ID: 1121262631

View in Genome Browser
Species Human (GRCh38)
Location 14:92577515-92577537
Sequence CGGCAGCAGCAGCAGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1272
Summary {0: 2, 1: 3, 2: 40, 3: 230, 4: 997}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121262628_1121262631 6 Left 1121262628 14:92577486-92577508 CCATCTTCTCTGTTTTCACTTTG 0: 1
1: 0
2: 7
3: 104
4: 965
Right 1121262631 14:92577515-92577537 CGGCAGCAGCAGCAGCAGAGAGG 0: 2
1: 3
2: 40
3: 230
4: 997
1121262627_1121262631 7 Left 1121262627 14:92577485-92577507 CCCATCTTCTCTGTTTTCACTTT 0: 1
1: 0
2: 6
3: 95
4: 916
Right 1121262631 14:92577515-92577537 CGGCAGCAGCAGCAGCAGAGAGG 0: 2
1: 3
2: 40
3: 230
4: 997

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121262631 Original CRISPR CGGCAGCAGCAGCAGCAGAG AGG Intronic
900161361 1:1225516-1225538 CAGCAGCCGCAGCAGCCCAGAGG + Intronic
900237557 1:1599986-1600008 CAGCAGCAGCAGCAGCGGCGGGG + Exonic
900320172 1:2079640-2079662 CGCCATCAGCAGCAGCCGCGGGG - Intronic
900341125 1:2189860-2189882 CTCCAGCGGCAGGAGCAGAGAGG - Intronic
900408780 1:2503720-2503742 GGGCCCCAGCAGCAGCAGGGTGG + Intronic
900504875 1:3024959-3024981 CGCCCCCAGCAGCAGCAGTGAGG - Intergenic
900652157 1:3735003-3735025 CGGCAGCAGCAGCAGACTCGGGG + Exonic
900750835 1:4396269-4396291 AGGCAGCAGGTGCAGCAGAAAGG + Intergenic
901401039 1:9015187-9015209 GGTCAGCAGCTGCAGCAGGGCGG + Exonic
901511633 1:9720734-9720756 CCGCAGCTGCAGCTGCTGAGGGG - Exonic
901565723 1:10113190-10113212 CGAGAGCAGGAGCAACAGAGAGG + Intronic
901683541 1:10930278-10930300 GGGCGGCAGCAGCAGCAGAAGGG + Intergenic
902139024 1:14336005-14336027 CGGAAGTAGCAGCAGAGGAGAGG + Intergenic
902150763 1:14441380-14441402 CAGCAGCAGCAGCAGCACCTGGG + Intergenic
902783922 1:18721025-18721047 CGGGAGCAGCAGCAGCAGGCAGG + Intronic
902995803 1:20223762-20223784 CGCCAGCAGGAGTAGCACAGGGG - Intergenic
903115642 1:21176610-21176632 CGGCAGCAGCAGCCGCCCCGCGG + Intronic
903349849 1:22711005-22711027 CAGCGGCAGCAGCAGCAGCGCGG - Exonic
903510073 1:23868227-23868249 GAGCAGCAGCAGCAACAGCGCGG + Exonic
903770137 1:25758616-25758638 CGGCAGCAGCAGCATCTTGGCGG + Exonic
903958341 1:27040409-27040431 AGGCAGCTGCAGCAGCTGAGAGG - Intergenic
904028862 1:27521553-27521575 CATCAGCAGCAGCAGCAGCAGGG - Intergenic
904152467 1:28453568-28453590 GGGCAGCAGAGGCAGCACAGTGG + Intronic
904563622 1:31414191-31414213 CTGTAGCTGCAGCCGCAGAGGGG + Intronic
904591812 1:31619165-31619187 CAGGAGCCGCTGCAGCAGAGGGG - Exonic
904642018 1:31938178-31938200 CCGCAGCAGCAGCAGCAAGACGG - Exonic
904797857 1:33070958-33070980 CAGCAGCAGCAGCTGGAGAAAGG + Intronic
904940765 1:34164061-34164083 CGGCAGCGGCAGCGGCGGCGCGG - Intronic
904961963 1:34340425-34340447 CAGCAGCAACAGCAGCACAGGGG - Intergenic
905172090 1:36115367-36115389 CGGCAGCAGCGGCAGCAGGAGGG + Intronic
905387112 1:37612792-37612814 CAGCAACAGCAGCAGCAGCAAGG - Exonic
905534398 1:38708949-38708971 GAGCAGCAGCAGCAGCATCGCGG - Intergenic
905805731 1:40875907-40875929 CAGCAGCAGCAGCAGCAATGTGG - Intergenic
905824073 1:41016137-41016159 CAGCAGCAGCTGCAGCAGCACGG - Exonic
906209680 1:44005595-44005617 CAGCAACAGCAGCACCAGACGGG + Intronic
906278548 1:44536687-44536709 TGGTGGCGGCAGCAGCAGAGGGG - Intronic
906960831 1:50418739-50418761 CCGCAGCAGCGGCGGCCGAGCGG + Exonic
907011496 1:50968200-50968222 AGGCAGCAGCAGCCGCAGCCTGG + Exonic
907372853 1:54014294-54014316 TGCCAGGAGGAGCAGCAGAGAGG + Exonic
907488075 1:54790758-54790780 CAGCAGCAGCAGCAGCAGCCAGG - Intronic
907534500 1:55137544-55137566 CTCCAGCAGCAGCAGCAGTGGGG - Exonic
907803331 1:57793507-57793529 CCTCAGTACCAGCAGCAGAGAGG - Intronic
907971641 1:59388503-59388525 AGGCAGCAGCAGGAGAAGAAGGG + Intronic
908107185 1:60856939-60856961 CAGCAGAAGCAGCAGCAGCAGGG + Intergenic
908825979 1:68133064-68133086 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
908854110 1:68405321-68405343 CAGCAGCAGCAGCAGCAATACGG + Intergenic
908959625 1:69680116-69680138 CAGCAGCAGCAGCAGCATCTGGG + Intronic
909079120 1:71087720-71087742 TGGCAGCAGCAGCAGCCAACTGG - Intergenic
909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG + Intergenic
909344887 1:74573169-74573191 AGGGAGCAGCAGAAGCAGAAGGG - Exonic
909678406 1:78263724-78263746 CAGCAGCAATAGCAGCACAGTGG - Intergenic
910171862 1:84386495-84386517 CAGCAGCAGAGGTAGCAGAGGGG + Intronic
910333676 1:86104857-86104879 TGCCAGCAGCAGCGGCCGAGTGG + Intronic
910514014 1:88037573-88037595 TGGCAGCAGCAGTGGCAGAAGGG - Intergenic
910674101 1:89800008-89800030 TTGCAGCAGCAGCAGCAAAGGGG + Intronic
911017242 1:93346184-93346206 CGGCGGCGGCAGCGGCAGCGGGG + Exonic
911357938 1:96844445-96844467 GTGCAGCTGCAGCAACAGAGAGG + Intergenic
911539847 1:99145418-99145440 CAACAGCAGCAGGAGCACAGTGG - Intergenic
912487161 1:110038297-110038319 TGGCAGTGGCAGCAGCAGATGGG - Intronic
912611674 1:111052924-111052946 CATTAGCAGCAGCAGCAGTGTGG - Intergenic
912721541 1:112024600-112024622 CAGCAGCAGCAGCAGCTAATGGG - Intergenic
913334712 1:117698594-117698616 CCGAAGCAGCAGCAGGAGAGAGG + Intergenic
913609614 1:120497271-120497293 CTGCAACAGCAGCTGGAGAGCGG - Intergenic
914337235 1:146726082-146726104 AGGCAGAATCAGGAGCAGAGTGG + Intergenic
914581576 1:149024573-149024595 CTGCAACAGCAGCTGGAGAGCGG + Exonic
914826687 1:151142574-151142596 CAGCAGCAGCAGTAGCAGCAAGG + Exonic
915143901 1:153783484-153783506 CGGAAGCAGCCGCAGCCCAGCGG - Intergenic
915191870 1:154157604-154157626 AGGGAGGAGCAGCAGCAGGGTGG + Intronic
915200116 1:154221009-154221031 CGGCGGCGGCAGCGGCAGCGCGG + Intronic
915316827 1:155033447-155033469 AGGCAGCAGCAGGAGGACAGTGG + Exonic
915319095 1:155046385-155046407 CACCACCAGCAGCAGCAGAATGG - Exonic
915393155 1:155562436-155562458 CGGCGGCGGCAGCAGCAGAGTGG + Exonic
915409300 1:155688325-155688347 CGGCAGCGGCGGCAGCAGAGTGG + Exonic
915528902 1:156492178-156492200 GGGCGGCAGCAGCAGGAGGGAGG + Intronic
915815774 1:158963162-158963184 CTGCAGCAGCAGTGGCAGAGGGG - Intronic
916059208 1:161087282-161087304 CTGCTGCAGCAGCAGCAGAGTGG + Intronic
916059537 1:161089234-161089256 CAGTAGCAGCAGCAGCAGCCAGG + Exonic
916203626 1:162294960-162294982 CAGCAGCAGCAGCAGTGGTGAGG - Intronic
916456104 1:164972443-164972465 AGGCAGCAGCAGAGGCAGAAGGG - Intergenic
916562609 1:165946154-165946176 CGGCAGCAGTAGCAGCAGCAAGG + Intergenic
917109839 1:171536050-171536072 TGGCAGCAGCAGCAACAGCAAGG + Exonic
917208240 1:172601162-172601184 CAGCAGGAGCAGAAGCAGACAGG + Intronic
918257675 1:182764363-182764385 CGGCAGGAGCACCTGCACAGAGG - Intergenic
918826984 1:189336888-189336910 TGCCAGCAGCAGCAGCAGTGTGG - Intergenic
918936014 1:190923342-190923364 GGCCAGCAGCATCATCAGAGTGG + Intergenic
919678382 1:200409588-200409610 CGGCGGCAGCAGCGGCAGGAGGG - Exonic
919776483 1:201197427-201197449 CTGCAGCAGCGGCAGCAGCCTGG - Intronic
919787425 1:201268705-201268727 CAGCAGCAGCTGCTGCAGGGAGG + Intergenic
919812150 1:201415475-201415497 CAGCAGCAGCAGAATCAGAGTGG - Intronic
919976285 1:202615176-202615198 ATGAAGCAGCAGCAGCAGATTGG + Intronic
920034453 1:203056811-203056833 CAGCAGCAGCAACAGCAGCCAGG + Exonic
920178225 1:204116662-204116684 CGGCAGCAGCAGGAGCAGGTAGG + Exonic
920335349 1:205241613-205241635 CAGCAGCATCAGCAGCAGCAGGG + Exonic
920504539 1:206507087-206507109 CGGCACCATCAGCGGGAGAGTGG + Intergenic
920600780 1:207321821-207321843 CAGCACCAGCAGCAGCAGCCGGG - Exonic
920857597 1:209675627-209675649 CAGGAGGAGCAGCAGGAGAGGGG - Intronic
921104270 1:211959964-211959986 CAGCAGCAACAGCAGCATAACGG - Intronic
921291822 1:213664490-213664512 CAGTAGCAGCTGCAGCAGAAGGG - Intergenic
921764430 1:218953501-218953523 CAGCAGCAGCAGCAGCAGGAGGG + Intergenic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
921812362 1:219529419-219529441 GAGCAGCAGCAGCAGCAGCAGGG + Intergenic
921872026 1:220151708-220151730 CGTGAGCACCAGCAGCTGAGAGG + Exonic
922180231 1:223227650-223227672 CAGCAGCACCAGCAGCACACTGG + Exonic
922327741 1:224544669-224544691 CAGCAGCCTCAGCAGCACAGCGG - Intronic
922665562 1:227465764-227465786 GGGCACAGGCAGCAGCAGAGAGG + Intergenic
922872322 1:228912842-228912864 CAGCAGCAGCAGCAGCTATGTGG - Intergenic
923119712 1:230978802-230978824 CAGCAGCAGCAGCAGCCGGCAGG + Exonic
923256583 1:232226640-232226662 CAGCAACAGCAGCAGCAGCCTGG + Intergenic
923318577 1:232805790-232805812 GGGCAGCTGCAGCAGCAAGGTGG - Exonic
923506290 1:234609196-234609218 TTGCAGCAGCAGCAGCAGCTTGG - Exonic
924141183 1:241025253-241025275 TGGCAGCAACATCAGTAGAGGGG + Intronic
924458129 1:244234421-244234443 CAGCAGCAGCAGCAGCAGCCAGG - Intergenic
924624400 1:245687450-245687472 GCTCAGCAGCAGCAGCGGAGAGG + Exonic
924628678 1:245716643-245716665 CAGCAGCTGAAGCAACAGAGAGG + Intergenic
924706285 1:246505432-246505454 CAGCAGCAGCAGCAGCACCAGGG + Intronic
1063093552 10:2889769-2889791 CGGCAACAGAAGCTGCACAGAGG + Intergenic
1063275130 10:4557657-4557679 CGGTAGCAGCAGCTCCAGGGAGG + Intergenic
1064000631 10:11661203-11661225 AGGCACCAGCAGGAGCAGGGGGG + Intergenic
1064103805 10:12484790-12484812 CCACAGGAGCAGCTGCAGAGTGG - Intronic
1064230824 10:13528595-13528617 CGGCAGCGGCAGCGGCGGCGCGG + Intronic
1064337957 10:14460566-14460588 AAGCAGCAACACCAGCAGAGAGG + Intronic
1064519023 10:16181816-16181838 AGGCAGCAGCATCAGGAAAGAGG - Intergenic
1064645341 10:17454199-17454221 CAGCAGCAGCAGCAGCAGGCTGG + Exonic
1065712750 10:28533211-28533233 CGGCAGCAGCGGCGGCGGCGGGG + Intronic
1065879618 10:30027567-30027589 CAGCAGCAGCAGCAGCAGTGAGG - Exonic
1065927273 10:30446033-30446055 AGGCAGCAGCAGCCGCTGAAGGG - Intronic
1066022736 10:31319444-31319466 CGGCAGCGGCGGCAGCGGAGGGG - Intronic
1066156457 10:32683709-32683731 CTGCAGCAGCAATGGCAGAGGGG + Intronic
1066224090 10:33365491-33365513 CGTCAGTAGCAGAAGCAGAGAGG + Intergenic
1066364596 10:34764569-34764591 CGGCAGCTGCTGGAGCTGAGTGG + Intronic
1066469697 10:35686710-35686732 CCGCATCAGCAGCAGCAAACTGG - Intergenic
1067017451 10:42768793-42768815 CAGCAACAACAGCAGCAGAAAGG - Intergenic
1067298767 10:44991250-44991272 CGCCAGCACCAGCAGCTTAGGGG + Intronic
1067531522 10:47077593-47077615 CGGCAACACCAGCAGCTGAGAGG - Intergenic
1067560356 10:47300692-47300714 CAGCAGCAGCAGCAGCAGCTGGG - Exonic
1067724481 10:48759539-48759561 CAGCAACAGCAGCAGCAGCCAGG - Intronic
1067849580 10:49746162-49746184 CGGCAGCAGCACCAGCCGGGTGG + Intronic
1068053533 10:51982804-51982826 CAGCAGCAGCAGCAGTGTAGTGG + Intronic
1068090794 10:52430215-52430237 CGGCAGCATCAGCAGCAAGTGGG + Intergenic
1068097612 10:52511645-52511667 CAGCAGCAGCAGGACCAGAGAGG + Intergenic
1068130494 10:52889819-52889841 TGGCTGCAGCAGCACCAGGGAGG - Intergenic
1068218347 10:54011190-54011212 CTGCAGCAGCAGTGGTAGAGGGG - Intronic
1068919401 10:62466349-62466371 CACCAGCTGCTGCAGCAGAGTGG - Intronic
1069336779 10:67360703-67360725 TGGCAGGAGCAAGAGCAGAGAGG + Intronic
1070160772 10:73865577-73865599 CAGCAGCAGTGGCAGCAGAGGGG + Intronic
1070215521 10:74375676-74375698 CCTCAGCAGCACCAGGAGAGTGG + Intronic
1070527802 10:77310268-77310290 CAGCAGCAGGGGCAGCTGAGGGG - Intronic
1070570642 10:77637722-77637744 CGGCAGCAGTAGCAGCAATATGG - Intronic
1070692845 10:78540507-78540529 CAGCAGAAGCAGCTGCACAGGGG + Intergenic
1071052823 10:81472885-81472907 CTGCAGCAGCAGCGCCAGATGGG - Intergenic
