ID: 1121262389

View in Genome Browser
Species Human (GRCh38)
Location 14:92575969-92575991
Sequence TGGCCAAGGTTGCTGAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 210}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121262389_1121262396 16 Left 1121262389 14:92575969-92575991 CCTTTCTTCAGCAACCTTGGCCA 0: 1
1: 1
2: 0
3: 14
4: 210
Right 1121262396 14:92576008-92576030 AACGCTAACCCAGAAGCTTGGGG 0: 1
1: 0
2: 0
3: 2
4: 69
1121262389_1121262401 26 Left 1121262389 14:92575969-92575991 CCTTTCTTCAGCAACCTTGGCCA 0: 1
1: 1
2: 0
3: 14
4: 210
Right 1121262401 14:92576018-92576040 CAGAAGCTTGGGGCTGGAGTGGG 0: 1
1: 0
2: 7
3: 84
4: 866
1121262389_1121262395 15 Left 1121262389 14:92575969-92575991 CCTTTCTTCAGCAACCTTGGCCA 0: 1
1: 1
2: 0
3: 14
4: 210
Right 1121262395 14:92576007-92576029 AAACGCTAACCCAGAAGCTTGGG 0: 1
1: 0
2: 0
3: 9
4: 87
1121262389_1121262394 14 Left 1121262389 14:92575969-92575991 CCTTTCTTCAGCAACCTTGGCCA 0: 1
1: 1
2: 0
3: 14
4: 210
Right 1121262394 14:92576006-92576028 CAAACGCTAACCCAGAAGCTTGG 0: 1
1: 0
2: 0
3: 16
4: 220
1121262389_1121262400 25 Left 1121262389 14:92575969-92575991 CCTTTCTTCAGCAACCTTGGCCA 0: 1
1: 1
2: 0
3: 14
4: 210
Right 1121262400 14:92576017-92576039 CCAGAAGCTTGGGGCTGGAGTGG 0: 1
1: 0
2: 5
3: 90
4: 840
1121262389_1121262397 20 Left 1121262389 14:92575969-92575991 CCTTTCTTCAGCAACCTTGGCCA 0: 1
1: 1
2: 0
3: 14
4: 210
Right 1121262397 14:92576012-92576034 CTAACCCAGAAGCTTGGGGCTGG 0: 1
1: 0
2: 2
3: 15
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121262389 Original CRISPR TGGCCAAGGTTGCTGAAGAA AGG (reversed) Intronic
900115905 1:1027832-1027854 TGGCCAAGGTGGCTGCCAAACGG - Intronic
900489561 1:2940430-2940452 TGGAAAAGGTTACTTAAGAAAGG + Intergenic
900629908 1:3628988-3629010 TTGCCTAGGTTGCTGAAAACAGG + Exonic
901290619 1:8121426-8121448 TTGCCAAGGCTACTGAACAAAGG - Intergenic
902197509 1:14808593-14808615 CGGCCAAGGTTTCTAAATAATGG + Intronic
903194400 1:21674010-21674032 AGACCAAGGTTGCTGCAGAAGGG - Intergenic
903997334 1:27315692-27315714 TGTACAAGGTTGCTGAACACTGG + Intergenic
906443821 1:45875678-45875700 TGGCCGAGCTTGATGAATAATGG + Intronic
907700146 1:56778218-56778240 TGGGAAAGTTGGCTGAAGAAGGG - Intronic
911101161 1:94096789-94096811 TGGCCAAGGTGCTTCAAGAAGGG + Intronic
911304172 1:96212716-96212738 TGGCAGATGTTGCTGAATAATGG - Intergenic
911499966 1:98673422-98673444 TGGAGCAGGTTGCTGAATAAAGG - Intronic
912106747 1:106287319-106287341 TGGCCAAATTAACTGAAGAATGG + Intergenic
912866159 1:113258641-113258663 TGGCCAAGATTGATGAGCAATGG - Intergenic
915895214 1:159806739-159806761 TGGCCAAGACTCCTGAGGAAGGG - Intronic
917220967 1:172727976-172727998 CTGCCAAGGTGGCTGAAGAGGGG - Intergenic
917774715 1:178321030-178321052 TAGAAAAGGTTGGTGAAGAATGG - Intronic
919490499 1:198199290-198199312 TGGTCAAGGTGACTGAACAAAGG - Intronic
923230845 1:231984800-231984822 TGGCCAAGACAGCTGAGGAAAGG + Intronic
