCTAGATACAATGGAGGTACAGG + Intronic
1162184642 19:8895394-8895416 CCTAAAGTCAAGGGAGGTGGGGG + Intronic
1164489223 19:28691414-28691436 CTTAGCTTCTAGGGAGGCTCAGG - Intergenic
1165459885 19:35938055-35938077 CTTAGATTCAGGGGTGGAGAAGG - Intronic
1165732011 19:38152028-38152050 CTAGGATTTAAGGGAGGTGGTGG - Intronic
1167795294 19:51704661-51704683 CTTAGATCTAAGGGAGGAGGGGG - Intergenic
925781880 2:7388955-7388977 CCTAAATACAAGGGAGGTACAGG + Intergenic
928624081 2:33121627-33121649 CTTACATTCCATGGAGGAGCTGG + Intronic
928680047 2:33692514-33692536 CTTAGATGCAATGGGGGTACAGG + Intergenic
928725701 2:34171462-34171484 CCTAGATACAATGGAGGTACAGG + Intergenic
929608906 2:43255206-43255228 TTTAGGTTTAAGGTAGGTGCGGG + Intronic
929875889 2:45796001-45796023 CTTAGAGTGAAGGGAGATGGAGG - Intronic
930419757 2:51135554-51135576 CCTAGATACAATGGAGGTACAGG - Intergenic
930507830 2:52305909-52305931 CCTAGATACAATGGAGGTGCAGG - Intergenic
931036410 2:58248951-58248973 CTTTGATTCCAGGGAGGTTGAGG - Intergenic
932200177 2:69819742-69819764 CTGAGAATCACAGGAGGTGCAGG + Intronic
932428199 2:71657101-71657123 CCTAGATACAATGGGGGTGCAGG + Intronic
935140050 2:100344966-100344988 CCTAGATTCAATGGGGGTACAGG - Intergenic
935182547 2:100703885-100703907 TAAAGATGCAAGGGAGGTGCAGG + Intergenic
936730250 2:115374243-115374265 CTAAGATACAATGGAGGTACAGG + Intronic
936811522 2:116408212-116408234 CCTAGATACAATGGAGGTACAGG - Intergenic
937488314 2:122338979-122339001 CTTGAATCCAAGGGTGGTGCTGG + Intergenic
937620641 2:123980912-123980934 CTTAGATACAATGGGGGTGCAGG - Intergenic
938389945 2:130897203-130897225 CTTTGTTTCATGGGAGGTGAGGG - Intronic
938553097 2:132398711-132398733 CATAGCTTCAAGGTAGGGGCTGG + Intergenic
938686292 2:133741685-133741707 CCTAGATACAATGGAGGTACAGG + Intergenic
939214537 2:139219060-139219082 CCTAGATACAATGGAGGTACAGG - Intergenic
939498198 2:142948948-142948970 CTTAAATACAATGGAGGTACAGG + Intronic
940621816 2:156122231-156122253 CCTAGATACAATGGGGGTGCAGG - Intergenic
941319816 2:164040923-164040945 CCTAGATACAATGGAGGTACAGG + Intergenic
942518012 2:176773678-176773700 CCTAGATACAATGGAGGTACAGG - Intergenic
944304278 2:198161186-198161208 TTTGTATTCAAGGGAGGTCCTGG + Intronic
944800259 2:203231734-203231756 CTTAGATACAATGGGGGTGCAGG - Intergenic
946377894 2:219324826-219324848 CTCAGGTTCAAGTGAGGTGGAGG + Intergenic
946874582 2:224114828-224114850 CCTAGATACAATGGAGGTACAGG - Intergenic
947048656 2:226018110-226018132 CCTAGATACAATGGAGGTACAGG + Intergenic
947396781 2:229694711-229694733 CTTAGATACAATGGGGGTACAGG - Intronic
947442238 2:230133441-230133463 CCTAGATACAATGGAGGTACAGG + Intergenic
949068011 2:242005194-242005216 CTGAGACTCAGGGGAGGTGCCGG - Intergenic
1169593531 20:7172032-7172054 CTTGGATTCCAGGGAGGGGAAGG - Intergenic
1170313424 20:15017175-15017197 CCTAGATTCAATGGGGGTACAGG + Intronic
1171251515 20:23652722-23652744 CTGGGCTTCAAGGGAGGTGGTGG + Intergenic
1172792118 20:37512906-37512928 CTTATCTTCAAGGGTTGTGCAGG + Intronic
1173142585 20:40497217-40497239 CCTAGATTCAAGGGAAGGGACGG - Intergenic
1173320942 20:41986350-41986372 CTTAGATAAAAGTGAGGTGAGGG - Intergenic