1071358023 10:84817959-84817981 CAGCAGCAGCAGCAGCATGAGGG + Intergenic
1071397456 10:85237969-85237991 GAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1071432881 10:85619922-85619944 CGGCAACAGCATCAGCAGCAAGG - Exonic
1071611722 10:87038202-87038224 CGGCAGTGGCAGCAGCAGCATGG + Intergenic
1072047590 10:91672226-91672248 TAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1072054404 10:91740251-91740273 TGCCAGCAGCACCAGCAGAATGG + Intergenic
1072242442 10:93509418-93509440 GGCCAGCAGCAGCAGCAGCTAGG - Intronic
1072336611 10:94403285-94403307 CAGCAGCTGCAGCAGTAGCGAGG + Exonic
1072562199 10:96586773-96586795 CAGCAGCAGCAGCCACAGCGCGG + Exonic
1072642703 10:97224523-97224545 CAGCAGCAAAAGCAGCAGAAAGG + Exonic
1073103553 10:101019523-101019545 AGGCAGAAGCAGAAGCAGAAGGG - Intronic
1073432807 10:103497636-103497658 GGGAATCACCAGCAGCAGAGTGG - Intronic
1073535094 10:104269183-104269205 CGGCGGCAGCAGCAGCAAGGAGG - Exonic
1074731356 10:116379869-116379891 CGGTGGCAGCAGGAGCAAAGTGG - Exonic
1074906603 10:117869660-117869682 CCTCTGCAGCAGCAGGAGAGTGG - Intergenic
1074944890 10:118271758-118271780 CCTCAGCAGAAGCAGCAGGGAGG - Intergenic
1074979248 10:118606439-118606461 GGGCAGCAGCAGCAGCATCTGGG + Intergenic
1075179381 10:120196306-120196328 TGACAGCAGCAGCAGCAGGTGGG + Intergenic
1075438470 10:122461669-122461691 CAGCAGCAGCGGGAGAAGAGCGG - Exonic
1075651301 10:124129568-124129590 CAGAGGCAGCAGCTGCAGAGTGG - Intergenic
1075667328 10:124240529-124240551 CCCCAGCAGCAGCAGGAGATTGG - Intergenic
1076140872 10:128077734-128077756 CAGAAGCAGCAGCAGCAGACAGG + Exonic
1076317235 10:129551082-129551104 GGGCAGCTGCAGCACCAGGGTGG + Intronic
1076372957 10:129966865-129966887 GGGCAGGAGCAGCAGCAGAGGGG + Intergenic
1076758402 10:132587362-132587384 TGGCAGCAGCAGAAGCAGGCTGG - Intronic
1076814936 10:132909944-132909966 CAGCTGCTGCAGCAGCAGATTGG - Exonic
1077063347 11:627108-627130 GAGCAGCAGCAGCAGCAGGAGGG + Exonic
1077103310 11:831635-831657 CAACAGCAGCAGCAGCAGGTGGG - Exonic
1077103683 11:832976-832998 CGGCGGCGGCAGCAGCTGCGGGG - Exonic
1077370013 11:2177445-2177467 CAGCAGCAGTAGCAGAAGGGGGG - Intergenic
1077370016 11:2177448-2177470 GGGCAGCAGCAGTAGCAGAAGGG - Intergenic
1077976914 11:7256292-7256314 CAGCAGCAGCAGCAGCTGCTGGG + Intronic
1078074796 11:8148794-8148816 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1078210355 11:9265213-9265235 CGGCAGCCGCGGCGGCCGAGGGG - Exonic
1078474926 11:11622005-11622027 CGGCAGCGGCAGCGGCGGCGGGG + Exonic
1078544571 11:12237748-12237770 CAGGAGCAGCAGCAGCAGCTGGG + Intronic
1079121448 11:17688149-17688171 GGGCACCAGCGTCAGCAGAGCGG + Intergenic
1079128435 11:17734591-17734613 CGGGAGCAGCAGGAGCCGCGCGG + Intergenic
1079181380 11:18196747-18196769 CAGCAGCAGCAGTACCAGATAGG - Intronic
1079733270 11:23962348-23962370 CGGGACCACCAGCTGCAGAGAGG + Intergenic
1079812471 11:25012489-25012511 CTTCAGCAGCACCAGCAGAAGGG - Intronic
1079837318 11:25350721-25350743 CGGCAGCTGCAATGGCAGAGGGG + Intergenic
1080414651 11:32057982-32058004 TGGGAACAGCAGCAGGAGAGAGG + Intronic
1080433743 11:32221270-32221292 CAGCAGCAGGAGCAGAAGACAGG - Intergenic
1080540201 11:33257672-33257694 CAGCAGCAGCAGCAGCGGTCGGG + Exonic
1080943205 11:36942646-36942668 CTGGAGCAGCAACATCAGAGAGG + Intergenic
1081801080 11:45859766-45859788 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1081812824 11:45922920-45922942 CAGCAGCAGCAGCAACAGCGCGG - Exonic
1082004553 11:47412363-47412385 CTGCAGCAGCAGCAACAGCTGGG + Exonic
1082812092 11:57484567-57484589 TGCAAGCAGCAGCACCAGAGAGG + Exonic
1082828524 11:57598296-57598318 AGCCAGCAGCAGCAGCAGGAGGG - Exonic
1082883253 11:58058754-58058776 CAGCAGCTGCAGAAGCAGATCGG - Intronic
1083363906 11:62129902-62129924 CGGCAGCTGCAGCCGCAGCACGG - Exonic
1083599657 11:63939004-63939026 CAACAGCGGCGGCAGCAGAGCGG - Exonic
1083729065 11:64643300-64643322 CGGCAGCGGCAGCAGCGGCGCGG - Intronic
1083747699 11:64744812-64744834 CGGGAGCCGCAGCCGCAGCGAGG - Intronic
1083796879 11:65021967-65021989 CAGCAGTAGCAGCAGCAGGCTGG - Exonic
1083829137 11:65219923-65219945 TGGCAGCAGCAGAGGCAGTGAGG + Intergenic
1083851310 11:65369040-65369062 CAGCAGCAGCAGCAGCATCTGGG + Intergenic
1083971610 11:66080261-66080283 CTGGAGAAGCAGCAGCAGACAGG + Intronic
1084001389 11:66296953-66296975 CGGCATGCCCAGCAGCAGAGTGG - Intergenic
1084086581 11:66857749-66857771 CAGCAGCAGCAGGAGCGGCGGGG - Exonic
1084178702 11:67436228-67436250 CAGCAGCAGCAGCAGGACAACGG + Exonic
1084697038 11:70761915-70761937 CAGCAGCAGCAGCAGCAGCCGGG - Intronic
1084738220 11:71119792-71119814 CGGCAGCAGCAGTAGCACCTTGG - Intronic
1084860436 11:72014504-72014526 GGGCAGCAGCAGGAGGAGCGTGG - Exonic
1084968349 11:72756045-72756067 AGGCAGCAGGTGCAGCAGGGTGG - Intronic
1085022244 11:73217224-73217246 CACCAGGAGCAGTAGCAGAGTGG - Intergenic
1085139180 11:74124676-74124698 GGGCTGCAGAAGCTGCAGAGAGG - Intronic
1085300696 11:75456688-75456710 AGGCAGCAGCAGCAGAGGAAGGG - Intronic
1085305661 11:75484337-75484359 CAGCAGCAGCTGCACCAGAGGGG + Intronic
1085635808 11:78158762-78158784 CTGCAGCAGAGGCAACAGAGAGG - Intergenic
1085812799 11:79700630-79700652 CAGCAGCAGTGGCAGCACAGTGG - Intergenic
1087014714 11:93543553-93543575 AGGCAGCGGCAGCAGCAGGCCGG - Intergenic
1087091162 11:94274569-94274591 CTCCAGCAGCAGAAGGAGAGAGG - Intergenic
1087144649 11:94799803-94799825 CAGCAGCAGCAACAGCAGCAGGG + Exonic
1087392058 11:97548443-97548465 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1088400883 11:109422148-109422170 CGGCGGCGGCGGCAGCAGCGCGG + Exonic
1089128323 11:116192977-116192999 AGGCAGCAGCCGCAGCTGAAAGG + Intergenic
1089167475 11:116488312-116488334 TGGCCACAGCAGCAGGAGAGTGG - Intergenic
1089202208 11:116731371-116731393 AGGCAGCAGCAGCGGGAGACGGG - Intergenic
1089298385 11:117483121-117483143 CGGCAGCAGCAGGAGGCAAGGGG + Intronic
1089609457 11:119661355-119661377 CAGCAGTGGCAGCAGCAGAGGGG + Exonic
1091061103 11:132462957-132462979 TTGCAGCAGCAGGTGCAGAGTGG - Intronic
1091111352 11:132971927-132971949 CAGCAGCAGTAGCAGCAGGGTGG - Intronic
1091111353 11:132971930-132971952 CGGCAGCAGCAGTAGCAGCAGGG - Intronic
1091293232 11:134454106-134454128 CAGCAGCAGCAGCAGAAGCAGGG - Intergenic
1091594335 12:1865655-1865677 CAGCAGCAGCAGCAGCACCAGGG + Intronic
1091708998 12:2724161-2724183 GAGCTGCTGCAGCAGCAGAGTGG + Intergenic
1092153091 12:6264566-6264588 TGGCAGCAGCAGCAGAAGCAGGG + Intergenic
1092253129 12:6912541-6912563 GGGCAGAAGCAGGACCAGAGCGG + Intronic
1092257794 12:6936759-6936781 CAGCAGCAGCAGCAGCATCACGG + Exonic
1092527720 12:9319398-9319420 CGGCAGGGGGAGCAGAAGAGTGG - Intergenic
1092597244 12:10021057-10021079 CTGGAGCAGGAGCAGGAGAGAGG - Intergenic
1093406754 12:18813727-18813749 GGCTAGCAGCAGCAGCAGTGGGG + Intergenic
1093465040 12:19440128-19440150 CGCCGCCAGCAGCAGCAGCGGGG + Exonic
1093690184 12:22101556-22101578 AGGCAGAAGCAGTGGCAGAGAGG - Intronic
1094041066 12:26122434-26122456 CGGCAGCTGCAGAAGGCGAGAGG + Exonic
1094439088 12:30455007-30455029 AAGCAGCAGCAGCAACACAGTGG - Intergenic
1094523408 12:31216166-31216188 CAGAAGCAGCAGCAGCAGTGAGG - Intergenic
1095486684 12:42692345-42692367 CGGCAGCGGCAGCAGCTCAAGGG - Intergenic
1096111728 12:49032778-49032800 CAGCAGCAACAGCAGCAGATGGG - Exonic
1096112854 12:49039519-49039541 CAGCAGCTGCAGGAGCAGTGGGG - Exonic
1096180698 12:49548986-49549008 CAACTGCAGCAGCAGCAGCGAGG + Exonic
1096220083 12:49823594-49823616 CAACAGCAGGAGCAGCAGAATGG + Intronic
1096595219 12:52690905-52690927 CAGCAGCAGGGCCAGCAGAGCGG + Exonic
1096602702 12:52741879-52741901 TGGCAGCGGCTGCAGCAGGGAGG + Intergenic
1096647088 12:53044754-53044776 CAGCAGCAGGAGCTTCAGAGAGG - Intergenic
1096848162 12:54419109-54419131 CAACAGCAGCGGCAGCAGCGGGG + Exonic
1096863838 12:54549625-54549647 CGGCAGCAGCAGCGGCGGTGCGG + Exonic
1097043323 12:56169558-56169580 CGGCGGCAGCAGCGGTGGAGAGG + Exonic
1097053468 12:56237183-56237205 CAGCAGCAGCAGCCGCCGAAAGG - Exonic
1097561249 12:61208885-61208907 CAGCAGCAGCTGCAGAACAGCGG + Intergenic
1097585481 12:61510695-61510717 CAGCAGCAGCAGGAGAAGAATGG + Intergenic
1098128474 12:67323560-67323582 CTGCAGAAGCAGTGGCAGAGAGG - Intergenic
1098704113 12:73665387-73665409 GGGCAGCGGCAGCATCAGTGTGG - Intergenic
1098985123 12:77003989-77004011 TGGCAGCAGCAGCCTCAGTGAGG + Intergenic
1100089630 12:90954375-90954397 GAGCAGCAGCAAAAGCAGAGAGG + Exonic
1100415543 12:94369884-94369906 AAGCAGCAGCAGCAGCAGCAAGG + Intronic
1101007436 12:100414903-100414925 CTGCAGCAGCAGCAGCTCTGGGG - Intronic
1101340895 12:103841189-103841211 GGGCAGCAGCAGTCGCAGAGCGG - Exonic
1101510590 12:105389291-105389313 CGGCAGCAGCAGCAACAGTGGGG - Intronic
1101981008 12:109406893-109406915 GGGAGGCAGCAGCAGCAGGGAGG - Intronic
1102347204 12:112167844-112167866 CAGCAGCAGCAGCGACAGCGAGG + Exonic
1102408411 12:112694508-112694530 CAGCAGCAGCAGCATAAGAAAGG + Intronic
1102510916 12:113414845-113414867 GTGCAGCAGGAACAGCAGAGAGG - Intronic
1102833170 12:116026592-116026614 CAGCAGCAGCAGCATCACATGGG - Intronic
1102869094 12:116399478-116399500 CTGCAGCTGCAGAAGGAGAGTGG - Intergenic
1102951162 12:117032640-117032662 GGGCAACAGCAGCACCAGGGTGG - Intergenic
1102965029 12:117119130-117119152 CAGCAGCAGCAGCAGCTTGGAGG - Intergenic
1102965031 12:117119133-117119155 AGCCAGCAGCAGCAGCAGCTTGG - Intergenic
1103074154 12:117968888-117968910 CAGCAGCAGCAGCAGCAGCGCGG - Intronic
1103211868 12:119173073-119173095 TGGCGGCACCTGCAGCAGAGAGG + Intergenic
1103604295 12:122075817-122075839 GGGCAGCATCGGCAGGAGAGTGG - Intergenic
1103899544 12:124296015-124296037 GGGCACCCGGAGCAGCAGAGGGG - Intronic
1103940840 12:124500393-124500415 AGGCAGCAGCAGAAGCCAAGTGG + Intronic
1103956855 12:124582220-124582242 CAGCAGCAGCAGCACCAGCCTGG - Intergenic
1104021248 12:124993828-124993850 CAGCAGCAGCAGCAGGAGCCCGG - Exonic
1104053083 12:125209382-125209404 CGCTAGCAGTGGCAGCAGAGTGG + Intronic
1104743096 12:131193280-131193302 CGGCGGCAGGAACAGCAGAATGG - Intergenic
1104759617 12:131289159-131289181 CAGCAACAGCAGCAGCCGATGGG + Intergenic
1104846840 12:131851201-131851223 CGGCAGCAGCAGCAGCATGGTGG - Exonic
1104846841 12:131851204-131851226 TGGCGGCAGCAGCAGCAGCATGG - Exonic
1105209379 13:18248926-18248948 AGTCAGCAGCAACAGCAGCGGGG + Intergenic
1105356361 13:19663471-19663493 CCGCAGCTGGAGCAGCAGGGAGG + Intronic
1105704830 13:22962356-22962378 TGGGAGCAGCAGGGGCAGAGAGG + Intergenic
1105752781 13:23436834-23436856 CGGTAGGAGCAGCAGCTGGGAGG - Intergenic
1105857791 13:24387514-24387536 TGGGAGCAGCAGGGGCAGAGAGG + Intergenic
1105913435 13:24891884-24891906 AGGCTGCAGCAGCACCTGAGTGG - Intronic
1106109287 13:26762187-26762209 CAGCAGCAGCAGCATCACTGGGG - Intergenic
1106226930 13:27793017-27793039 CGGCAGCAGCAGCGGCGGCCGGG - Exonic
1106250162 13:27976917-27976939 CAGCAGCAGCAACAGCAGCAAGG - Intergenic
1106308965 13:28535894-28535916 CTGGAGGACCAGCAGCAGAGAGG + Intergenic
1106440558 13:29763340-29763362 CGGGACAAGCCGCAGCAGAGTGG - Intergenic
1106587491 13:31069985-31070007 CAGCAGCAGCAACAGAAGACAGG + Intergenic
1106995557 13:35476295-35476317 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1107058521 13:36131250-36131272 CGGCAGCAGCTGCTGGAGCGCGG + Exonic