1063581128 10:7308541-7308563 TGTCCAAGGATGCTGGAGATGGG + Intronic
1064058557 10:12118257-12118279 AGGCGCATGTTGCTGAAGAAGGG + Intronic
1070348337 10:75567277-75567299 TGGAAAAGGTGGCTGAAGGAAGG - Intronic
1072398291 10:95068338-95068360 TGGCCAAGGTTGCTGGAGAATGG - Intronic
1074508259 10:114090451-114090473 TGGCAAAGATTGCAAAAGAAGGG - Intergenic
1074661962 10:115669763-115669785 TGACCAAAGTTGTAGAAGAAAGG - Intronic
1076441633 10:130484656-130484678 TGGCCCAGGCTGCTGAGGGAGGG + Intergenic
1076847443 10:133076231-133076253 TGCCCAAGGTGGGGGAAGAAGGG - Intronic
1076981000 11:204751-204773 TGGCCATGGTTGCTGAGCATGGG - Exonic
1078862766 11:15266729-15266751 TGGAAAAGGTCTCTGAAGAAAGG + Intergenic
1079027606 11:16961246-16961268 TGACCAAGGCTCCAGAAGAAAGG + Intronic
1079719189 11:23789220-23789242 TGAACAATGTTGCTGAAGAGAGG - Intergenic
1081002649 11:37694326-37694348 TGGAGAAGGTTGCAGAAGTAGGG - Intergenic
1081992747 11:47346535-47346557 GGGCCAAGGGAGCTGAAGAGGGG + Intronic
1082014464 11:47474245-47474267 AGGCCAGGGTGGCTGGAGAATGG - Intronic
1089843621 11:121440805-121440827 TGGTTAAGTTTGATGAAGAATGG - Intergenic
1090085067 11:123643238-123643260 AGGCCCAGGATGCTGAAGCATGG + Intronic
1090095716 11:123740618-123740640 GGACCAAGGTTGTTCAAGAAAGG + Intronic
1091514234 12:1162166-1162188 TGGCCAAGCGTGCTGTACAATGG + Intronic
1092306866 12:7310424-7310446 TAGCTGAGGTAGCTGAAGAATGG + Intronic
1094443349 12:30503556-30503578 TGCCCAAGGTGACTGAAGAAAGG - Intergenic
1095969354 12:47891152-47891174 TGGCCCAGGTAGCTGGACAAAGG - Intronic
1096109898 12:49022360-49022382 AGGCAGAGGTTGCAGAAGAAGGG + Intronic
1098617132 12:72540595-72540617 TGGTCAGGTTTGCTGAAAAATGG + Intronic
1099547115 12:83998173-83998195 TGTCCAAGGCAGCAGAAGAAAGG + Intergenic
1101527455 12:105544630-105544652 TGGGCAAGGCAGCTGTAGAATGG + Intergenic
1101866784 12:108526238-108526260 TCCCCACGGTTGCTGAAGATGGG + Exonic
1105643195 13:22287396-22287418 AGGCCAAAGATGCAGAAGAAGGG - Intergenic
1106182256 13:27380017-27380039 TGGCCCAGGTTGCTGGAGCACGG + Intergenic
1107617480 13:42185339-42185361 TGGCCAAAGGAGCTGAGGAAGGG - Intronic
1111623621 13:90755384-90755406 TGGCCACGGTTGCGGGAGTAAGG - Intergenic
1112135666 13:96575233-96575255 TGGCATAGCCTGCTGAAGAATGG + Intronic
1112196593 13:97232526-97232548 TTGCCAAGGTTACAGAATAAGGG + Intronic
1115209375 14:30949850-30949872 TGGCCAAGGGTTATGAAAAAAGG + Intronic
1116244766 14:42395382-42395404 TTGCCAAGATTGCTGGAGATGGG + Intergenic
1116382610 14:44290056-44290078 TGGCCTGAGTTGGTGAAGAAAGG - Intergenic
1119098909 14:71861399-71861421 TGGCCAATTTTGCAGAAGTAAGG - Intergenic
1119760400 14:77146687-77146709 TGGCCCAGGCTGCAGAAGAGAGG + Intronic
1119940104 14:78631670-78631692 TGTGCAAGGTAGCTGCAGAAAGG - Intronic
1121262389 14:92575969-92575991 TGGCCAAGGTTGCTGAAGAAAGG - Intronic
1121312665 14:92943595-92943617 TGGAGGAGGTTGCTGGAGAATGG - Intronic