1175195280 20:57239186-57239208 CCTAGATACAATGGAGGTACAGG + Intronic
1175904238 20:62371863-62371885 GTTAGATCCCAGGGAGGTCCCGG - Intergenic
1177267102 21:18799010-18799032 CCTAGATACAATGGAGGTACAGG - Intergenic
1177271174 21:18850890-18850912 CCTAGATACAATGGGGGTGCAGG - Intergenic
1177628858 21:23700912-23700934 CCTAGATACAATGGAGGTACAGG - Intergenic
1177981139 21:27916006-27916028 CTTAGATACAATGGGGGTACAGG - Intergenic
1178807978 21:35855246-35855268 ATTAGATGCAAGGCAGGTGGTGG - Intronic
1179513600 21:41891621-41891643 CAGAGCTTCAAGGCAGGTGCAGG - Intronic
1179915324 21:44473914-44473936 GTTAGATTCAAGTGTGGTGTCGG + Intergenic
1182505166 22:30777022-30777044 CCTAGATACAATGGGGGTGCAGG - Intronic
1182861403 22:33562581-33562603 CTCAGATTCAAGGCAGCTCCTGG - Intronic
952551980 3:34489309-34489331 GTTTGATCCAAGGGAGCTGCTGG - Intergenic
954363962 3:50136630-50136652 GTGAGATACAAGGGAGGGGCTGG + Intergenic
956246192 3:67186154-67186176 CTTAGATACAATGGGGGTACAGG + Intergenic
957738581 3:84233496-84233518 CTTAGATACAATGGAGGTACAGG + Intergenic
957981813 3:87520173-87520195 CTTAGATACAATGGGGGTACAGG - Intergenic
958550504 3:95606745-95606767 CCTAGATACAATGGAGATGCAGG + Intergenic
961417028 3:126766743-126766765 GGTAGATTCACGGGAGGTGTTGG + Intronic
961962061 3:130865292-130865314 CCTAGATACAATGGAGGTACAGG - Intronic
962045858 3:131758456-131758478 CCTAGATACAATGGAGGTACAGG - Intronic
963153425 3:142070927-142070949 CTTAGATGCAAGGGATGAACAGG + Intronic
963852987 3:150226318-150226340 CTCAGAATCAATGGAGGTGAAGG + Intergenic
964258236 3:154804467-154804489 CCTAGATACAATGGAGGTACAGG + Intergenic
964457395 3:156883284-156883306 CCTAGATACAATGGGGGTGCAGG - Intronic
965036986 3:163451805-163451827 CTCAGATACAATGGAGGTACAGG - Intergenic
965045575 3:163572898-163572920 CTTAGATACAATGCAGGTGCAGG - Intergenic
965198928 3:165631840-165631862 CTTAGATACAATGGAGGTATAGG - Intergenic
965838904 3:172881081-172881103 CCTAGATACAATGGAGGTACAGG - Intergenic
966123310 3:176547507-176547529 CTTAGATACAATGGGGGTACAGG + Intergenic
968295228 3:197571186-197571208 CCTAGATACAATGGAGGTACAGG - Intronic
968767269 4:2479189-2479211 CTTAGATACAACGGGGGTGCAGG - Intronic
970306020 4:14733575-14733597 CCTAGATACAATGGAGGTACAGG + Intergenic
971072025 4:23105130-23105152 CTTAGATACAATGGGGGTACAGG - Intergenic
971147637 4:23996145-23996167 CTTTGATTAACGGGAGGTGATGG + Intergenic
971546368 4:27891650-27891672 CCTAGATTCAATGGAGGTACAGG - Intergenic
971660385 4:29407045-29407067 CATGGATTCACTGGAGGTGCAGG + Intergenic
972242000 4:37203576-37203598 CCTAGATGCAATGGAGGTACAGG + Intergenic
972748949 4:41969461-41969483 CCTAGATACAATGGAGGTACAGG - Intergenic
973063787 4:45762995-45763017 CTTAGATACAATGGGGGTACAGG + Intergenic
974153783 4:58044156-58044178 CCTAGATACAATGTAGGTGCAGG - Intergenic
974569717 4:63628671-63628693 CCTAGATACAAGGGAGGTACAGG - Intergenic
974797189 4:66767398-66767420 CCTAGATTCACTGGAGGTACAGG - Intergenic
974876545 4:67709997-67710019 CCTAGATACAATGGAGGTACAGG + Intergenic
975686801 4:76924317-76924339 GATAGTTTCAAGGGAGGGGCTGG + Intergenic