1107276712 13:38687427-38687449 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1107404432 13:40099312-40099334 CAGCAGCAACAGCAGCAGTTTGG + Intergenic
1107826439 13:44332727-44332749 AGGCAGCAGCAGCAGCAGGGAGG - Intergenic
1107899255 13:44995822-44995844 CAGCAGCAGCAGCAGCAGCTGGG - Intronic
1108639708 13:52371709-52371731 CAGCAGCAGCAGCAGGATGGGGG + Intergenic
1108686734 13:52826400-52826422 CCGGACCAGCAGCTGCAGAGGGG + Intergenic
1108689916 13:52850849-52850871 CGGCAGCAGCAGCGCCAGGCGGG - Intergenic
1109134135 13:58625711-58625733 TGGCAGCAGCAGCAGCAGGCAGG - Intergenic
1109495633 13:63168154-63168176 CAGCAGCAGCAGCAGCATCAGGG + Intergenic
1110273498 13:73617139-73617161 GGGCAGCAGCAGCTGCGGTGTGG - Intergenic
1110624494 13:77637632-77637654 GGGGATCACCAGCAGCAGAGGGG - Intronic
1110630147 13:77698080-77698102 CGGCAGCAGCAGCAGGTGCGGGG - Intronic
1111337548 13:86841602-86841624 TGGCAGCAGCTGCTTCAGAGGGG + Intergenic
1111694683 13:91608560-91608582 TGACTGCAGCAGCAGCAGATAGG + Intronic
1111735590 13:92135050-92135072 CTGCAGCAGGAGAACCAGAGAGG - Intronic
1111756331 13:92400335-92400357 CTACAGCAACAGCAACAGAGGGG + Intronic
1112394464 13:99016032-99016054 CAGCAGCATCTGCAGCAGTGTGG - Intronic
1112558479 13:100491051-100491073 CAGCAGCAGCAGCAGCATTCAGG - Intronic
1112644931 13:101319274-101319296 AGGCTGCAGGAGGAGCAGAGAGG - Intronic
1113094199 13:106646460-106646482 CCTCAGCAGCAGATGCAGAGAGG + Intergenic
1113301211 13:109021473-109021495 CAGCAGAAGCAGCAGCAGTGTGG + Intronic
1113462461 13:110491707-110491729 AAGCAGCAGCAGCAACAGCGTGG - Intronic
1113589497 13:111488539-111488561 AGGCAGCAGCATCAGCAGGTGGG + Intergenic
1114261896 14:21043021-21043043 CAGCAGCAGAAGCAGCAGAAGGG - Exonic
1114519007 14:23321483-23321505 CGGCGGCGGCAGCAGCAGCGGGG + Exonic
1114634640 14:24180541-24180563 CGTCAGGAGCAGCAACAGTGCGG + Exonic
1115028254 14:28766876-28766898 CAGCAGCAGCAGCAGCCCAAAGG - Intergenic
1115058561 14:29162304-29162326 CAGCAGCAGCACCAGCAGAAGGG - Intergenic
1116075739 14:40108487-40108509 CTGCAGGATAAGCAGCAGAGAGG - Intergenic
1116441784 14:44962435-44962457 CGGCAGCAGAAGCAGCGCGGAGG - Exonic
1116441785 14:44962438-44962460 GGGCGGCAGCAGAAGCAGCGCGG - Exonic
1116484730 14:45433975-45433997 CGGCAGCAGCAGCAGCAGCAGGG + Intergenic
1116725265 14:48554767-48554789 CAGCAGCAGCAGCAGCAGAGTGG - Intergenic
1116861573 14:49999985-50000007 AAGCAGCAGCAGCAGCCAAGGGG + Intronic
1117512897 14:56471256-56471278 TGGCAGCGGCAGCAGCAGGCTGG + Intergenic
1117638825 14:57775300-57775322 CAGCAGTGGCAGCAGCAGTGTGG - Intronic
1118318445 14:64739411-64739433 GGGCAGCAGGAGGAGGAGAGTGG - Intronic
1118630227 14:67695710-67695732 CGGCTGCAGCGGCACCAGAGCGG + Exonic
1118823234 14:69358504-69358526 CAGCAGGTGGAGCAGCAGAGTGG + Intergenic
1118859650 14:69652702-69652724 AGGCAACAGCAGCAGCAGCTAGG - Intronic
1119357415 14:74018936-74018958 CGGGAGCGGCAGAAGCGGAGCGG + Intronic
1119395168 14:74320924-74320946 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
1119618567 14:76114493-76114515 CAGCAGCAGCAGAAGCAGCATGG + Intergenic
1119634664 14:76264194-76264216 TGGCAGCAGGAGCAGCAGAGAGG + Intergenic
1120970953 14:90206585-90206607 GGGCATTAGAAGCAGCAGAGTGG - Intergenic
1121013616 14:90535450-90535472 CCAGAGCAGCAGCAGCAGGGAGG - Exonic
1121038360 14:90725334-90725356 CAACAGCAGCAGCAGCAGACAGG - Intronic
1121070340 14:91013742-91013764 GACCAGCAGCAGCAGCAGCGTGG + Intronic
1121195847 14:92071009-92071031 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1121262631 14:92577515-92577537 CGGCAGCAGCAGCAGCAGAGAGG + Intronic
1121294918 14:92812348-92812370 AGAAGGCAGCAGCAGCAGAGAGG - Intronic
1121492956 14:94372848-94372870 CGGCAGAAGCAGCAGAGGTGAGG - Intergenic
1121604081 14:95227613-95227635 CCTCAGCAGCAGCAGCAAACAGG + Intronic
1121711050 14:96039452-96039474 CAGCGGCAGCGGCAGCAGCGAGG + Exonic
1121738892 14:96237702-96237724 AGGCAGCACCTGCAGCAGGGTGG - Intronic
1122081692 14:99271296-99271318 CGGCAGCGGCGGCAGCGGCGCGG - Intronic
1122156114 14:99751380-99751402 AGGCAGCAGCAGCTGCTGAATGG + Intronic
1122627770 14:103092912-103092934 CTGCAGCACCATCTGCAGAGGGG - Intergenic
1122723676 14:103736387-103736409 CGGCAGCAGGAGCAGCAGCTGGG - Intronic
1122738696 14:103858482-103858504 CAGCAGCATCAGCAGCACAGGGG - Intergenic
1122773652 14:104107903-104107925 GGGCAGCGGCACCAGCAGACAGG - Intronic
1122871326 14:104640409-104640431 CGGGGGCAGCTGCAGCAGAGGGG - Intergenic
1122975269 14:105168370-105168392 CAGCAGCAGCAGCAGCCGCCGGG + Exonic
1123024891 14:105419899-105419921 CGGCGGCGGCGGCAGCAGCGCGG + Exonic
1123681621 15:22768238-22768260 CGGAAGCAGGAGGAGCAGATGGG - Intergenic
1123681640 15:22768322-22768344 CGGAAGCAGGAGGAGCAGATGGG - Intergenic
1123681679 15:22768490-22768512 CGGAAGCAGGAGGAGCAGATGGG - Intergenic
1123681707 15:22768637-22768659 CGGAAGCAGGAGGAGCAGATGGG - Intergenic
1123681722 15:22768700-22768722 CGGAAGCAGGAGGAGCAGATGGG - Intergenic
1123681738 15:22768805-22768827 CGGAAGCAGGAGGAGCAGATGGG - Intergenic
1123681840 15:22769306-22769328 CGGGAGCAGGAGGAGCAGATGGG - Intergenic
1123681851 15:22769348-22769370 CGGAAGCAGGAGGAGCAGATGGG - Intergenic
1123681930 15:22769810-22769832 CGGGAGCAGGAGGAGCAGATGGG - Intergenic
1123721375 15:23064553-23064575 CAGCAGCTGCAGCAGCACAGTGG - Intergenic
1124333839 15:28842710-28842732 CGGAAGCAGGAGGAGCAGATGGG - Intergenic
1124333848 15:28842752-28842774 CGGAAGCAGGAGGAGCAGATGGG - Intergenic
1124333857 15:28842794-28842816 CGGAAGCAGGAGGAGCAGATGGG - Intergenic
1124333915 15:28843121-28843143 CGGAAGCAGGAGGAGCAGATGGG - Intergenic
1124566820 15:30823651-30823673 CGTCCGAAGCAGCCGCAGAGGGG - Intergenic
1124588650 15:31034401-31034423 CAGCAGCACCTGCAGCAGATGGG - Intronic
1124929124 15:34101789-34101811 TAGCAGCAGCAGCAGCAGGACGG + Exonic
1125158246 15:36614213-36614235 AGGGAGGAGCAGCAGCAGGGTGG - Intronic
1125381562 15:39092258-39092280 CGGGAGGACCAGCTGCAGAGAGG - Intergenic
1125435960 15:39645660-39645682 GGGCAGCAGCAGCTGCAGCCAGG - Intronic
1125831383 15:42719211-42719233 AAGCAGCAGCCTCAGCAGAGCGG + Intronic
1125882160 15:43204324-43204346 CAGCAGCAGCAGCAGCATTTAGG - Intronic
1125933958 15:43618681-43618703 CAGCAGCAGCAGCAGCAGCAGGG + Exonic
1125947055 15:43718143-43718165 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1126829561 15:52587067-52587089 CAGCAGCAGTAGCAGGAGAAAGG + Intronic
1127003157 15:54534072-54534094 TGGTGGCAGCAGCAGCACAGTGG - Intronic
1127428580 15:58880435-58880457 CAGCAGCAGCAGCACCAGCTGGG + Intronic
1127474076 15:59315772-59315794 CAGCAACAGCAGCAGCATTGGGG - Intronic
1128203953 15:65833988-65834010 CTGCAGCAACAGCACCAGGGTGG - Intronic
1128374181 15:67064269-67064291 CTGCAGCAGCAGCTGCGGATTGG + Intronic
1128581636 15:68814519-68814541 GTGCAGCAGCAGCAGGAAAGAGG + Intronic
1128655144 15:69455265-69455287 CTGGAGCAGCAGCAGTGGAGGGG - Exonic
1128719751 15:69939760-69939782 TTGGGGCAGCAGCAGCAGAGAGG + Intergenic
1129332278 15:74833798-74833820 GGGGAGCAGCAGCAGCACTGAGG + Intergenic
1129372488 15:75106245-75106267 CTGCAGCAGCAAGAGCAGAATGG + Intronic
1129538952 15:76335996-76336018 CAGCAGCGGCAGCAGCAGCAAGG + Intergenic
1129607095 15:77030314-77030336 GAGCAGCAGCAGCACCAGCGTGG + Intronic
1129679849 15:77652618-77652640 CAGCAGGAGCAACAGCTGAGAGG - Intronic
1129919912 15:79311275-79311297 CAGCAGCAGAAGCAGCACGGAGG - Exonic
1130040946 15:80404693-80404715 CCGCAGCATCAGCACCAGAGCGG + Intronic
1130113914 15:80989723-80989745 CAGCAGCAGCAGCAGGTCAGAGG + Exonic
1130223873 15:82043939-82043961 CGGGACCAGCAGCAGCGCAGCGG - Exonic
1130224237 15:82045633-82045655 CGGCGGCGGCAGCAGCGGAGGGG - Exonic
1130647885 15:85744685-85744707 AGGCAGCTGCCTCAGCAGAGAGG - Exonic
1130688056 15:86056534-86056556 GGCCAGGAGCAGAAGCAGAGAGG + Intergenic
1130844896 15:87735310-87735332 CAACAGCAGTAACAGCAGAGTGG - Intergenic
1130881753 15:88061526-88061548 GAGCAGGAGCAGGAGCAGAGTGG + Intronic
1131032725 15:89199958-89199980 CCGAGGCAGCAGCAGCAGAGGGG - Exonic
1131466054 15:92655615-92655637 CAGCAGCAGCGGCAGGAGCGGGG + Exonic
1131509257 15:93040424-93040446 CTAGAGCAGCAGCAGCAAAGGGG - Intronic
1132087576 15:98920990-98921012 GCGCGGCAGCAGCAGCAGAGAGG - Intronic
1132712744 16:1276712-1276734 CAGCAGCAGCAGCAGCTGCGGGG + Intergenic
1132885644 16:2180929-2180951 CGGCGGCAGCAGCTGCGGGGTGG + Exonic
1132953078 16:2575729-2575751 GAACAGCAGCAGCAGCAGCGAGG + Intronic
1132961273 16:2624439-2624461 GAACAGCAGCAGCAGCAGCGAGG - Intergenic
1133002408 16:2858027-2858049 CGACGCCAGCAGCAGCAGGGAGG + Exonic
1133035427 16:3031402-3031424 CGGCAGCAGCTGGAGGTGAGTGG - Intronic
1133042869 16:3069751-3069773 TGGCAGCAGGAGAAGCAGGGTGG + Intronic
1133129212 16:3665842-3665864 TGGCAGCAGCAGCAGCAGCCAGG + Intronic
1133138458 16:3728397-3728419 CAGCAACAGCAGCAGCAGCAAGG - Exonic
1133288281 16:4701487-4701509 CCAGAGCAGCAGCAGCAGCGAGG - Exonic
1133288418 16:4702102-4702124 CAGCAGCAGCAGCAGCAGTCGGG - Exonic
1133298135 16:4765626-4765648 CGCGAGCAGCAGCCGGAGAGCGG - Exonic
1133303317 16:4795951-4795973 CAGCAGCAGCAGGAGCAGCACGG - Exonic
1133357722 16:5148644-5148666 TGGCAGCAGCAGCAGCTGGAGGG + Intergenic
1134027186 16:10963421-10963443 CCCCAGCATCATCAGCAGAGGGG - Intronic
1134143590 16:11742685-11742707 CGGCGGCAGCAGCAGCAGCGAGG - Exonic
1134163979 16:11915642-11915664 CGGCAGCAGCAGCAGCGACTCGG - Exonic
1136033867 16:27523812-27523834 TTCCAGCCGCAGCAGCAGAGAGG + Intronic
1136079595 16:27842961-27842983 AGGCAGCTGCAGGAGCACAGAGG - Intronic
1136269418 16:29139680-29139702 CCGCAGCAGCAGCAGCACGTTGG - Intergenic
1136394824 16:29987172-29987194 AAGCAGCAGCAGCAGCAGGAGGG - Exonic
1136511007 16:30738333-30738355 CGGCGGCGGCGGCAGCAGCGGGG + Exonic
1136550464 16:30979920-30979942 CAGCAGCAGCAGCAGCGATGGGG + Exonic
1136561547 16:31042144-31042166 CGGCAGCGGCAGCAACAGCAGGG - Intronic
1136622153 16:31436398-31436420 CCGCAGCTGCAGCAGCAGAAGGG + Exonic
1136777352 16:32879061-32879083 AGGCAGCAGGAGCTGGAGAGAGG - Intergenic
1136893273 16:33982452-33982474 AGGCAGCAGGAGCTGGAGAGAGG + Intergenic
1137655305 16:50153771-50153793 CAGCAGCAGCAGCAGCAGCACGG + Exonic
1137699786 16:50489203-50489225 TGGCACCAGCAGCCCCAGAGGGG - Intergenic
1137775014 16:51047213-51047235 CAGAAGCAGCAGCAGCAGCTGGG + Intergenic
1137783339 16:51115972-51115994 CAGGAGCAGCAGCAGCATACTGG - Intergenic
1137938221 16:52656063-52656085 AGGGAGGAGCAGCAGCAGGGTGG - Intergenic
1138166654 16:54808118-54808140 CAGCAGCAGCAGCAGCATCTGGG - Intergenic
1138360768 16:56425499-56425521 GGGCAGCAGCGGGAGCAGCGCGG - Exonic
1138382051 16:56609259-56609281 GGGCAGCAGGAGCAGCAGCCTGG - Exonic
1138383338 16:56618585-56618607 GGGCAGCAGGAGCAGCAGCCTGG - Intergenic
1138385600 16:56633747-56633769 GGGCAGCAGGAGCAGCAGCCTGG - Exonic
1138386153 16:56636848-56636870 GGGCAGCAGAAGCAGCAGCCTGG - Intergenic
1138386651 16:56639855-56639877 GGGCAGCAGGAGCAGCAGCCTGG - Exonic
1138387355 16:56644706-56644728 GGGCAGCAGGAGCAGCAGTCTGG - Intronic
1138389408 16:56659069-56659091 GGGCAGCAGGAGCAGCAGCCTGG - Exonic
1138390459 16:56666952-56666974 GGGCAGCAGGAGCAGCAGCCTGG + Exonic
1138392155 16:56677648-56677670 GGGCAGCAGGAGCAGCAGCCTGG - Exonic