1123428292 15:20191317-20191339 AAGCCAGGGTTCCTGAAGAAAGG + Intergenic
1126654578 15:50963101-50963123 TTGCCAAGGATGCAGAAAAAAGG + Intronic
1128260694 15:66230964-66230986 TGGGCAAGGCTGCTGTAGGAAGG - Intronic
1129769061 15:78192181-78192203 TTGCCAAGGCTGCTGGAAAAGGG - Intronic
1130253423 15:82315031-82315053 GGGCCAAGAGTGCTGAAGACAGG - Intergenic
1130624667 15:85501758-85501780 AAGCCTAGGTTTCTGAAGAAAGG - Intronic
1130809391 15:87360548-87360570 TAGCCAAGGCTGCTGAGAAATGG - Intergenic
1133744401 16:8675587-8675609 TGGCCAGGGTGGGTGAGGAAAGG - Intronic
1133843017 16:9427531-9427553 TGGTCATGATTTCTGAAGAATGG + Intergenic
1136482033 16:30548073-30548095 TGGTCAAGGGTTCTGAGGAACGG + Intronic
1136856026 16:33658434-33658456 AAGCCAGGGTTCCTGAAGAAAGG - Intergenic
1137738258 16:50741317-50741339 TTCCCAAGGATGGTGAAGAAGGG - Intergenic
1137831887 16:51551797-51551819 TGGCTAAGGGCTCTGAAGAAAGG + Intergenic
1138200850 16:55087342-55087364 GGGCCCCTGTTGCTGAAGAAGGG - Intergenic
1140784265 16:78325027-78325049 TGGCCAAGGAATCTGAGGAATGG - Intronic
1141850324 16:86640683-86640705 GGGCCACGGTTGCTAGAGAATGG - Intergenic
1203117612 16_KI270728v1_random:1506913-1506935 AAGCCAGGGTTCCTGAAGAAAGG - Intergenic
1142524957 17:533621-533643 TGGCGAAGGCAGCAGAAGAAAGG - Intronic
1142637095 17:1264484-1264506 TGGCCAAGCTGGCTGGGGAAAGG + Intergenic
1143253120 17:5537252-5537274 TGGCCAATGTTGGGGTAGAAAGG - Intronic
1143921823 17:10336394-10336416 AGGCCAAGATGGCTGGAGAAAGG - Intronic
1145811957 17:27769644-27769666 TGGCCAGGTTTCCAGAAGAAAGG - Intronic
1147553736 17:41463278-41463300 AGACAAAGGTTGCAGAAGAAAGG - Intronic
1147803708 17:43113844-43113866 AGGCCAAGGTAGCTGAAGTCAGG + Intronic
1148031134 17:44621878-44621900 TGGGCAAAGCTGCAGAAGAATGG - Intergenic
1148711772 17:49687097-49687119 TGGCCAGGGTTGCTGGAGCAAGG - Intergenic
1150445488 17:65224701-65224723 AGGCCAAGGATGCTGGAGTATGG - Intronic
1151140759 17:71990052-71990074 TTGCCAAGGTGGCGGAAAAAGGG - Intergenic
1151787705 17:76283330-76283352 AGGCCAAGGTGGCTAAAGATGGG + Intronic
1151887058 17:76929211-76929233 TGGCCAAAGATGATGAAGCAGGG + Intronic
1153140802 18:1970586-1970608 TGGAGAAAGTTGCTTAAGAAGGG + Intergenic
1153672412 18:7424525-7424547 CTGTCAAGGTTGCAGAAGAAAGG - Intergenic
1154272663 18:12933319-12933341 TGGAGAAGGTGGCTGCAGAATGG - Intergenic
1155360696 18:24997931-24997953 TGGCAGAGGATGCTGAAGCAAGG - Intergenic
1155570570 18:27187753-27187775 TATCCAAGGTTGATGAATAAAGG + Intergenic
1157699721 18:49753595-49753617 TGGCCAAGGTTGTTGATGAGAGG - Intergenic
1158878729 18:61755863-61755885 TGGCCAAATTTGCTGGAGACTGG - Intergenic
1160318033 18:77866292-77866314 TGGCAATTGTTTCTGAAGAAAGG - Intergenic
1160704069 19:521319-521341 TGGCAAAGATAGCAGAAGAAGGG + Intergenic
1165125275 19:33591179-33591201 GGGTCAAGGTTGCTGAAGACTGG - Intergenic
1166416501 19:42598556-42598578 TGGCCATCGTTGCAGGAGAAAGG + Intronic