976002814 4:80392160-80392182 CTTAGATACAATGGAGGTAAAGG - Intronic
976050828 4:81009766-81009788 CCTAGATACAATGGAGGTACAGG - Intergenic
976277249 4:83290165-83290187 CCTAGATACAATGGAGGTACAGG - Intergenic
976678211 4:87726183-87726205 CCTAGATACAATGGAGGTACAGG - Intergenic
976875522 4:89849824-89849846 CCTAGATACAATGGAGGTACAGG + Intergenic
977022084 4:91771755-91771777 CCTAGATGCAATGGAGGTACAGG + Intergenic
977093818 4:92714101-92714123 CCTAGATACAATGGAGGTACAGG + Intronic
978034570 4:103977084-103977106 CCTAGATACAATGGAGGTACAGG - Intergenic
978234845 4:106446280-106446302 CCTAGATACAATGGAGGTACAGG + Intergenic
978446956 4:108789060-108789082 GGTAGATTCATGGGAGGTGTTGG + Intergenic
978460624 4:108947560-108947582 CTTAGGTTTAAGGGATGAGCAGG + Intronic
979795659 4:124843598-124843620 CTTAGATTTAAAGTAGGGGCTGG + Intergenic
980426245 4:132630999-132631021 TTTAGATACAATGGGGGTGCAGG - Intergenic
981311613 4:143303305-143303327 CAGAGACTCCAGGGAGGTGCTGG + Intergenic
982299973 4:153868286-153868308 CCTAGATACAATGGAGGTACAGG - Intergenic
982539242 4:156646753-156646775 CTTGGATTCAAGGATGCTGCGGG + Intergenic
982618825 4:157678000-157678022 CCTAGATACAATGGAGGTACAGG + Intergenic
982987687 4:162231836-162231858 CCTAGATACAAAGGAGGTACAGG + Intergenic
983455154 4:167953725-167953747 CCTAGATACAACGGAGGTACAGG - Intergenic
987873362 5:23648212-23648234 CTTAGATACAATGGAGGTACAGG - Intergenic
988009304 5:25462307-25462329 CCCAGATACAAGGGAGGTACAGG - Intergenic
988196956 5:28016000-28016022 CTTAGATACAATGGGGGTACAGG - Intergenic
988886484 5:35563744-35563766 CCTAGATACAATGGAGGTACAGG - Intergenic
989032727 5:37136185-37136207 CCTAGATACAATGGAGGTACAGG + Intronic
989495101 5:42102574-42102596 CCTAGATACAATGGAGGTACAGG - Intergenic
991116773 5:62963905-62963927 CCTAGATACAAGGGAGGTATGGG + Intergenic
991409477 5:66332061-66332083 CCTAGATACAATGGAGGTACAGG - Intergenic
991940728 5:71849854-71849876 CCTAGATACAATGGGGGTGCAGG + Intergenic
992023624 5:72649691-72649713 CTTAGCTTCAACGGTGGTGGTGG - Intergenic
993409280 5:87554208-87554230 CCTAGATACAATGGAGGTACAGG + Intergenic
993689671 5:90984403-90984425 CTTAGATCCAAGTTAGGTGTGGG + Intronic
995220456 5:109641861-109641883 CTTAGATACAATGGGGGTACAGG - Intergenic
995698345 5:114905189-114905211 CTTAGATACAATGGGGGTACAGG + Intergenic
996177700 5:120379370-120379392 CCAAGATACAATGGAGGTGCAGG - Intergenic
997491795 5:134283839-134283861 CCTAGATACAATGGAGGTACAGG + Intergenic
997790922 5:136761322-136761344 TTTAGGTTCAAGGAATGTGCAGG - Intergenic
1000496259 5:161989172-161989194 CCTAGATACAATGGAGGTACAGG + Intergenic
1000947292 5:167437383-167437405 CTTAGATACAATGGGGGTACAGG - Intronic
1001842999 5:174895430-174895452 ATTAGATTCTAAGAAGGTGCAGG + Intergenic
1003690292 6:8346949-8346971 CTGAGATACAATGGAGGTACAGG - Intergenic
1004428484 6:15522706-15522728 CTTAGAGTGAAGGGACGTGCAGG - Intergenic
1005597710 6:27394970-27394992 CCAAGATACAATGGAGGTGCAGG - Intronic
1006240527 6:32673795-32673817 TTTAGATACAATGGAGGTACAGG - Intergenic
1007382859 6:41502058-41502080 CTTAGGTCCAAGGGAGGGGCAGG + Intergenic
1009634867 6:66252713-66252735 CCTAGATTCAATGGGGGTACAGG + Intergenic