1138393059 16:56683954-56683976 GGGCAGCAGGAGCAGCAGCCTGG - Exonic
1139099189 16:63744640-63744662 TAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139241344 16:65395459-65395481 AGGCAGCAGCAGCATCACATGGG + Intergenic
1139347963 16:66316642-66316664 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139392822 16:66615982-66616004 CAGGAGAAGCAGCAGCAGAGAGG + Exonic
1139459410 16:67109967-67109989 CTGCAGCAGCCGCGGCAGCGGGG - Exonic
1139519433 16:67472110-67472132 AGGCAGCAGCAGCAGCAAGCTGG + Intronic
1139662129 16:68428446-68428468 GAGCAGGAGCAGCAGCAGAAGGG + Intronic
1139734138 16:68972884-68972906 GAGCAGCAGCAGATGCAGAGGGG + Intronic
1139997038 16:70991237-70991259 AGGCAGAATCAGGAGCAGAGTGG - Intronic
1140392867 16:74603114-74603136 CAGCAGCAGCAGCAGCAGCCAGG + Intronic
1140820795 16:78661243-78661265 CTCCAGCAGCAGCAACAGAGAGG + Intronic
1140851162 16:78935932-78935954 AAGCAGCAGCAGCAGCAGCTAGG + Intronic
1141001047 16:80308202-80308224 GGGCAGCAGAAGAAGGAGAGAGG - Intergenic
1141071138 16:80955324-80955346 CAGCAGCAGCAGCAGCGTAGTGG - Intergenic
1141128311 16:81416953-81416975 CGGCAGCAGCAGCAGCAGCTAGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141190803 16:81823287-81823309 CCGGGGCAGCTGCAGCAGAGAGG + Intronic
1141818570 16:86429780-86429802 TGGCAGCAACAGAAGCAGGGAGG - Intergenic
1141894208 16:86948170-86948192 GAGCAGGAGCAGGAGCAGAGTGG - Intergenic
1141915499 16:87093896-87093918 CAGCCGCAGCAGCCGCAGGGAGG + Intronic
1141982337 16:87558368-87558390 CGGCAGCAGCCTCACCAGAAGGG - Intergenic
1141989612 16:87602573-87602595 CGGCAGCAGCAGCAGCAATGCGG - Intronic
1203079765 16_KI270728v1_random:1141170-1141192 AGGCAGCAGGAGCTGGAGAGAGG - Intergenic
1142707538 17:1705907-1705929 ACGCAGCAGAAGCAGCAGGGAGG + Exonic
1142879519 17:2873510-2873532 AAGCAGCAGCAGCTGCAGAAAGG + Intronic
1143098715 17:4492864-4492886 TGGCAACAGCAAGAGCAGAGAGG + Intergenic
1143130729 17:4675321-4675343 GGGCAGCAGCAGCAGCCGCAGGG + Exonic
1143147538 17:4786311-4786333 CAGCAGCAGCGGCAGCAGCTTGG + Exonic
1144308596 17:13992067-13992089 CTGCAGTAGGAACAGCAGAGGGG + Intergenic
1144531654 17:16044861-16044883 CTGGAGCAGCAGCAGTGGAGTGG - Intronic
1144650616 17:17004693-17004715 CATCAGCAGCAGCAGCCCAGGGG - Intergenic
1144872866 17:18381397-18381419 CTGCAGCACCAGCAGGAGACGGG + Exonic
1145011857 17:19372804-19372826 AGGCAGTAACATCAGCAGAGCGG + Intronic
1145942429 17:28749660-28749682 AGGCAGCAGAAGCAGCTGACGGG - Exonic
1146329708 17:31917276-31917298 CGGCAGCAGCTGCCGCGGAGAGG + Intergenic
1146533113 17:33627489-33627511 TGGCAGGAGCAGCAGCAGGAGGG - Intronic
1146588868 17:34110438-34110460 CTGAGGCAGCGGCAGCAGAGAGG - Intronic
1146901418 17:36591921-36591943 CGGCGGCGGCGGCAGGAGAGCGG + Exonic
1147262786 17:39218268-39218290 CAGCAGCAGCAGCAGCAGCGTGG + Intronic
1147262789 17:39218271-39218293 CAGCAGCAGCAGCAGCGTGGGGG + Intronic
1147507499 17:41034334-41034356 CAGGAGTAGCAGCAGCAGACTGG + Exonic
1147508134 17:41040880-41040902 GAGCAGTAGCAGCAGCAGACTGG + Exonic
1147696502 17:42358844-42358866 CACCAGCAGCACCAGCACAGAGG - Intronic
1147719799 17:42532093-42532115 CGGCCGCAGCAGCAGCAAAACGG + Intergenic
1147923429 17:43932579-43932601 CGGCAGCAGAAGCAGCTCTGCGG + Intergenic
1148021692 17:44557711-44557733 CAGCAGCGGCAGCAGCAGGCGGG - Exonic
1148218308 17:45845859-45845881 CAGCAGAGGCAGCGGCAGAGAGG - Exonic
1148338135 17:46855196-46855218 GGGCAGCAGTGGCTGCAGAGAGG + Intronic
1148647168 17:49225714-49225736 GGGCAGCAGGAGAAGCAGTGGGG + Intronic
1148768845 17:50055736-50055758 CAGCAGCAGCCGCAGGAAAGCGG + Intergenic
1148770083 17:50061444-50061466 GGGCAGCAGCAGCAACAAGGGGG + Intronic
1148821946 17:50364945-50364967 CAGCAGCAGCAGCAGCAGGATGG - Intergenic
1149092542 17:52801464-52801486 CAGCAGTAGCAGTAGCAGATTGG - Intergenic
1149477855 17:56978124-56978146 CGGCAGCATCAGCAACAGGCTGG - Exonic
1149539056 17:57454938-57454960 CGACAGGAGCAGCAGCAGGCAGG - Intronic
1149634694 17:58157219-58157241 CAGCAGCAGTAGCCGCAGGGTGG - Intergenic
1149634695 17:58157222-58157244 CGGCAGCAGCAGTAGCCGCAGGG - Intergenic
1150163994 17:62924117-62924139 CCACAGGAGCAGAAGCAGAGGGG - Intergenic
1150311086 17:64130000-64130022 CAGCAGCAGCAGCAGCCGCCGGG + Exonic
1150484123 17:65532421-65532443 AAGCAGCAGCAGCAGCAGCCAGG + Intronic
1151165811 17:72202839-72202861 CAGCAGCAGCAGCAGGAGTGAGG - Intergenic
1151285753 17:73109842-73109864 CAGCAGCAGCAGCGACAGAAAGG + Intergenic
1151325364 17:73376709-73376731 GGGCAGCGCCAGCAGCAGTGTGG - Intronic
1151474083 17:74335660-74335682 CTGGAGCTGCAGCAGCAGATGGG + Intronic
1151479282 17:74360931-74360953 CCACAGCAGTAGCAGGAGAGAGG + Intronic
1151484180 17:74388175-74388197 GGGCAGGAGCAGAAGGAGAGAGG + Intergenic
1151674067 17:75589016-75589038 CGGGAGCCGCAGCAGGAGCGGGG + Intergenic
1151748382 17:76023602-76023624 CTGCAGCACCAGCAGGAGACGGG - Exonic
1151878156 17:76879024-76879046 AGGCTGCAGCAGCAGCATGGTGG - Intronic
1152064443 17:78102708-78102730 CTCCAGCAGCGGCAGCAGATGGG + Intronic
1152068639 17:78124614-78124636 CACCAGCAGCAGCAGCAGGAGGG + Exonic
1152248056 17:79196176-79196198 CTGGAGAAACAGCAGCAGAGTGG + Intronic
1152574752 17:81135098-81135120 GGACAGAAGCAGCACCAGAGGGG - Intronic
1152651377 17:81495056-81495078 GAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1152698804 17:81809044-81809066 CAGCAGCAGCAACAGCAGCAGGG - Exonic
1152941813 17:83176793-83176815 TGGCTGCAGGAGCTGCAGAGAGG + Intergenic
1154019271 18:10648242-10648264 CAGCAGCAGCAGCAGCATAGTGG - Intergenic
1154184947 18:12174982-12175004 CAGCAGTAGCAGCAGCATAGTGG + Intergenic
1155218410 18:23662868-23662890 CGGCAGCAGCCGCCGCACACAGG + Exonic
1155433369 18:25785615-25785637 CGGCATCAGCAGAGGCAGAGGGG - Intergenic
1155528702 18:26743918-26743940 CGGCAGCATCAGCATCAGCAGGG - Intergenic
1155654345 18:28177099-28177121 CGGCAGCACCAACAGCGGCGCGG + Exonic
1155654517 18:28177784-28177806 CGGCTGCGGCAGCAGCTGCGCGG - Intergenic
1155708603 18:28847529-28847551 CTGCAGCAGCAGTGGCAGAGGGG - Intergenic
1155728271 18:29117479-29117501 TGGCAGCAGTTACAGCAGAGTGG + Intergenic
1155779388 18:29811786-29811808 CAGCAGCAGCAGTAGCACAGTGG - Intergenic
1156197818 18:34795531-34795553 AGGCAGCAGAGGCAGCAGAATGG + Intronic
1156294067 18:35774106-35774128 CAGAAGCTGCAGCAGCAGAGGGG - Intergenic
1156482530 18:37445229-37445251 CTGCAGAAGCGGGAGCAGAGGGG + Intronic
1156791198 18:40976602-40976624 TGGCAACAGCAGCAGCTGTGGGG + Intergenic
1156958442 18:42994732-42994754 GGGCAGCAGCAGCCGCTGCGTGG - Intronic
1156996718 18:43477974-43477996 AGGCAGCAAAAACAGCAGAGAGG - Intergenic
1157357222 18:46946962-46946984 CCGCAGCAACAGTAGGAGAGGGG - Intronic
1157384261 18:47248157-47248179 CCGAAGCAGCAGCCACAGAGAGG + Intronic
1157565061 18:48674337-48674359 CAGGAGCTGCAGCAGCACAGGGG - Intronic
1157740963 18:50092431-50092453 ACGCAGCAGCAGCAGCAGGATGG - Intronic
1159102221 18:63970153-63970175 CAGCAGCAGCAGCAGGAGGTGGG + Exonic
1159695762 18:71554162-71554184 CGGGAGCAGGAGCAAGAGAGAGG - Intergenic
1159921072 18:74227822-74227844 CAGCAGCAGCAGCAGCAGAAAGG + Intergenic
1160047380 18:75399719-75399741 CAGCAGCAGCAGCAGCAAAAGGG - Intergenic
1160057681 18:75499998-75500020 CAGCAGCAGCAGCAGCATCCAGG + Intergenic
1160227087 18:77019848-77019870 TGGCGGAAGCAGCAGGAGAGCGG + Intronic
1160365257 18:78319225-78319247 CTGCAGAAGCAGGAGAAGAGAGG - Intergenic
1160377369 18:78423185-78423207 CAGCAGCAGCAATAGCAGGGGGG - Intergenic
1160377372 18:78423188-78423210 CGGCAGCAGCAGCAATAGCAGGG - Intergenic
1160447310 18:78937577-78937599 CGACAGCAGCAGAAGCCGGGTGG - Intergenic
1160455505 18:78996192-78996214 TCGCAGCAGCAGCGGTAGAGCGG + Intronic
1160779829 19:872787-872809 GGGCAGCAGCAGCAGAAGCAAGG + Intronic
1160823181 19:1067627-1067649 CGGCAGGGGCCACAGCAGAGAGG + Intronic
1160865096 19:1252847-1252869 CAGCAGCAGCAGCAGTGGCGTGG + Intronic
1161009973 19:1955294-1955316 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1161151459 19:2712278-2712300 CGGCCGGAGCAGGAGCACAGGGG - Intergenic
1161233255 19:3186110-3186132 CGCCACCAGCAGCAGCACAGCGG - Exonic
1161327418 19:3670457-3670479 CGGAGGCACCAGGAGCAGAGGGG + Intronic
1161477444 19:4494343-4494365 GGGCAGCGGCGGCAGCAGCGGGG + Exonic
1161735159 19:5987698-5987720 TGGCAACAGCAGCAGCAGGCTGG - Intergenic
1161953838 19:7482212-7482234 CTGCAGGACCAGGAGCAGAGGGG + Intronic
1162264076 19:9555916-9555938 CCGAAGCAGGAGCAGGAGAGAGG + Intergenic
1162481105 19:10927682-10927704 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1162907035 19:13830287-13830309 CAGCTGCAGTCGCAGCAGAGTGG - Exonic
1162924499 19:13923441-13923463 CGGCAGCAGCACGAGGTGAGGGG + Exonic
1163155700 19:15438955-15438977 GGGCAGCAGCAGCAGCTCCGAGG - Intronic
1163612769 19:18309704-18309726 CAGCAGCAGAAGCAGCAGAAAGG - Exonic
1163700114 19:18782667-18782689 CAGCAGCAGCTGCAGCACTGAGG + Intergenic
1163770699 19:19189350-19189372 TGGCAGCAGGGGAAGCAGAGAGG - Intronic
1164161431 19:22627828-22627850 CAGCAGCAGCAGCAGCTTGGAGG + Intergenic
1164976064 19:32573629-32573651 GCACAGCAGCAGCAGCAGAGGGG - Intergenic
1165002476 19:32776365-32776387 CAGCAACAGCAACAGCAGTGTGG - Intronic
1165432569 19:35780985-35781007 CGGCAGCGGCTGCGGCAGCGGGG + Exonic
1165452258 19:35890416-35890438 CAGCAGCAGCTGAACCAGAGTGG + Exonic
1165758066 19:38305460-38305482 TGGCAGACGCAGCAGCTGAGGGG - Exonic
1165861628 19:38912117-38912139 CCGCAGCAGCAGCAGCTCAGAGG + Exonic
1166120842 19:40685278-40685300 TGGGAGCACCAACAGCAGAGGGG + Intronic
1166218854 19:41353015-41353037 CGGCAGCAGCCGCAGCCCGGAGG + Exonic
1166331523 19:42080568-42080590 GGGCAGCAGCGGCTGCACAGCGG - Exonic
1166364856 19:42273133-42273155 CGGCAGCCGCAGCAGCAGCGTGG + Intronic
1166385160 19:42376579-42376601 AGGCAGCTGGAGCAGCAGTGTGG - Exonic
1166748339 19:45152509-45152531 CTGCAGCAGCAGCAGCAGCAGGG - Exonic
1167251004 19:48398430-48398452 CAGCAGCAGCAGCATCTTAGCGG - Exonic
1167334473 19:48875919-48875941 CCGCTGCAGCAGCAGACGAGCGG - Exonic
1167341992 19:48921854-48921876 CAGCAGCAGCAGCAGCAGCAAGG + Exonic
1167435362 19:49475692-49475714 CAGCAGCAGCAGGAGGAGATAGG - Exonic
1167436226 19:49480367-49480389 CAGCAGTAGGAGGAGCAGAGGGG - Exonic
1167443681 19:49525045-49525067 CAGCAGCAGCAGCAGCAGGATGG - Intronic
1167556500 19:50199450-50199472 GGGTATCAGCTGCAGCAGAGAGG - Intronic
1167617215 19:50541932-50541954 TAGCAGCAACAGCAGCAGAGTGG + Intronic
1167771889 19:51525863-51525885 CTGCAGCAGCAATGGCAGAGGGG - Intronic
1168000565 19:53442620-53442642 AGGAAGGAGCAGCAGCAGGGTGG - Intronic
1168005060 19:53480104-53480126 AGGAAGGAGCAGCAGCAGGGTGG - Intronic
1168246994 19:55117455-55117477 CGGGAGCAGCTGCGGCAGTGGGG - Exonic
1168269163 19:55240292-55240314 CTGCAGCAGCTGCGGGAGAGCGG + Exonic
1168571415 19:57474157-57474179 CAGCACCAGAAGCAGCACAGTGG - Exonic
1168712892 19:58511911-58511933 GAGCAGCAGCAGCAGCAGCAAGG + Exonic
925339523 2:3126515-3126537 CTCAACCAGCAGCAGCAGAGGGG + Intergenic
925609914 2:5693768-5693790 CAGCAGCGGCAGCAGCGGCGAGG + Exonic
926061315 2:9806874-9806896 CCGAAGCACCTGCAGCAGAGGGG + Intergenic
926115762 2:10212260-10212282 CAGCAGCAGCAGCAGCAGAAGGG - Intergenic
926689911 2:15725974-15725996 CAGCAGCACCAGCAGTGGAGAGG - Intronic
927020514 2:19011966-19011988 TGGCAAGAGCAGCAGCAGATGGG - Intergenic