1168562894 19:57398130-57398152 AGGCCATGGTTGCTGGAGACTGG - Intronic
926684881 2:15690908-15690930 AAGCCAAGGTTGTGGAAGAAAGG - Intronic
927091899 2:19718845-19718867 GGGCCCAGGTTGCTCAAGGAGGG + Intergenic
928473402 2:31597758-31597780 TGGCCAATCTTGCTGGAGTAAGG - Intergenic
930573512 2:53116442-53116464 TGGCCAAGGATGCGGTATAATGG - Intergenic
935179019 2:100673972-100673994 TGGCCCAGGATGCTACAGAAGGG - Intergenic
935534656 2:104279977-104279999 TGTCCAAGTTTTCTGAAGCAGGG + Intergenic
935688603 2:105709949-105709971 TTGCAAAGATTGCAGAAGAAGGG - Intergenic
937218470 2:120327583-120327605 TGGCCAAGGGGGCTGGAGCATGG - Intergenic
937264596 2:120607937-120607959 TGGCCCAGGTTCCCCAAGAATGG - Intergenic
938849815 2:135249104-135249126 TGGGCAAGGTTGCAGAGAAAAGG + Intronic
938858139 2:135337271-135337293 GTGCCAAGCATGCTGAAGAAAGG - Intronic
939290500 2:140188279-140188301 TGGCCACTGTTCCTGAAGTATGG - Intergenic
939302152 2:140357841-140357863 TGGCAAAGGTTTTTGAAAAAGGG + Intronic
939562136 2:143744637-143744659 TGTACAAGGATGCTGAATAAAGG - Intronic
939568281 2:143810597-143810619 TGACCAAGATTGCTTTAGAAGGG - Intergenic
940889525 2:159021880-159021902 AGGCCAAGTTTGAGGAAGAATGG + Intronic
941133050 2:161677960-161677982 TGAGCATGGTAGCTGAAGAAAGG - Intronic
942562007 2:177229727-177229749 AGGACAATGTGGCTGAAGAAAGG - Intronic
946361795 2:219223396-219223418 TGGCCAAGCTCCCTTAAGAAAGG - Intronic
948367386 2:237465996-237466018 TGGCCAGGGTTGCTGCTGATCGG - Intergenic
1168811263 20:706258-706280 AGGCCAAGGTGGCTGGAGCAGGG + Intergenic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1169833248 20:9848950-9848972 TGGTCATGGTTGCAAAAGAAGGG + Intergenic
1170125553 20:12959649-12959671 TGGTCAAGGATGTTGCAGAAAGG - Intergenic
1170126234 20:12967364-12967386 TGGTCAAGGATGTTGCAGAAAGG - Intergenic
1172034620 20:32002248-32002270 AGGCCAGGGTTGCTGAGGAGAGG - Exonic
1174755223 20:53152004-53152026 AGGGCAAGGTTGCTGTAAAATGG + Intronic
1175144642 20:56886332-56886354 TTGCCAATGTTGCTGTACAAGGG + Intergenic
1176511988 21:7755656-7755678 AGGCCATGGTGGCTGAGGAATGG - Intronic
1178646101 21:34386182-34386204 AGGCCATGGTGGCTGAGGAATGG - Intronic
1179914251 21:44466379-44466401 TGGCCAAGGTTGCTAGAGAGGGG + Intergenic
1180961148 22:19762959-19762981 AGGCCAAGGTTGCCGAAGGTGGG + Intronic
1181823572 22:25494765-25494787 TGGGCAAGCCAGCTGAAGAAAGG - Intergenic
1182920567 22:34075467-34075489 TAGCCAAAGATGCTGAACAAAGG + Intergenic
1184392827 22:44214797-44214819 GGGCCATGGCTGCTGAAGAAAGG - Intronic
1185083245 22:48721249-48721271 TGGCCCAGGCTGCTCTAGAATGG - Intronic
949500017 3:4670869-4670891 TGGCTCAGGATGCTAAAGAAGGG + Exonic
949862262 3:8516447-8516469 TGGTCAACGTGGCTGAGGAAAGG - Intronic
950582665 3:13872692-13872714 TGGCCATGGTTGTAGAAGAGAGG - Intronic
951560920 3:23965952-23965974 TAGCCAAGGATCCTGAAGCAAGG - Intronic
952385147 3:32835647-32835669 TGACCAAGGATGGTGAAGGAAGG - Intronic