1010061323 6:71626002-71626024 CTTAGATGCAATGGGGGTACAGG - Intergenic
1010248263 6:73682252-73682274 CCTAGATACAATGGAGGTACAGG + Intergenic
1010388403 6:75308915-75308937 CGTAGATACAAGGGAGATGTTGG + Intronic
1010900627 6:81423306-81423328 CCTAGATACAATGGAGGTACAGG - Intergenic
1012068147 6:94576815-94576837 CATAGATACAATGGAGGTACAGG + Intergenic
1012369807 6:98489891-98489913 TTTAGTTCCCAGGGAGGTGCTGG - Intergenic
1012456250 6:99409250-99409272 CTTCGATTCTGGGGAGGTGCTGG + Exonic
1012624762 6:101392693-101392715 CTTGGCTTCCAGGGAGGGGCTGG - Intergenic
1012723945 6:102784316-102784338 CCTAGATTCAATGGGGGTACAGG - Intergenic
1012732325 6:102899000-102899022 CCTAGATACAATGGGGGTGCAGG + Intergenic
1014068050 6:117150207-117150229 CCTAGATACAATGGAGGTACAGG + Intergenic
1014143524 6:117971108-117971130 CCTAGATACAATGGAGGTACAGG + Intronic
1016062100 6:139641629-139641651 CTTAAATTCAAGTGAGAGGCAGG - Intergenic
1016579807 6:145616856-145616878 CCTAGATACAATGGGGGTGCAGG - Intronic
1017679466 6:156848753-156848775 CTTAGCATGAGGGGAGGTGCCGG + Intronic
1018086200 6:160303272-160303294 CCTAGATACAATGGAGGTACAGG + Intergenic
1018649053 6:165975893-165975915 ATTAAATCCAAGAGAGGTGCTGG - Intronic
1019345352 7:526993-527015 CTTCTGCTCAAGGGAGGTGCTGG - Intergenic
1020014139 7:4821123-4821145 CTGAGCTTCGAGGGAGGCGCAGG - Intronic
1020837129 7:13167889-13167911 CCTAGATACAATGGAGGTACAGG + Intergenic
1022685686 7:32594097-32594119 CTGAGATGCAGGGGAGGAGCAGG + Intergenic
1024845529 7:53637286-53637308 CCAAGATACAAGGGAGGTACAGG - Intergenic
1024964120 7:55006513-55006535 ATTAGGCTCACGGGAGGTGCAGG - Intergenic
1026153496 7:67807989-67808011 AGTAGATTGAAGGGAGGAGCAGG + Intergenic
1027369670 7:77494710-77494732 CCTAGATACAATGGAGGTACAGG - Intergenic
1027698327 7:81437471-81437493 CTTAGCTTGCAGGGAGGTGTGGG - Intergenic
1028344470 7:89761986-89762008 CATAGATTCAAAGGAAGTGGAGG + Intergenic
1030970138 7:116046035-116046057 CCTAGATACAATGGAGGTACAGG - Intronic
1031448623 7:121886022-121886044 CTTAAATACAAGGGGAGTGCTGG + Intronic
1032205652 7:129862793-129862815 CTTTTATTCAAGGGAGATGGGGG + Intronic
1035105469 7:156438795-156438817 CTTAAATTTAAAGGAGCTGCAGG + Intergenic
1036805629 8:11830712-11830734 CTTAGATTTATGGGGAGTGCTGG + Intronic
1037108483 8:15138227-15138249 CTTAGATACAATGGAAGTACAGG - Intronic
1038655511 8:29447461-29447483 TTGGGATTCAAGGGAGGTCCTGG - Intergenic
1039522914 8:38186524-38186546 GTTAGATTCACTGGAGATGCAGG + Intronic
1039657186 8:39422951-39422973 CCTAGATACAATGGAGGTACAGG + Intergenic
1042466270 8:69132930-69132952 CCTAGATACAATGGAGGTACAGG + Intergenic
1042953509 8:74224943-74224965 CCTAGATACAATGGAGGTACAGG + Intergenic
1043993214 8:86781189-86781211 CCTAGATACAATGGGGGTGCAGG - Intergenic
1045207507 8:100057218-100057240 CCTAGATACAATGGAGGTACAGG - Intronic
1045732180 8:105255431-105255453 CCTAGATACAATGGGGGTGCAGG + Intronic
1046154626 8:110271541-110271563 ATTGAATTCAAGGGAGGTGATGG + Intergenic
1046405785 8:113770244-113770266 CTTATATACAATGGAGGTTCAGG - Intergenic
1046508069 8:115161806-115161828 CGTAGATGCAAGGGAGGTTGAGG - Intergenic