927075346 2:19571667-19571689 AGGCAGCTGAAGCAGAAGAGAGG - Intergenic
927181001 2:20446850-20446872 CCGCAGCGGCAGCAGCAGCGCGG + Intergenic
927217735 2:20677968-20677990 CAGCAGCAGCAGCAGCAGCTGGG + Intergenic
927256360 2:21043907-21043929 CGCCAGCAGCGCCAGCAGCGCGG + Exonic
927275959 2:21262695-21262717 CCGCAGCAGCAGGACAAGAGGGG + Intergenic
927400342 2:22703697-22703719 CAGCAGCAGCAGTGGCAGTGGGG - Intergenic
927638457 2:24832233-24832255 CAGCAGCTGCAGCTGGAGAGTGG - Intronic
927697959 2:25250854-25250876 TGGCAGCGGCAGCAGCAGGTGGG + Intronic
927875111 2:26650099-26650121 CTGCAGAATGAGCAGCAGAGAGG + Intergenic
927937119 2:27082366-27082388 TGGCGGCAGCAGCAGCAGTGGGG + Exonic
928032780 2:27795929-27795951 AGGCAGCAGGAGAAACAGAGGGG - Intronic
928097269 2:28412379-28412401 CCGCAGAAGCAGTAGCAGCGGGG + Exonic
928391470 2:30914054-30914076 CAGCAGCAGCAGCAGCAGCCTGG - Intronic
928398181 2:30959097-30959119 CAGCGGCAGCAGCAGGAGAGAGG - Intronic
928437940 2:31267935-31267957 CAACAGCACCAGCAGGAGAGTGG + Exonic
928647542 2:33370480-33370502 CAGCAGCAGCAGCAGCAGCTTGG - Intronic
929243979 2:39682495-39682517 GGCCAGCAGAAGCAGCAAAGTGG - Intronic
929265941 2:39919825-39919847 AGACAGCAGCAGCAGCAGCAAGG + Intergenic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
929590563 2:43143064-43143086 AGGCAGCAGCAGCAGCAGGAGGG - Intergenic
929604195 2:43224599-43224621 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
929604360 2:43225373-43225395 CTGCAGCAGCAGCAGAAGGGGGG - Exonic
929604364 2:43225376-43225398 CACCTGCAGCAGCAGCAGAAGGG - Exonic
929604396 2:43225533-43225555 CGGCAGCAGCTGCGGCAGCGCGG - Exonic
929607053 2:43241695-43241717 CAGCAGCTGCTGGAGCAGAGCGG + Intronic
929782547 2:44966319-44966341 CAACTGTAGCAGCAGCAGAGAGG + Intergenic
930092583 2:47541987-47542009 CAGCAGCAGCAGCGGCAGCAGGG + Intronic
930096428 2:47570252-47570274 CAGCAGCAGCAGCAGCAGGAGGG + Exonic
930304824 2:49665231-49665253 CCGCAGAAGCAGTGGCAGAGGGG + Intergenic
930714315 2:54578449-54578471 CAGCAGCAGCAGCAGCTAACCGG - Intronic
931254108 2:60555277-60555299 CGGCGGCGGCGGCTGCAGAGTGG - Intergenic
931462260 2:62459260-62459282 CAGCAGCTGCAGCTGCAAAGAGG + Intergenic
931500199 2:62856454-62856476 CACCAGCTGCTGCAGCAGAGTGG - Intronic
931516937 2:63055528-63055550 TGCCGCCAGCAGCAGCAGAGCGG + Exonic
931881394 2:66574868-66574890 CAGCCGCAGCAGCAGCAGCAGGG + Intergenic
931909895 2:66887820-66887842 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
932083751 2:68739092-68739114 CTTCTGCAGCAGCAGCAGAGTGG + Intronic
932208183 2:69902812-69902834 CGGCAGCGGCAGCAGCGGAAGGG - Intronic
932476194 2:72007647-72007669 GGGCAGCAGCAGGGGCAAAGTGG + Intergenic
932593710 2:73081500-73081522 CGGCAGCAGTGGCAGCAGCGGGG + Intronic
933336321 2:80964195-80964217 TAGCAGCAGCAGCAGCAGCATGG + Intergenic
933336322 2:80964198-80964220 CAGCAGCAGCAGCAGCATGGTGG + Intergenic
933649627 2:84840112-84840134 TGGAAGCAGCAGCAGCAGGCAGG - Intronic
933764487 2:85697483-85697505 CTGCAGCAGCAGCACCACAGTGG - Intronic
933780419 2:85796927-85796949 CCGGGGCAGCAGCTGCAGAGGGG - Intergenic
934623213 2:95829035-95829057 CTGCAGAAGCAGTGGCAGAGAGG + Intergenic
934736732 2:96693430-96693452 TGGCTGCAGCAGCAGAGGAGAGG + Intergenic
934770425 2:96904199-96904221 CAGCAGCAGCAACAGCACAGTGG + Intronic
934810553 2:97273058-97273080 CTGCAGAAGCAGTGGCAGAGAGG - Intergenic
934827139 2:97434881-97434903 CTGCAGAAGCAGTGGCAGAGAGG + Intergenic
935834671 2:107037365-107037387 CAGCAGATGCAGTAGCAGAGAGG - Intergenic
935852816 2:107241726-107241748 GAGCAGCAGCAGCAGCAGACAGG + Intergenic
936047890 2:109200995-109201017 GGGCAGCAGCAGCAGCTAAGTGG + Intronic
936598128 2:113868896-113868918 CAGCAGCAGCAGCAGAAGGAAGG + Intergenic
936781624 2:116039827-116039849 CAGCAGCAGCAGCAGCATCTGGG - Intergenic
937022525 2:118671364-118671386 CAGCAACAGCAGCAGCAGCAGGG - Intergenic
937024073 2:118682873-118682895 CAGCAGCAGCAGCAGCACAGAGG - Intergenic
937303023 2:120854860-120854882 CAGCAGCAGCAGCAGCATCTGGG - Intronic
937357764 2:121209023-121209045 CAGCAGCAGGGCCAGCAGAGGGG + Intergenic
937379637 2:121365112-121365134 CTCCAGCAGCAGGAGCAGAATGG + Exonic
937397192 2:121547260-121547282 CCGCAGCGGCAGTGGCAGAGAGG - Intronic
937844085 2:126558232-126558254 CGGCGGCGGCAGCAGCGGCGAGG + Intergenic
937900091 2:127013379-127013401 TGGCAGAGACAGCAGCAGAGAGG + Intergenic
938168823 2:129057039-129057061 AAGCAGCAGCAGCATCTGAGAGG - Intergenic
938257132 2:129868264-129868286 CAGGAGCAGCAGCAGGACAGAGG + Intergenic
938458830 2:131484585-131484607 CAGCGGCAGCAGCAGCAGCAGGG + Intronic
938483743 2:131682512-131682534 CCCCTGCAGCAGCAGCAGCGTGG + Intergenic
939244934 2:139610726-139610748 CCCCAGCAGCAGCAGCAGTGTGG - Intergenic
939991064 2:148876640-148876662 CAGCAGCCCCAGCTGCAGAGAGG - Intronic
940531708 2:154886335-154886357 CAGCAGCTGCAGTAGCACAGTGG + Intergenic
941264140 2:163338524-163338546 CAGCAGCAGCAGCAGCAGTACGG + Intergenic
941933238 2:170963422-170963444 CAGCAGCAGCAGTAGCAGCGGGG - Intronic
942017277 2:171829584-171829606 GGGAAGCAGCAGGAGCCGAGGGG + Intronic
942178163 2:173354868-173354890 CAGGAGGAGCAGCAGCAGCGCGG - Exonic
942241035 2:173964439-173964461 CTGCAGCAGCAGCAACAGCACGG - Exonic
942241409 2:173965827-173965849 CGGCCGCAGCAGCAGCCCCGGGG - Intergenic
942465227 2:176200988-176201010 CTGGAGCAGCAGCAGTGGAGGGG + Intergenic
942521228 2:176806284-176806306 CAGCAGTAGCAGCAGCGCAGGGG + Intergenic
943093747 2:183404535-183404557 CAGCAGCAGCAGCAGCCATGTGG + Intergenic
944271268 2:197786658-197786680 CGGCGGCAACAGGTGCAGAGCGG - Intronic
944310778 2:198231677-198231699 TGGATGCAGCAACAGCAGAGTGG - Intronic
944471301 2:200055930-200055952 CTGCAGCAGCAGTGGCAGAGGGG - Intergenic
944610716 2:201403455-201403477 CGGTAGAAACAGCAGCACAGTGG - Intronic
944655538 2:201873520-201873542 CAGCTGCAGCAGCAGCAGCATGG - Intronic
944743660 2:202635320-202635342 CAGCAGCAGCAGCAGCAACATGG + Exonic
945357425 2:208856762-208856784 CTGCAGCAGCAGTAGCAGAGGGG + Intergenic
945994571 2:216425250-216425272 CGCCAGCTGCTGCAGCAGAGCGG + Intronic
946019842 2:216633546-216633568 CGGCGGCGGCAGCGGCAGCGCGG - Exonic
946078887 2:217099523-217099545 CGGCAGTAGAGGCAGGAGAGCGG + Intergenic
946103659 2:217351002-217351024 TGCCAGCAGCAGCAGCAGTGTGG + Intronic
946411627 2:219518001-219518023 AAGCAAGAGCAGCAGCAGAGGGG - Intronic
946431977 2:219631011-219631033 TGGCAGCAGTAGCAGCAGGATGG + Intronic
946977060 2:225164719-225164741 CAGCAGCAGCAGCAGCAGCAAGG - Intergenic
947118379 2:226795330-226795352 CGGTAGCAGCAGCAGCAGCGAGG - Exonic
947209959 2:227699508-227699530 AGGCAGCAGCAGCACCAGGTAGG + Exonic
947314024 2:228835578-228835600 AGACAGCAGCAGCAGCAGCAAGG - Intergenic
947488399 2:230573130-230573152 AGGGAGGAGCAGCAGCAGGGTGG + Intergenic
947722584 2:232378813-232378835 CAGCAGCAGCAGCAGCATGCAGG - Exonic
947846836 2:233251532-233251554 CGGAAGCGTCAGCTGCAGAGAGG - Intronic
947905722 2:233760426-233760448 ATCCAGCAGCTGCAGCAGAGGGG + Exonic
947914697 2:233823637-233823659 CTGCCGCATCAGCAGCACAGCGG + Exonic
947944755 2:234092020-234092042 CGTCAGCAGCTGCAGCAGCCAGG - Intergenic
948006851 2:234616801-234616823 CGGCAGTAGCAGCAGAAGCGAGG + Intergenic
948675687 2:239595270-239595292 TGGCAGCAACAGGTGCAGAGTGG + Intergenic
948717342 2:239873851-239873873 CGGCAGCAGGAACTTCAGAGAGG + Intergenic
948830927 2:240597919-240597941 CGGCTCCTGCAGCAGCAGTGGGG - Exonic
948843986 2:240674525-240674547 TGGCAGCAGAAGCAGCAGCAGGG - Intergenic
948849826 2:240700110-240700132 TGGCAGCAGAAGCAGCAGCAGGG + Intergenic
948877407 2:240837012-240837034 TGGGAGCAGCAAAAGCAGAGGGG - Intergenic
948992760 2:241563151-241563173 CGGGAGCAGCAGGAGCAGGGAGG - Intronic
1168771890 20:420871-420893 CGGAAGCAGCAGCAGCAGGAGGG + Exonic
1168957544 20:1844901-1844923 CGGCAGCAGCAGCCCCAGAAGGG - Intergenic
1168958889 20:1854770-1854792 CAGCAGCAGCAGCAGCACTTGGG + Intergenic
1169065614 20:2692925-2692947 GAGCAGCAGCAGCAGCAGCCCGG - Exonic
1169111295 20:3035892-3035914 CAGAAGCAGCAGCAGCAGTCAGG + Exonic
1169488496 20:6052767-6052789 CGTCAGCAGCAGCAGCGGTAGGG + Exonic
1170150524 20:13221793-13221815 CCCCAGCAGCAGCAGCAGCTCGG - Exonic
1170330199 20:15201046-15201068 CAGCAGCAGCAGCACCTGGGAGG - Intronic
1170330200 20:15201049-15201071 CAGCAGCAGCAGCAGCACCTGGG - Intronic
1170624523 20:18021221-18021243 AGGCAGCAGCAGCAGCAGTAGGG - Intronic
1170629729 20:18056791-18056813 CGGCAGCGGCAGCAGCAGCGCGG - Exonic
1170853224 20:20022963-20022985 CGGCAGCAGAAACAGCAGAGGGG + Intronic
1170924745 20:20712594-20712616 CGGCGGCGGCGGCAGCAGCGGGG - Intergenic
1170999111 20:21396194-21396216 CAGCAGCTGCAGCAGGAGGGCGG - Exonic
1171152258 20:22837547-22837569 AGGAAGCACCAGCAGGAGAGTGG - Intergenic
1171847145 20:30284084-30284106 CGGCGGCAGCAGGAGCATCGCGG + Intergenic
1172042296 20:32053868-32053890 CAGCAGCAGCAGCATCACCGGGG - Intronic
1172100799 20:32483279-32483301 CGGCGGCAGCAGCCGGAGAAGGG + Intronic
1172100802 20:32483282-32483304 CGGCAGCAGCCGGAGAAGGGGGG + Intronic
1172167636 20:32908611-32908633 CAGCAGCAGCAGCTGCAGAGAGG - Intronic
1172520581 20:35562949-35562971 AGGCAGCAGCAGCCCCACAGTGG - Intergenic
1172970930 20:38872620-38872642 CAGCAGCAGCAGCAGCACCTGGG - Intronic
1173179746 20:40796825-40796847 GGGCAGGAGCAGCAGCAGAGTGG - Intergenic
1173807441 20:45935023-45935045 TGGCGGCGGCAGCAGCGGAGGGG - Intronic
1173855997 20:46251220-46251242 CAGCAGCAGCAGCAGTAGCGCGG + Exonic
1174053915 20:47785433-47785455 CGGCAGCGGCAGCGGCGGCGCGG - Intronic
1174298853 20:49568063-49568085 TAGCAGCAGCAGCAACAGTGCGG + Exonic
1174371303 20:50089994-50090016 AGGTGCCAGCAGCAGCAGAGGGG + Intronic
1174734998 20:52957392-52957414 CAGCAGCAGCAGCAGCACCTGGG + Intergenic
1174882166 20:54291869-54291891 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1175116132 20:56683811-56683833 CTGGAGCAGAAGCAGCAGAGAGG + Intergenic
1175166058 20:57045480-57045502 CTGCAGCATCAGCAGCATCGGGG + Intergenic
1175504380 20:59471167-59471189 GGGAAGCAGCAGCTGCAGTGAGG + Intergenic
1175582665 20:60112616-60112638 CAGCATCAGCAGCAGCACAGTGG + Intergenic
1175834884 20:61987081-61987103 CAGCAGCAGCAGCAACAGCCAGG + Intronic
1176008986 20:62881693-62881715 CTGAAGCAGCTGCAGCCGAGCGG - Exonic
1176383090 21:6123108-6123130 CAGCAGCAGCAGCAGGAATGGGG - Exonic
1176418130 21:6491573-6491595 GGGCAGCAGCAGCTCCAGACTGG + Intergenic
1176680256 21:9815602-9815624 CGGCGGCAGCAGGAGCATCGCGG - Intergenic
1176680538 21:9817011-9817033 CGGCGGCAGCAGGAGCATCGCGG - Intergenic
1176684753 21:9838120-9838142 CGGCGGCAGCAGGAGCATCGCGG - Intergenic
1176795918 21:13371308-13371330 TGGCAGCAGCAGCAGTCTAGGGG - Intergenic
1176798622 21:13397967-13397989 CAGAAGCAGCAGCTGCATAGTGG - Intergenic
1177209324 21:18050485-18050507 GGGCAGTAGCAACAGCAGATTGG + Intronic
1177237569 21:18412722-18412744 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1177507730 21:22040187-22040209 TGCCAGCAGCAGAAGCACAGTGG + Intergenic
1178061434 21:28857054-28857076 AGCCAGCAGCAGCAGCAGGCTGG + Intergenic
1178319994 21:31597904-31597926 CGGCGGCAGCAGCAGCTGCAAGG + Intergenic
1178521145 21:33289378-33289400 CGACACCAGCAGCAGCGGTGGGG - Intronic