952975821 3:38695014-38695036 TGGCAAAGATTGCTGAAGCTAGG - Intergenic
954077315 3:48190392-48190414 AGGTCAAGGTTGCTGGAGAAGGG + Intergenic
955091217 3:55752503-55752525 TTGCCAAGACTGCTGAACAAGGG + Intronic
955095223 3:55790396-55790418 TGGCCAGGGCTGCTAAAGCAGGG - Intronic
955794101 3:62617762-62617784 TTACTTAGGTTGCTGAAGAAAGG + Intronic
955981103 3:64528649-64528671 TGGCCAAGGTGACTAAGGAAGGG - Intronic
958815853 3:98914646-98914668 TGGCCAGGGTTGCTGAGCATTGG - Intergenic
959989209 3:112612149-112612171 TGTCCAAGGTTTCTTAGGAAAGG + Intronic
961410507 3:126716910-126716932 GGGCCAAGATTGCTGTAGAAAGG - Intronic
964081157 3:152759615-152759637 TGGCCAAAGTGGCAGAAGATGGG - Intergenic
964376700 3:156055101-156055123 GGGCCAAGGTTGCTGATGGGTGG - Intronic
964386233 3:156150984-156151006 TGGGCATGGCTGGTGAAGAAAGG + Intronic
966078252 3:175965233-175965255 TTGGCAAGGCTGCAGAAGAAAGG - Intergenic
968891719 4:3372949-3372971 AGGCCATGGTCGCTGAGGAAGGG + Intronic
969315973 4:6381474-6381496 TGACCCAGGTTGCTGGAGCATGG - Intronic
970178682 4:13364953-13364975 TTGCTAAGGTTTCTGAAAAAAGG - Intronic
970215494 4:13755074-13755096 TGGCCATTGTTGCAGAAGTAAGG + Intergenic
970217016 4:13769898-13769920 TGGCCAATGTTGCAGGAGTAAGG + Intergenic
970700615 4:18733514-18733536 TGGACAAGGCTTCTAAAGAAGGG + Intergenic
970977829 4:22061213-22061235 TGTCCAAGGTGGATGAAGAGAGG + Intergenic
971209756 4:24604329-24604351 TGGACAAGGTTGCAGATGACTGG + Intergenic
971894358 4:32572598-32572620 TAACCAAGGTTTCTGAAAAAAGG + Intergenic
972003235 4:34065737-34065759 TGGCCAAGGTTGCTAAGTGAAGG - Intergenic
978227312 4:106352895-106352917 TGCCTAGGATTGCTGAAGAATGG + Intergenic
980766004 4:137305070-137305092 TGGCCAAGGCAGCTGAAGGTAGG - Intergenic
981562961 4:146067074-146067096 TGGCCAAAGTTGCTATACAAGGG - Intergenic
983282418 4:165697430-165697452 TGGCCAGGGTTGTTGAACTATGG + Intergenic
984499459 4:180540547-180540569 TTGCCATGGATGCTGTAGAAGGG - Intergenic
987170471 5:15252066-15252088 TGGCCATTCTTGCAGAAGAAAGG - Intergenic
988087552 5:26490767-26490789 TTTCCAAGGTCGCTGAAGCAAGG - Intergenic
988464848 5:31478838-31478860 TGGCCAAGTTTTCTCTAGAAAGG - Intronic
989274209 5:39568151-39568173 TGGCATAGGTTGCTGTAGCAAGG - Intergenic
991045818 5:62221650-62221672 AAGCCAGGGTTCCTGAAGAAAGG + Intergenic
991964451 5:72077303-72077325 AGGCCAAGGTGCCTGAAGGAAGG + Intergenic
993774834 5:91980391-91980413 TAGCTATAGTTGCTGAAGAAAGG + Intergenic
993918873 5:93775345-93775367 TGGCCATGGGTGCTGGAGAATGG - Intronic
994092510 5:95821693-95821715 AAGCCAAGGATGCTGAAGAGAGG + Intronic
996016213 5:118536985-118537007 TGTTTAAGCTTGCTGAAGAAAGG + Intergenic
996138537 5:119875240-119875262 TGGCAAAGGTAGCAGAAGATTGG + Intergenic
1000437007 5:161224723-161224745 TGGGCGGGGTTGCGGAAGAAAGG + Intergenic
1005851921 6:29828717-29828739 CGGCCAATGTGGCTGAACAAAGG + Exonic
1007298204 6:40844969-40844991 TGGCCTAGGGTACTGAAGGAAGG + Intergenic