1046689145 8:117263255-117263277 CTTAGAGTTAGGGGAGGTGATGG + Intergenic
1047207187 8:122812083-122812105 CTTAGACTCGAGGGAAGTGGAGG + Intronic
1047818434 8:128490986-128491008 CTTAGCTTCTTGGGAGTTGCTGG + Intergenic
1050656018 9:7829909-7829931 CTTAAATTCAAGGCACTTGCTGG + Intronic
1050967850 9:11831425-11831447 CTTAGAACCAATGGAGGTGTTGG + Intergenic
1051990300 9:23145010-23145032 CCTAGATACAAAGGAGGTACAGG + Intergenic
1052053879 9:23882174-23882196 CCTAGATACAATGGGGGTGCAGG + Intergenic
1052452924 9:28655333-28655355 CCTAGATACAATGGGGGTGCAGG - Intronic
1052969343 9:34367487-34367509 CCTAGATACAACGGAGGTACAGG + Exonic
1055008782 9:71539947-71539969 GTTATATACAAGGGAGGTGTGGG + Intergenic
1056316681 9:85397066-85397088 CTGAGACTCAAAGGAGGTGAGGG - Intergenic
1056444916 9:86656285-86656307 CTTAGATTCCTGGGAGATGATGG + Intergenic
1059082509 9:111265498-111265520 CCTAGATACAATGGAGGTACAGG + Intergenic
1060653482 9:125351536-125351558 CCTAGATACAATGGAGGTGCAGG + Intronic
1186804975 X:13131792-13131814 CCTATAGTCAAGTGAGGTGCTGG - Intergenic
1187555273 X:20345162-20345184 CCTAGATACAATGGAGGTACAGG - Intergenic
1188624038 X:32262340-32262362 CTGGGAATCAAGGGAGGGGCAGG + Intronic
1188753742 X:33935593-33935615 CCTAGATTCAATGGAGGTACAGG + Intergenic
1189071211 X:37866124-37866146 CCTAGATACAATGGAGGTACAGG + Intronic
1189228701 X:39435219-39435241 CTTAGATACAATGAAGGTACAGG + Intergenic
1189381289 X:40504232-40504254 CTTAGTTTCAAGGGAAGAGGTGG - Intergenic
1189651730 X:43197005-43197027 CTTAGAATATAGGGAGGTGAAGG - Intergenic
1190531727 X:51385706-51385728 CCTAGATACAATGGAGGTACAGG + Intergenic
1191680093 X:63831724-63831746 CCTAGATACAATGGGGGTGCAGG - Intergenic
1192066705 X:67892205-67892227 CTAAGATACAATGGAGGTACAGG - Intergenic
1193153537 X:78148697-78148719 CCTAGATACAATGGAGGTACAGG - Intergenic
1193279044 X:79626081-79626103 CCTAGATACAATGGAGGTACAGG + Intergenic
1193439067 X:81516124-81516146 CCTAGATACAATGGAGGTACAGG - Intergenic
1194332553 X:92601030-92601052 CCTAGATACAATGGAGGTACAGG - Intronic
1194864996 X:99054438-99054460 CCTAGATACAATGGAGGTACAGG - Intergenic
1196526013 X:116727725-116727747 CCTAGATACAATGGAGGTACAGG - Intergenic
1197004637 X:121481148-121481170 CCTAGATACAATGGAGGTACAGG - Intergenic
1197160479 X:123317470-123317492 CTTAGATACAATGGAGGTACAGG + Intronic
1197581985 X:128294814-128294836 CCTAGATACAATGGAGGTACAGG - Intergenic
1198188572 X:134280789-134280811 CCTAGATACAATGGAGGTACAGG - Intergenic
1198612600 X:138418455-138418477 CTTAGATACAATGGGGGTACAGG - Intergenic
1198679464 X:139165915-139165937 CCTAGATACAATGGAGGTACAGG - Intronic
1198996451 X:142578899-142578921 CCTAGATACAATGGAGGTGCAGG - Intergenic
1199566181 X:149217685-149217707 CCTAGATACAATGGAGGTACAGG - Intergenic
1199879471 X:151961753-151961775 CTTAAATTCTAGCGAGGTCCAGG - Intronic
1199928522 X:152494602-152494624 CCTAGATACAATGGAGGTACAGG - Intergenic
1200641253 Y:5720082-5720104 CCTAGATACAATGGAGGTACAGG - Intronic
1201433885 Y:13935325-13935347 CTTATATTCATGGGAGGTGATGG - Intergenic
1201748939 Y:17411761-17411783 CTAATCTTCAAGGGTGGTGCAGG - Intergenic