1178728060 21:35072770-35072792 GGCCAACAGCAGCAGCAGTGTGG + Intronic
1178854605 21:36239881-36239903 CTGCAGCAGCAGCAGGAGCACGG - Exonic
1178973380 21:37201008-37201030 GGGCAGCAGCAGCAGGAGTGTGG + Intronic
1179085106 21:38209182-38209204 CTGGAGCAGCAGGAGCAAAGGGG + Intronic
1179368994 21:40786436-40786458 CAGCAGCATCAGCAGCACACGGG + Intronic
1179740379 21:43415131-43415153 CAGCAGCAGCAGCAGGAATGGGG + Exonic
1180009501 21:45040319-45040341 CCACAGCAGCAGCAGCAGCATGG - Intergenic
1180018158 21:45101011-45101033 CAGCAGCAGCAGCGCCAGTGCGG + Intronic
1180025733 21:45161121-45161143 CGGCAGCAGCAACTCCAGACAGG - Intronic
1180054075 21:45348106-45348128 CAGCAGCAGCAGCCCGAGAGTGG + Intergenic
1180151056 21:45948122-45948144 CTGCAGCAGCCTCAGGAGAGGGG - Intergenic
1180188852 21:46153294-46153316 CAGGAGCAGCAGCACCTGAGCGG + Intronic
1180215055 21:46318434-46318456 GGGCAGCAGCTGAGGCAGAGGGG + Intronic
1180863896 22:19104881-19104903 AAGCAGCAGCAGCAGCAGAGGGG + Intronic
1180962701 22:19769349-19769371 CAGCAGCAACAGCAGCAGTGTGG - Intronic
1181145117 22:20840301-20840323 CTGCTGCTGCAGCAGCACAGTGG + Intronic
1181175490 22:21032526-21032548 CGGCTGCGGCAGCAGCAGGTGGG - Exonic
1181493942 22:23277504-23277526 CAGCAGCAGCAGCAGGGGATGGG - Intronic
1181493945 22:23277510-23277532 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1181572026 22:23772920-23772942 GAGCAGCAGCAGCAGCATCGGGG - Exonic
1181725136 22:24806237-24806259 CGGCTGCAGCAGCAGCGCCGCGG + Intronic
1182123130 22:27799612-27799634 CAGCAGCAGCAGCAGCAGCATGG - Exonic
1182355572 22:29720987-29721009 GGGCAGCAGCAGAAGGGGAGAGG + Intronic
1182460747 22:30481882-30481904 CAGCAGCAGCAGGAGCAGGAGGG + Intergenic
1182460748 22:30481885-30481907 CAGCAGCAGGAGCAGGAGGGCGG + Intergenic
1182556989 22:31134485-31134507 CTGGAGGAGCAGCAGGAGAGAGG - Exonic
1182567687 22:31212316-31212338 CGGCGGCGGCAGGAGCTGAGGGG + Intronic
1183061955 22:35341627-35341649 GGGCTGCAGCAGGAGCAGATTGG - Intronic
1183161249 22:36114794-36114816 CTGCAGCAGGTGCAGCAGAAGGG - Intergenic
1183229116 22:36569956-36569978 GCGCAGCAGCAGCAGCTCAGAGG + Intronic
1183337614 22:37259593-37259615 CGGCAGAAGCTGCGGCCGAGAGG - Intergenic
1183359015 22:37373773-37373795 AGGCGGCAGCAGCTGCAGGGAGG + Exonic
1183462127 22:37957903-37957925 GGGCAGTGGCAGAAGCAGAGAGG - Intronic
1183574860 22:38681779-38681801 GGGCATTAGCAGCAGCTGAGAGG - Intergenic
1184279810 22:43430525-43430547 TGGCAGCAGGAACAGCACAGAGG - Intronic
1184301546 22:43563659-43563681 CACCAGCAGCAGCAGCAGCGCGG - Intronic
1184322844 22:43756306-43756328 GTGCTGCAGCTGCAGCAGAGAGG - Intronic
1184696543 22:46142654-46142676 CGGCAGAAGGAGCAGGAGCGGGG - Intergenic
1184742061 22:46434324-46434346 AGTCAGCAGCAGCAGCTGGGAGG + Intronic
1184835657 22:47019579-47019601 GGGCAGCAGAATCAGCAGTGGGG + Intronic
1184925290 22:47632204-47632226 CAGCAGCAGCAGCAGCAGCCCGG + Intergenic
1184933727 22:47702252-47702274 CAGCAGCAGCAGCAGCGGGGTGG - Intergenic
1184933728 22:47702255-47702277 CAGCAGCAGCAGCAGCAGCGGGG - Intergenic
1184937610 22:47736444-47736466 AGGCCCCAGCAGCAGCAGGGAGG + Intergenic
1185236462 22:49716420-49716442 TTGCAGCACCAGCAGCAGCGAGG - Intergenic
1185251535 22:49804237-49804259 CTGCAGCCGCCGCAGCAGGGGGG + Exonic
949376867 3:3400565-3400587 TGGCAGCAGCAGTGGCAGTGGGG + Intergenic
949682572 3:6531644-6531666 GGGCAGGATCAGCAGAAGAGAGG + Intergenic
949875340 3:8623026-8623048 TGGCTGCAGCAGCAGCAGAAGGG + Intronic
951078507 3:18425122-18425144 CAGCAGGAGCAGCGGCGGAGAGG - Intronic
951477199 3:23119469-23119491 GAACAGCAGCAGCAGCAGGGGGG - Intergenic
952055118 3:29434811-29434833 CAGCAGCAACAACAGCAGCGGGG + Exonic
952420026 3:33122269-33122291 GGGCAGCAGCAGCAGCAAGAAGG - Intronic
952583980 3:34869232-34869254 GACCAGCAGCATCAGCAGAGTGG + Intergenic
952644648 3:35640087-35640109 CAGCAGCAGCAGGGGCAGCGGGG + Intronic
952878767 3:37969956-37969978 TGGCAGGAGGAGCAGCAGAGGGG - Intronic
952884690 3:38005284-38005306 TGGCTGCAGCAGAAGCAGTGAGG - Intronic
952942490 3:38454762-38454784 CAGCAGCAGCAGCAGCATGCGGG + Intronic
953801817 3:46030716-46030738 CAGCTGCAGGAGCAGCAGTGGGG + Intergenic
953993037 3:47498544-47498566 TGGCTGTAGCAGCAGCAGGGAGG - Intronic
954035687 3:47849798-47849820 CCGGAGGAGCAGCTGCAGAGCGG - Intronic
954304490 3:49718231-49718253 CGGCGGCAGCAGCGGCAGGGTGG + Exonic
954419869 3:50413112-50413134 CAGCGGCAGCAGCAGCTGGGTGG - Intronic
954419870 3:50413115-50413137 TGGCAGCGGCAGCAGCAGCTGGG - Intronic
954579064 3:51693253-51693275 CGGCAGCAGGCGCAGCAGGCTGG + Intronic
954816747 3:53288362-53288384 AGGCATAAGCAGCAGAAGAGTGG + Intronic
955081473 3:55661466-55661488 AGGCAGCAGAAGAGGCAGAGAGG - Intronic
955387606 3:58492053-58492075 CGGCGGCGGCGGCGGCAGAGGGG - Intergenic
955935628 3:64099902-64099924 TGGCACCACCATCAGCAGAGAGG + Exonic
956193467 3:66629571-66629593 TTGCTGCAGCAGCAGCAGCGGGG + Intergenic
956193468 3:66629574-66629596 CTGCAGCAGCAGCAGCGGGGAGG + Intergenic
956609144 3:71104392-71104414 CAGCAACAGCAGCAGAAGGGCGG - Intronic
956609145 3:71104395-71104417 CAGCAGCAACAGCAGCAGAAGGG - Intronic
956780276 3:72597942-72597964 CAGCAGTAGCAGCAGCAGCAGGG + Intergenic
956813608 3:72888280-72888302 CAGCAGCGCCAGCAGCAGCGCGG - Exonic
956978978 3:74614621-74614643 CGGCAGCAGCCACAGCAGCCTGG - Intergenic
958678599 3:97296618-97296640 CAGCAGCAGCAGTGGCAGTGAGG + Intronic
959291086 3:104475133-104475155 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
960198908 3:114807430-114807452 CAGCAGCAGCTGCAGGGGAGGGG - Intronic
960442165 3:117702176-117702198 TGGCAGCAGGAGCAAGAGAGAGG - Intergenic
960688145 3:120314231-120314253 CAGCAGCAGCAGCAGCATGGTGG - Intergenic
960688146 3:120314234-120314256 CTGCAGCAGCAGCAGCAGCATGG - Intergenic
960879042 3:122326849-122326871 TGGCAGCAGCAGCAGCACTTGGG - Intronic
961643931 3:128382386-128382408 CGGCACCAGCAGGAGCTGTGTGG + Intronic
961819849 3:129570456-129570478 GGGGAGCAGGAGGAGCAGAGAGG - Intronic
961856710 3:129878734-129878756 CAGCAGCAGCAGCAGCACCTGGG + Intronic
962212740 3:133492310-133492332 CAGCAGCTGCAGCAGCATGGCGG - Intergenic
962212741 3:133492313-133492335 TGGCAGCAGCTGCAGCAGCATGG - Intergenic
962230575 3:133661994-133662016 CGGCAGCTGCAGCAGAAGAGCGG + Intergenic
963150863 3:142044204-142044226 CGGCGGCGGCAGCAGCAAAAGGG + Intronic
963809991 3:149766862-149766884 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
963870192 3:150408301-150408323 CGGCAGCGGCGGCGGCAGCGGGG + Intergenic
964791983 3:160460888-160460910 TGGCAGCAGATGCAGCAGGGTGG - Intronic
965637102 3:170793683-170793705 GGACAGGAGCTGCAGCAGAGTGG - Intronic
966448178 3:180027116-180027138 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
966921872 3:184617473-184617495 CAGCAGCAGCAGCAGCAAGATGG + Intronic
967170578 3:186820203-186820225 AGGCAGCAGCAGTAGCATGGTGG + Intergenic
967659603 3:192090707-192090729 CAGCAGCTGCAGCAGCACAGTGG - Intergenic
967997367 3:195176938-195176960 CGTCAGCAGCGGCAGCAGGCCGG - Intronic
968165359 3:196460382-196460404 AGGTAGCAGCAGCAGCTGGGAGG + Intergenic
968262120 3:197333974-197333996 CAGCAGCAGCAGCAGGAGCTAGG + Intergenic
968515126 4:1012499-1012521 CGGCAGCAGGAGCAGCAACAGGG - Exonic
968522699 4:1041215-1041237 CGGGAGCAGCAGGAGGGGAGCGG - Intergenic
968542001 4:1172545-1172567 CGGCAGGAGCAGCGGGAGCGCGG + Exonic
968811527 4:2801569-2801591 CTGCTGCAGCCCCAGCAGAGGGG + Intronic
968967850 4:3778339-3778361 CAGCTGCAGCAGCAGCAGCTGGG + Intergenic
969006136 4:4021336-4021358 CAGCAGCAGCAGCAGCTGGAGGG + Intergenic
969134475 4:5019401-5019423 CGCCAGGAGCAGCAGCAGCACGG + Exonic
969222162 4:5768074-5768096 TTGCAGCAGCAGCAGCAGTGAGG + Intronic
969402282 4:6963375-6963397 CCGGAGCAGCAGCACCAGTGTGG + Intronic
969481915 4:7451282-7451304 CAGCAGCAGCAGCGGCAGTGGGG + Intronic
969746776 4:9078951-9078973 CGGCGGCAGCAGCAGCTGGAGGG - Intergenic
969806812 4:9615954-9615976 CAGCAGCAGCAGCAGCTGGAGGG - Intergenic
970180274 4:13384367-13384389 CAGCAGCAGCAGCAGCACGGTGG - Intronic
970180275 4:13384370-13384392 CAGCAGCAGCAGCAGCAGCACGG - Intronic
970585706 4:17512164-17512186 CGGCAGCAGCGGGCGCGGAGCGG - Exonic
970592562 4:17572212-17572234 CAGCAGCAGCAGCAGCAAGATGG - Intergenic
970646173 4:18122769-18122791 CGAGAGCAGGAGCAGAAGAGAGG + Intergenic
972083432 4:35182708-35182730 CAGCAGCAGCAGTAGCAGTGTGG - Intergenic
972125529 4:35760621-35760643 CTGCAGCAGCACTGGCAGAGGGG - Intergenic
972369657 4:38410677-38410699 GCGGAGGAGCAGCAGCAGAGGGG + Intergenic
973306689 4:48659986-48660008 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
973795998 4:54427406-54427428 TGACAGCAGCAGCAACAGACAGG + Intergenic
973888466 4:55346422-55346444 CGGCAGGAGCTGCAGCAGTAGGG - Exonic
973916078 4:55636112-55636134 CAGCAGCAGCAGCAGGAGCGGGG + Exonic
975585063 4:75940887-75940909 GGCCAGCAGCAGCAGCAGCAGGG + Exonic
976088181 4:81427732-81427754 AAGCAGCAGCAGCAGCAGGCAGG + Exonic
976122650 4:81800033-81800055 CAGCAGCAGCAGCAGAGGAAAGG + Intronic
977696577 4:99972237-99972259 CAGAGGCAGCAGCAGCACAGGGG - Intergenic
979076331 4:116275320-116275342 CAGCAGAAGTAGCAGCAGTGTGG - Intergenic
979671717 4:123366607-123366629 CTAGAGCAGCAGCAGCAGAGAGG + Intergenic
979975472 4:127190732-127190754 CTGCAGTAGCAGCAGCAGCTGGG + Intergenic
980027119 4:127781014-127781036 CTACAGCAGCAGCAGCAGCAAGG - Intergenic
980532147 4:134070300-134070322 TGCCAGCAGCAGCGGCAGTGTGG + Intergenic
980792028 4:137632454-137632476 CAGCAGCAGCAGCAGCATGGGGG - Intergenic
980792032 4:137632457-137632479 TGCCAGCAGCAGCAGCAGCATGG - Intergenic
980970074 4:139559304-139559326 CAGCAGCAGCAGAAGTAGTGTGG + Intronic
981511962 4:145567021-145567043 CAGCAGCAGCAGCAGCATGGCGG - Intergenic
981511963 4:145567024-145567046 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
981600360 4:146481400-146481422 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
982097891 4:151939849-151939871 CAGAGTCAGCAGCAGCAGAGTGG - Intergenic
982215602 4:153080302-153080324 CAGTAGCAGCAGCAGCAGCCAGG + Intergenic
982265321 4:153533369-153533391 CTGCAGCAGCAGTGGCGGAGGGG + Intronic
983130438 4:164012526-164012548 TAGCAGCAGCAGCAGCAGCCAGG + Intronic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
983259485 4:165440421-165440443 GAGCAGCAGCAGCAGCTAAGGGG - Intronic
984057541 4:174948652-174948674 CAGCAGCTGCAGCAGCATGGTGG + Intronic
984088404 4:175340401-175340423 CCTGAGAAGCAGCAGCAGAGAGG - Intergenic
984432305 4:179664768-179664790 GAGCAGCAGCAGCAGCTCAGAGG - Intergenic
984592755 4:181635141-181635163 CTGCATCAGCAGCAGAAGGGAGG + Intergenic
984778781 4:183505606-183505628 CGGCTGCAGCTGCCGCTGAGGGG + Intronic
984820518 4:183877660-183877682 CAGCAGCAGCAGCGGAAGTGCGG - Intronic
984835030 4:184011379-184011401 GGACAGCAGCAGCATCACAGTGG + Exonic
985093823 4:186392093-186392115 CAGCAGCAGCAGCAGCATCTTGG + Intergenic
985279473 4:188270965-188270987 CACCAGCAGCAGCAGCAGCCTGG + Intergenic
985543581 5:498251-498273 CGGAAGCAGCAGCTCCAGGGTGG - Intronic
986284099 5:6347349-6347371 CTGGAGCTGCCGCAGCAGAGAGG - Intergenic
986297048 5:6448621-6448643 TGGCAGCAGCAGCAGCACCCCGG + Exonic
986392620 5:7300297-7300319 CGGAAGCAGGAGAAGCAGATGGG - Intergenic
986392674 5:7300654-7300676 CGGAAGCAGGAGGAGCAGACGGG - Intergenic