1009859599 6:69309975-69309997 GGGCCAAGGTTGAGGAAGACAGG - Intronic
1015751226 6:136561264-136561286 TGGGGAAGGTTGTTGGAGAAGGG - Intronic
1015844630 6:137507274-137507296 AGGCCAATGTGGCTGAAGTAGGG + Intergenic
1017991931 6:159497302-159497324 CTGGCAAGGTTGCTGAGGAAAGG + Intergenic
1018851560 6:167644161-167644183 TGGCCAAAGTTGCTTAGGAGTGG - Intergenic
1018896723 6:168024642-168024664 TGGCCAAGGATGGAGAAGAAAGG + Intronic
1024111471 7:46151349-46151371 TAGCCACTGTTGCTAAAGAATGG - Intergenic
1027977897 7:85182652-85182674 TGGCCATGTTTCCTGGAGAAAGG + Intronic
1028822092 7:95224100-95224122 AGGTGAAGGTAGCTGAAGAATGG - Intronic
1031082824 7:117274892-117274914 TGGCCAAGCTTGGTGATCAAGGG - Intergenic
1032417411 7:131747009-131747031 TGGACAGAGTTGATGAAGAAGGG - Intergenic
1032948649 7:136881882-136881904 TGGCCATGGCTGCTGAAGATTGG - Intronic
1033228045 7:139576247-139576269 TTGCCAAGGGGGCTGAAGAGTGG + Intronic
1034801228 7:154057901-154057923 TAGACAGGGTTGCTAAAGAATGG + Intronic
1037422357 8:18716515-18716537 TGGCCAGGGTGGCTGAAGCTTGG + Intronic
1037665304 8:20963898-20963920 TGGCCAAAGTTGGTGAGGTAGGG + Intergenic
1042452638 8:68966601-68966623 GGGCCAAGGTAGCTGCAGAGGGG - Intergenic
1043714017 8:83458972-83458994 CCTCCAAGGTTACTGAAGAAGGG - Intergenic
1045095383 8:98792263-98792285 TGGCCATTGTTGCAGAAGTAAGG - Intronic
1045756899 8:105554392-105554414 CAGCCAAGGTGGCTGAAGTATGG - Intronic
1046870970 8:119205627-119205649 TGCCCAGGGTTGCTGAAAGAAGG - Intronic
1049488491 8:142878750-142878772 CGGCCAAGGTTGGTGCAGAGCGG + Intronic
1050230163 9:3515611-3515633 TGGGGGAGGTTGCTGTAGAAGGG - Intronic
1051847667 9:21470721-21470743 TGTCCAAGGTTGCCATAGAATGG - Intergenic
1052794232 9:32908261-32908283 TAGCCAAGATTCCTGAAGAGAGG + Intergenic
1057005266 9:91551794-91551816 TATCCAAGGTTTCTGCAGAAGGG + Intergenic
1058670172 9:107354658-107354680 AGTCCAAAGTTGGTGAAGAAAGG + Intergenic
1060995317 9:127872448-127872470 AGGCCAGGGTGGCTGAAGGATGG + Intronic
1186038422 X:5449327-5449349 TGTCCTAGGTTGTGGAAGAAAGG + Intergenic
1186776822 X:12873059-12873081 GGGCCAATATTGCTGAAGCAGGG - Intronic
1187483768 X:19682811-19682833 TGGGCAAGGTTGCTGAGGGCGGG + Intronic
1189134523 X:38534536-38534558 TGGCCAGGGTTGGGGAAGGAAGG - Intronic
1189612635 X:42753448-42753470 TAGCCAAGGTTGCTGAACACAGG - Intergenic
1190337759 X:49272675-49272697 TGGGCAAGGTAACTGAAGCATGG + Intronic
1193558846 X:82992198-82992220 TTAGCAAGGTTGCTGAACAAAGG - Intergenic
1193853050 X:86563055-86563077 TGGTCTAGGTTTCTTAAGAAAGG + Intronic
1193994722 X:88351384-88351406 TGGCCATTCTTGCTGAAGTAAGG - Intergenic
1195097269 X:101515112-101515134 TGGATAAAGTTGCAGAAGAAAGG - Intronic
1198218847 X:134581404-134581426 TAGCTTGGGTTGCTGAAGAAAGG + Intronic
1201075638 Y:10185270-10185292 TGGCCATGGTTTTTGAAGATGGG + Intergenic
1201559204 Y:15298277-15298299 GGGAGAAGGTTGTTGAAGAAAGG - Intergenic