986392747 5:7301032-7301054 CGGAAGCAGGAGGAGCAGATGGG - Intergenic
986456756 5:7927613-7927635 TGGCAGCATCAGCAGCAGCCAGG + Intergenic
986466924 5:8034997-8035019 GAGCAGCAGCAGCACCAGGGAGG + Intergenic
986561408 5:9063761-9063783 AGGCAGCAGCAGCAGCAGGTGGG + Intronic
987160534 5:15137175-15137197 TGGTGGCAGCAGGAGCAGAGAGG + Intergenic
988401763 5:30771278-30771300 AGGCAGCGGGAGCAGCAGGGAGG + Intergenic
988487414 5:31678359-31678381 TGGAAGCAGCAGCCGCTGAGGGG + Intronic
988779124 5:34503099-34503121 GGACAGCAGCAGCAGCTGAATGG + Intergenic
989341976 5:40386378-40386400 CAGCAACAGCAGCAGCAGCTGGG - Intergenic
989461818 5:41708498-41708520 CTGCAGCAACAGTGGCAGAGAGG - Intergenic
989710177 5:44388612-44388634 AAGCAGCAGCAGCAGCAGCCGGG + Exonic
990165537 5:52989491-52989513 CAGCAGCAGCGGCAGCGGCGCGG - Exonic
990524053 5:56607597-56607619 TGGCAGAGGCAGCAGGAGAGGGG - Intergenic
990825520 5:59893682-59893704 CAGCAGCAGCAGCATCAGGAAGG - Exonic
990876687 5:60494308-60494330 CTGTAGCTGCACCAGCAGAGGGG - Intronic
991027982 5:62051831-62051853 CAGCAGCAGAAACAGCACAGTGG + Intergenic
991927465 5:71719334-71719356 AGGTAGCATCAGCAGCAGGGCGG - Exonic
991967393 5:72107066-72107088 CGGCTGCAGCAGGAGCTCAGCGG + Intergenic
992146723 5:73858055-73858077 CAGCAGCAGCAGTAGGAAAGTGG - Intronic
993486708 5:88495965-88495987 CGGCAGCATCAGCAGCATCTGGG - Intergenic
994099285 5:95876751-95876773 CGGCAGCAACAGCAGCACCTGGG - Intergenic
994145752 5:96393306-96393328 CCCCAGCAGCAGCAGCGTAGGGG - Exonic
994473414 5:100238433-100238455 CTGCAGAAGCAGTAGCAGAGAGG + Intergenic
995064284 5:107842558-107842580 TGGCAGCATGAGCAACAGAGGGG + Intergenic
995068440 5:107889755-107889777 CTTAAGCAGCAGCAGCAGCGAGG + Intronic
995650531 5:114362919-114362941 CGGCGGCAGCGGCTGCAGACGGG - Exonic
996167011 5:120236611-120236633 TTCCAGCAGCAGCAGCAGCGTGG + Intergenic
996552308 5:124743863-124743885 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
996720762 5:126628094-126628116 CTGAAGCAGCAGCAGTGGAGGGG + Intergenic
997182164 5:131841339-131841361 TGCCAGCAGTAGCAGCAGTGTGG + Intronic
997429660 5:133828959-133828981 AGGCAGCCTCACCAGCAGAGGGG + Intergenic
997659513 5:135578740-135578762 CAGCAGCAGCAGGAGCAGCGCGG + Exonic
997887270 5:137641412-137641434 TGGCAGCAGCAGCAGCACCTGGG - Intronic
997980707 5:138465944-138465966 CAGCAGCAGCAGCAGCAGCGGGG + Exonic
998774950 5:145588781-145588803 AGGCAGCACCAGCAGCAGCCAGG + Intronic
998799638 5:145856365-145856387 CAGGAGCAGCAGCAGCAGCTAGG - Intergenic
998820606 5:146054357-146054379 CAGCAGTAGCAGCAGCAGCAAGG - Intronic
998940870 5:147280615-147280637 CCACAGCAGCAGCAGCAGCAAGG + Intronic
999052172 5:148534544-148534566 CTGCAGAAGCAGTGGCAGAGAGG - Intronic
999232186 5:150068239-150068261 CAGGAGCAGCAGCAGCAGCAAGG + Exonic
999542070 5:152584788-152584810 CTGCAGCTGCAGTGGCAGAGGGG + Intergenic
1000065545 5:157690565-157690587 CGGCAGCAGGAGCCGCAGGTCGG + Intergenic
1000275441 5:159730651-159730673 GGGCAGAATCAGCAGAAGAGGGG - Intergenic
1000698796 5:164422215-164422237 CTGCAGCAGCAGGGGCACAGGGG + Intergenic
1001035089 5:168291775-168291797 CGGCAGCGGCAGCGGCGGCGTGG + Intronic
1001548967 5:172588338-172588360 GGACAGCAGCAGCAGCTGTGTGG - Intergenic
1001775279 5:174324224-174324246 AGGGTGCAGAAGCAGCAGAGGGG + Intergenic
1002021192 5:176365477-176365499 CGGCCGCAGCAGTCGCAGCGGGG + Exonic
1002096196 5:176832580-176832602 TAGCAGCAGCGGCAGCTGAGGGG - Intronic
1002455906 5:179345266-179345288 CAGCAGCAGCAGCAGCAGCGCGG + Exonic
1002660460 5:180788026-180788048 ATGCAGCAGCAGCAGCAGCCAGG + Intergenic
1002789840 6:428859-428881 GGTCAGCAGGAGCAGGAGAGCGG - Intergenic
1002838759 6:887832-887854 GGCCAGCACCACCAGCAGAGGGG + Intergenic
1002931322 6:1637076-1637098 AGGCAGCTGTGGCAGCAGAGTGG + Intronic
1003097785 6:3156305-3156327 CTGCAGCAGCCGCTGCTGAGGGG + Intronic
1003156787 6:3603609-3603631 CAGCAGCAGCAGCTGCGGATGGG + Intergenic
1003330424 6:5124278-5124300 GGGCAGCAGCAGGAGAAAAGTGG - Intronic
1003482478 6:6546322-6546344 CCGCAGCCGCAGCCGCGGAGGGG + Intergenic
1003592890 6:7450474-7450496 CAGCAGCAGCAGCAGGAGAAAGG + Intergenic
1003870388 6:10398307-10398329 CAGCAGTAGCAGCAGCAGGAAGG + Exonic
1004320349 6:14627000-14627022 CATCTGCAGCAGCAGCAGTGTGG + Intergenic
1004675863 6:17841545-17841567 TGTAAGCAGCAGCAGCAGAGGGG + Intronic
1004732208 6:18368677-18368699 CAGCAGCAGCAGCGGCTGCGCGG - Intergenic
1005948313 6:30611664-30611686 GAGCAGCAGCAGAAGCAGGGAGG + Intronic
1006193620 6:32223899-32223921 CAGCAGCAGCAGCAGTGAAGGGG + Exonic
1006380397 6:33693939-33693961 CGGAAGCCGCTGCTGCAGAGGGG + Intronic
1006820429 6:36889198-36889220 CAACAGCAGCTGCTGCAGAGAGG + Intronic
1006911361 6:37565773-37565795 CGGCAGCAGCAGCCTCAGGGAGG - Intergenic
1007221460 6:40282243-40282265 GAGCAGCAGCAGCAGCACTGGGG - Intergenic
1007339920 6:41184885-41184907 CAGCAGCAGCAGCAGCACAACGG + Intergenic
1007342578 6:41200976-41200998 CAGCAGCAGCAGCAGCAGGAAGG + Exonic
1007350748 6:41271936-41271958 GAGCAGCAGCAGCAGCAGCCAGG + Intronic
1007415915 6:41691077-41691099 CAGCAGCAACAGCAGCAGCTCGG - Exonic
1007534729 6:42576424-42576446 GGGCAGCAGCAGCAGCAGAATGG - Intronic
1007576681 6:42929617-42929639 CAGCAGCAGCAGCAGCAGCAAGG - Exonic
1007625339 6:43243496-43243518 CGGCGGCGGCAGCGGCAGAGCGG - Intergenic
1007654838 6:43445762-43445784 CGGCAGCAGGAGCAGCAGCCAGG - Exonic
1007680287 6:43629051-43629073 CGGCAGCAGCAGCGGCTGCGGGG - Exonic
1007769877 6:44183959-44183981 TACCAGCAGCAGCAGCAGCGAGG + Exonic
1008469373 6:51866040-51866062 CAGCAGCAGCAGCAGCACCAGGG - Intronic
1008649511 6:53548334-53548356 TAGCAGCAGCAGCAGCCCAGAGG - Intronic
1008716396 6:54295097-54295119 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1008716397 6:54295100-54295122 CAGCAGCAGCAGCAGCGGGGTGG + Intergenic
1008806240 6:55432041-55432063 GAGCAGCAGCAGCAGCAAAATGG - Intergenic
1009621556 6:66084647-66084669 CAGCAGGAGCAGCAGCACAGTGG + Intergenic
1009705170 6:67239815-67239837 TGGCATCAGCACCAGCAGAGTGG - Intergenic
1009803908 6:68577332-68577354 CAGCAGCAGCAGCAGCATTTGGG + Intergenic
1011399929 6:86949355-86949377 CAACAGCAGCAGCAGCAGCAGGG - Intronic
1011557926 6:88588539-88588561 AGGCAGGAGAAGCAGCAGATGGG - Intergenic
1012247165 6:96938632-96938654 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1012616424 6:101284132-101284154 CAGCAGAAGCAGTGGCAGAGAGG - Intergenic
1012668917 6:102015650-102015672 CAGTAGCAGCAGCAGCACGGTGG - Intronic
1012964402 6:105657689-105657711 CCACAGCAGGAGCAGCAGAGGGG - Intergenic
1013155806 6:107490270-107490292 CGGGAGCGGCAGCGGCAGCGAGG + Exonic
1013422519 6:109979180-109979202 CGGCGGCCACAGCAGCAGGGGGG + Exonic
1013804770 6:113985045-113985067 CAGCAACAGCAGCAGCAAATGGG - Intronic
1014137535 6:117907171-117907193 CGGCGGCGGCGGCGGCAGAGCGG - Intergenic
1014199094 6:118588999-118589021 CAACAGCAGCAGCGGCAGTGAGG - Intronic
1014592146 6:123286841-123286863 CAGCAGCAGCAGCAGCACCTGGG + Intronic
1014701936 6:124699621-124699643 CTGGAGCAGCAGCAAGAGAGTGG - Intronic
1014854392 6:126381659-126381681 TGTCAGCAGCAGCAGCAGTGCGG - Intergenic
1014947692 6:127516370-127516392 CTGCAGCAGCAGCAACAGCAGGG - Exonic
1015220639 6:130801497-130801519 CGGCAGCGGCGGCAGCGGCGGGG + Intergenic
1015403055 6:132808691-132808713 CAGCAGGGGAAGCAGCAGAGAGG + Intergenic
1015773649 6:136792683-136792705 CAGCAGCAGCGGCAGCCGAAAGG + Intergenic
1015804411 6:137093861-137093883 CTGGAGCAGCAGCAAGAGAGAGG + Intergenic
1015878916 6:137851454-137851476 CACCAGCAGCAGCAGCAGCTGGG + Intergenic
1016272266 6:142302250-142302272 GTGGAGCAGCGGCAGCAGAGCGG + Exonic
1017973097 6:159329915-159329937 CAGCAGTGGCAGCAGCAGTGAGG + Intergenic
1018013561 6:159693199-159693221 CGGCAGCGGCTTCAGCAGATCGG - Exonic
1018166079 6:161098317-161098339 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1018400326 6:163414600-163414622 CGGCAGCAGCGGCGGCGGCGGGG - Intronic
1018908434 6:168088398-168088420 AGGCAGCAGTAGCAGCTGAGAGG - Intergenic
1018934851 6:168267058-168267080 CCGCAGCAGCAGCAGCTGCTAGG - Intergenic
1019032297 6:169024112-169024134 AATCAGCAGCAGAAGCAGAGGGG + Intergenic
1019450640 7:1095943-1095965 CGGCAGCAGCGGCAGCGGGGAGG + Intronic
1019484192 7:1281141-1281163 CAGCAGCAGCAGCAGCAGCCAGG + Intergenic
1019484193 7:1281144-1281166 CAGCAGCAGCAGCAGCCAGGAGG + Intergenic
1019657729 7:2205673-2205695 CGGCAGGTGTGGCAGCAGAGAGG - Intronic
1019876020 7:3811614-3811636 GGCCAACAGCAGCAGCAGAGAGG - Intronic
1020006398 7:4785637-4785659 GGGCAGCAGCACCCGCACAGAGG - Exonic
1020034938 7:4959085-4959107 CGGCGGCGGCAGCAGCAGGTTGG + Exonic
1020049471 7:5072387-5072409 CAGCAGCAGCAGCAACAGCGGGG - Exonic
1020086436 7:5313153-5313175 CAGCAGCAGCAGCAGCGGCTCGG - Exonic
1020326680 7:6979626-6979648 CGGCGGCAGCAGCAGCTGGAGGG + Intergenic
1020513783 7:9090964-9090986 CTACAGCAGCAGTGGCAGAGGGG - Intergenic
1020570846 7:9859158-9859180 GGGGAGCAGCTGCTGCAGAGGGG - Intergenic
1021131140 7:16913976-16913998 CAGTAGCAGCAGCAGCAGTGTGG - Intergenic
1021561361 7:21971859-21971881 GAGCAGCAGCTGCAGCAGAGAGG - Intergenic
1022174797 7:27862721-27862743 AGGCAGCAGCAACAGAAGCGTGG - Intronic
1022459864 7:30594962-30594984 CGGCAGCAGCAGCAGCAGAGCGG - Exonic
1022538214 7:31111369-31111391 TGGCAGCAGCAGTAGCAGTAAGG - Exonic
1022590705 7:31659467-31659489 GGGCAGAAGAAGAAGCAGAGAGG - Intergenic
1024279920 7:47710376-47710398 CTCCTGCAGCACCAGCAGAGGGG + Intronic
1024298292 7:47863675-47863697 TGGCAGGAGCAGCGGCAGTGTGG + Intronic
1024674575 7:51626720-51626742 GGGAAGCAGCAGCAGGAGGGAGG - Intergenic
1025014485 7:55427903-55427925 CAGCAGCAGCAGCTGTGGAGGGG + Intronic
1025664064 7:63572914-63572936 CAGCAGCAGCAGCAGCGGCTCGG - Intergenic
1025813153 7:64888204-64888226 GGGCAGCAGCAGCAGCAGCCAGG - Intronic
1026764986 7:73154820-73154842 CAGCAGCAGCAGCAGCACCGGGG + Intergenic
1026822176 7:73557255-73557277 CGGCAGCAGCCGCAGCAGGTGGG + Intronic
1026830162 7:73605785-73605807 CGACATCAGCAGCAGCAGGCAGG + Intronic
1026853479 7:73738659-73738681 CAGCAGCAGCGGCGGCCGAGGGG - Exonic
1026916361 7:74122249-74122271 CGGCTGCAGCAGCAGCTGCCAGG + Exonic
1027082182 7:75237792-75237814 CAACAGCAGCAGCAGCACCGGGG - Intergenic
1027628586 7:80574946-80574968 TGGCAGCTGCAGCAGCAGCAGGG + Intronic
1027859832 7:83563489-83563511 CAGCAGCAGCAGCAGCAGCTAGG + Intronic
1028477190 7:91265154-91265176 CCGCCTCAGCAGCAACAGAGCGG + Exonic
1028673047 7:93426490-93426512 CGGCTGCAGCGCGAGCAGAGCGG + Exonic
1028962545 7:96765491-96765513 GAGCAGCAGCAGCAGCAGCTGGG - Intergenic
1028963608 7:96776971-96776993 CAGAAGCAGTGGCAGCAGAGAGG + Intergenic
1029403278 7:100358325-100358347 CGGCTGCAGCAGGAGCAGCAGGG - Exonic
1029414815 7:100436133-100436155 CGGCAGCGGCGGCAGGTGAGCGG - Exonic
1029439032 7:100577300-100577322 CGGCGGCAGCAGCAGCAGAGCGG - Exonic
1029506481 7:100966478-100966500 CAGCAGCAGCACCAGCAGCGCGG - Exonic
1029547322 7:101217230-101217252 CGGCAGCAGCAGCAGGAACCGGG + Exonic
1030595218 7:111530046-111530068 CAGAAGCAGCATCAGCAAAGAGG + Intronic
1031053790 7:116972131-116972153 AGGGAGGAGCAGCAGCAGGGTGG + Intronic
1031629705 7:124032396-124032418 CAGCAGCAGCAGCAGCGGAGGGG - Exonic
1031966642 7:128031972-128031994 CGGCGGCAGCAGCAGCAGCGGGG + Intronic
1032216974 7:129965011-129965033 GGGCAAAAGCAGGAGCAGAGAGG - Intergenic
1033148025 7:138887864-138887886 CAGCAGCAGCAGCAGCAGTGAGG + Intronic
1033673015 7:143511272-143511294 CAGCAGCAGCAGCACCAGGCAGG + Intergenic
1034331531 7:150287355-150287377 CAGCAGCAGCAGCAGCATCCTGG - Intronic
1034366351 7:150551805-150551827 TAGCAGCAGCAGCAGAACAGTGG - Intergenic
1034426346 7:151016201-151016223 CAGCAGCAGCAGGAGCCGTGGGG - Exonic
1034470563 7:151252190-151252212 CGGCAGGAGGAGCAGGAGAGCGG + Intronic
1034800485 7:154052685-154052707 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
1035014066 7:155748769-155748791 CTGCAGCAGCAGCCACAAAGGGG - Intronic
1035057537 7:156046097-156046119 CAGGAGCAGGAGCAGGAGAGAGG + Intergenic
1035109706 7:156470927-156470949 CGGGAGCAGGAGCAGGAGAGCGG - Intergenic
1035133463 7:156676611-156676633 TGGTAGCAGGAGCGGCAGAGAGG - Exonic
1035297474 7:157875663-157875685 CTGCAGCAGCAGCAGCACCTTGG + Intronic
1036579689 8:10062230-10062252 CAGCAGCAGCAGCAGCTGGCTGG + Intronic
1036795941 8:11756993-11757015 CGCCACCACCAGCAGCAGCGAGG + Exonic
1037155574 8:15694901-15694923 CGCCAGCAGCAGCAGCAGTCTGG + Intronic
1037388373 8:18366303-18366325 CTGCAGTAGCAGTGGCAGAGAGG - Intergenic
1037465181 8:19152754-19152776 GTGCAGCAGAAGCAGCACAGAGG + Intergenic
1037552813 8:19991657-19991679 TGTCAGCAGCAGATGCAGAGAGG - Intergenic
1038131434 8:24736356-24736378 TGGCAACACCAGCAGCAGAGAGG + Intergenic
1038163309 8:25061218-25061240 CGTCAGGAGCATCGGCAGAGAGG - Intergenic
1038319515 8:26514220-26514242 CGGCAGCCGCGGCAGCAGCTAGG + Intergenic
1038429258 8:27486551-27486573 GGGCAGCAGCAGCAGCGGCCAGG - Intergenic
1038727611 8:30095452-30095474 CGGCGGCAGCAGCGGCAGCCGGG - Intronic
1038828540 8:31033148-31033170 CTGCGGCGGCTGCAGCAGAGGGG - Exonic
1040446885 8:47504922-47504944 CAGCAGCAGACGCTGCAGAGTGG + Intronic
1041167442 8:55103172-55103194 CAGCGGCAGCAACAGCAGCGGGG + Exonic
1041232546 8:55768395-55768417 CAGCTGCAGCAGCAGCAGCAAGG - Intronic
1041698840 8:60765630-60765652 CAGCAGCAGCAGCCGCACAAAGG - Intronic
1042027870 8:64443264-64443286 CAGCAGAAGCAGCAGCACATGGG + Intergenic
1042444024 8:68862548-68862570 CGGCAGCAGCAGCAGCAGGTGGG - Intergenic
1042573005 8:70187126-70187148 AGGCAGCAGGAGAAGCAGTGAGG + Intronic
1042951441 8:74204227-74204249 TGGCAGCAGCTGCAGCAGCCAGG + Intergenic
1044313882 8:90727060-90727082 CAGCGGCAGCAGCAGCATGGTGG - Intronic
1044313883 8:90727063-90727085 CAGCAGCGGCAGCAGCAGCATGG - Intronic
1044894913 8:96881344-96881366 TGGCAGGAGCAGGAGCAAAGGGG + Intronic
1044900700 8:96941174-96941196 CAGCAGCAGCAGCAGCACCAGGG - Intronic
1044923075 8:97186117-97186139 CTACAGCAGCAGCAGCAACGTGG + Intergenic
1044927899 8:97224691-97224713 CTGCAGAAGCAGCGGCAGAGGGG - Intergenic
1045305228 8:100951985-100952007 CGGCGGCGGCAGCAGCGGCGAGG + Exonic
1045398855 8:101790916-101790938 CAGCAGTAGCAGCAGCAGCAAGG + Intronic
1045499398 8:102733431-102733453 CAGCAGCAGGAGCAGCAGCATGG + Intergenic
1045716541 8:105053734-105053756 AAGTAGCAGCAGCAGCAGATAGG - Intronic
1045718319 8:105074905-105074927 CAGCAGCAGCAGCGGGAGGGAGG - Intronic
1045718320 8:105074908-105074930 CAGCAGCAGCAGCAGCGGGAGGG - Intronic
1045824926 8:106386071-106386093 GGGCAGCAGCAGCAGCAGCAAGG + Intronic
1046056681 8:109086655-109086677 CAGCAGGAGCAGCAGCAGTGAGG - Exonic
1046407423 8:113791525-113791547 CGGCAGCAGCAGCTCCAGATGGG + Intergenic
1047094604 8:121610424-121610446 CGGCAGCATCAGCAGCATGTGGG - Intergenic
1047418934 8:124690141-124690163 CGGGAGCAGCAGCAGTGGGGAGG - Intronic
1047418935 8:124690144-124690166 CGGCGGGAGCAGCAGCAGTGGGG - Intronic
1047493074 8:125390225-125390247 TGGCAGCGGCAGCAGCAGCGTGG - Intergenic
1047704118 8:127480565-127480587 AGACAACAGCAGCAGCAGAAAGG - Intergenic
1047836914 8:128703804-128703826 CTGCAGCAGCAGCAGCAACTTGG - Intergenic
1047961804 8:130016514-130016536 CAGCAGCAGCAGCAGCAGCCCGG + Intronic
1048274468 8:133055852-133055874 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1048472925 8:134719441-134719463 GCCCAGCAGCAGCAGCAGCGAGG + Intergenic
1048600186 8:135911341-135911363 AGGCAGCAGGGTCAGCAGAGTGG + Intergenic
1048752629 8:137697379-137697401 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1048765329 8:137837545-137837567 AAGCAGCAGCAGCAGCAGTTTGG + Intergenic
1048912871 8:139152854-139152876 CAGAAACAGCAGCAGCACAGAGG - Intergenic
1048980906 8:139703132-139703154 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1048980907 8:139703135-139703157 CAGCAGCAGCAGCAGCGGGGAGG + Intergenic
1049025916 8:139988757-139988779 CGTCAGCACCAGGAGCAGCGAGG - Exonic
1049047185 8:140162024-140162046 CCGCAGCAGCCCCAGCAGACCGG + Intronic
1049055939 8:140237678-140237700 AGGCAGCAGCAAGAGCAGAGCGG + Intronic
1049264644 8:141660910-141660932 TGGCAGAGGCAGCAGCAGATCGG + Intergenic
1049280043 8:141739698-141739720 GGGCAGGAGCAGCAGCAGTCAGG - Intergenic
1049331475 8:142056362-142056384 CGGCATGAGCAGAGGCAGAGAGG + Intergenic
1049345800 8:142137921-142137943 CGTAAGCAGCAGCAGCAGTAGGG - Intergenic
1049409027 8:142464242-142464264 CAGCAGCAGCAGTAGCAGCGGGG - Exonic
1049788562 8:144462729-144462751 CGGCGGCGGCGGCAGGAGAGCGG - Intronic
1049802581 8:144524936-144524958 CAGCAGCAGCGGCAGCAGTGCGG + Exonic
1049812307 8:144580958-144580980 CGGCAGCAGCGTCAGCCGTGAGG - Exonic
1049923773 9:389605-389627 CAGCAGCAGCAGCAGCACCCAGG + Intronic
1050052773 9:1620547-1620569 CAGCAGCAGCAGCAGCTGTTTGG + Intergenic
1050928472 9:11296463-11296485 CAGCAGCAACAGCAGCACGGTGG + Intergenic
1051266699 9:15316166-15316188 CAGCAGCAGCAGCAGCAAGTGGG - Intergenic
1051789246 9:20781772-20781794 TGGCATCACTAGCAGCAGAGAGG - Exonic
1051973066 9:22914156-22914178 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1053141924 9:35688003-35688025 CCGCAGCACCAGGAGCAGATAGG - Intronic
1053511271 9:38689739-38689761 CGGCAGCAGCAGCAACAGCAGGG - Intergenic
1053542847 9:38993161-38993183 CAGCAGCAGCAGTGGCAGCGAGG + Intergenic
1053607824 9:39679023-39679045 GGGCTGCAGCAGCAGCAAAAAGG - Intergenic
1053807293 9:41816678-41816700 CAGCAGCAGCAGTGGCAGCGAGG + Intergenic
1053865671 9:42435383-42435405 GGGCTGCAGCAGCAGCAAAAAGG - Intergenic
1054245711 9:62663386-62663408 GGGCTGCAGCAGCAGCAAAAAGG + Intergenic
1054559836 9:66697917-66697939 GGGCTGCAGCAGCAGCAAAAAGG + Intergenic
1054623299 9:67370749-67370771 CAGCAGCAGCAGTGGCAGCGAGG - Intergenic
1054716635 9:68563535-68563557 CGGCAGCAGCAGCATCAGCTGGG + Intergenic
1054790418 9:69251437-69251459 CATCTGCAGCAGCAGCAAAGGGG - Intronic
1055278124 9:74642494-74642516 GAACAGCGGCAGCAGCAGAGTGG + Exonic
1055840773 9:80500456-80500478 CAGCAGCAGCAGCAGCAGTACGG - Intergenic
1056109178 9:83377623-83377645 TGGGAGCAGGAGCAGGAGAGAGG - Intronic
1056180198 9:84075622-84075644 CAGCAACAGCAGCAGCAGCAGGG - Intergenic
1057514612 9:95710783-95710805 AGTCAGAAGCAGCATCAGAGAGG + Intergenic
1058732086 9:107860109-107860131 CACCAGCATCACCAGCAGAGAGG + Intergenic
1059397822 9:114049566-114049588 GGGCAGCACCAGCTGCAGGGTGG - Exonic
1059633963 9:116154404-116154426 CGGCAGCAGCGGGAGGCGAGGGG + Exonic
1060252516 9:121997555-121997577 TGCAAGCAGCAGCTGCAGAGAGG + Intronic
1060552335 9:124491524-124491546 CAGCAGCACCAGCAGCTCAGGGG + Intronic
1060970885 9:127737198-127737220 GGGTCACAGCAGCAGCAGAGTGG - Intergenic
1061011697 9:127959662-127959684 AGACAGAAGCAGCAGCAAAGGGG - Intronic
1061062510 9:128257747-128257769 CGGCAGGAGGAGCTGCACAGCGG - Intronic
1061293681 9:129666089-129666111 CGGGGGCAGCAGCGGCAGCGAGG + Exonic
1061550910 9:131334198-131334220 CGCCAGCAGCCTCAGCTGAGTGG - Intergenic
1061867429 9:133500066-133500088 CGCCGGCAGCAGCAGCCAAGGGG - Intergenic
1061989716 9:134152401-134152423 CGGCAGCACCCCCAGCAGATGGG - Intronic
1062084622 9:134642249-134642271 CAGCAGCAGCAGCAGCAGCGGGG - Exonic
1062173681 9:135149127-135149149 AGGCCGCTGCAGCAGTAGAGAGG + Intergenic
1062403702 9:136383536-136383558 CAGCAGCAGCAGCAGCGAGGAGG - Exonic
1062403703 9:136383539-136383561 CAGCAGCAGCAGCAGCAGCGAGG - Exonic
1203665418 Un_KI270754v1:18134-18156 CGGCGGCAGCAGGAGCATCGCGG - Intergenic
1203666565 Un_KI270754v1:23770-23792 CGGCGGCAGCAGGAGCATCGCGG - Intergenic
1203667714 Un_KI270754v1:29409-29431 CGGCGGCAGCAGGAGCATCGCGG - Intergenic
1203668859 Un_KI270754v1:35051-35073 CGGCGGCAGCAGGAGCATCGCGG - Intergenic
1203669706 Un_KI270754v1:39274-39296 CGGCGGCAGCAGGAGCATCGCGG - Intergenic
1186470343 X:9816579-9816601 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1186880084 X:13856382-13856404 CAGCAGCAGCAGCAGCATCTGGG + Intronic
1187263077 X:17705048-17705070 TGGCGTCAGCAGCAGAAGAGTGG + Intronic
1187274851 X:17808232-17808254 CAGCAGCAGCAGCAGCACCCAGG + Intronic
1187455864 X:19440693-19440715 AGGCAGCAGGAGCTGAAGAGTGG + Intronic
1188090018 X:25952914-25952936 GGGGGGCAGCAGCAGTAGAGGGG + Intergenic
1188437121 X:30173694-30173716 CAGCAGCAGCAGCAGCACTTGGG + Intergenic
1188707882 X:33357715-33357737 CAGCAGCAGCAGTAGCAGTATGG - Intergenic
1188833923 X:34933242-34933264 TGCCAGCAGCAGCAGCAGTGTGG - Intergenic
1189104316 X:38220748-38220770 CGGCAGCAGCAGCAGCAGCGCGG + Exonic
1189211929 X:39290980-39291002 CAGCAGCATCAGCAGCAGCTGGG - Intergenic
1189247537 X:39575389-39575411 AGGCAGAGGCAGCAGCAGTGAGG - Intergenic
1189899434 X:45690626-45690648 AGGCTGGAGCTGCAGCAGAGAGG - Intergenic
1189992818 X:46610626-46610648 CAGCAGCAGCAGCAGGACCGAGG + Intronic
1190106811 X:47566969-47566991 CGGCAGCTGCAGTTGCAGAGAGG - Exonic
1190237924 X:48631671-48631693 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1190459504 X:50658259-50658281 CACCAGCACCAGCAGAAGAGTGG - Intronic
1190459643 X:50659481-50659503 CGCTAGCATCAGCAGAAGAGTGG + Intronic
1190892902 X:54586652-54586674 AGGCAGCAGCAGCTGCACTGTGG - Intergenic
1191128186 X:56980618-56980640 GGGCAGCAGCAGTAGCAGCGTGG + Intronic
1191642436 X:63441868-63441890 TAGCAGCAGCTGCAGCAGTGTGG - Intergenic
1191743699 X:64463701-64463723 CTGCAGAGGCAGTAGCAGAGAGG + Intergenic
1192034126 X:67545301-67545323 CTGCTGCAGCAGCAGCAAACTGG - Exonic
1192034132 X:67545399-67545421 AGGCAGCAGCAGCAGCAGCAGGG + Exonic
1192180383 X:68912361-68912383 AGGCAGCAGGAGGAGCCGAGGGG - Intergenic
1192432843 X:71124364-71124386 AGGCAGCAGCAGCAGCAAGCTGG + Exonic
1192436014 X:71144405-71144427 CCCCAGCAGAAGCAGCAGAAGGG + Intergenic
1192982945 X:76366753-76366775 TGCCAGCAGCAGCAACAGTGAGG + Intergenic
1194085683 X:89524957-89524979 TGCCAGCAGCTGCAGCAGTGTGG + Intergenic
1194141682 X:90217256-90217278 GGAGAGCAGCTGCAGCAGAGAGG + Intergenic
1194265177 X:91744228-91744250 TGGCAGCAGCAGCAGCTGCATGG - Intergenic
1194425393 X:93731340-93731362 CAGCAGCAGCAGCAGCACCCTGG - Intergenic
1195671145 X:107471066-107471088 TGGCAGCAGAAGCAGTAGAGGGG + Intergenic
1195687988 X:107602686-107602708 CTGCAGCAGCAGCAGCCCTGAGG + Exonic
1195966459 X:110434204-110434226 TGGCAGCAGCAGGAGGGGAGTGG + Intronic
1196047370 X:111270388-111270410 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1196723316 X:118875001-118875023 CGCAAGCAGCAGCAGAAGTGAGG + Intergenic
1197104996 X:122703134-122703156 TAGCAGCAGCAGCAGCAGGCAGG + Intergenic
1197141558 X:123122464-123122486 CAGCAGCAGCAGCAGCTTGGTGG - Intergenic
1197141559 X:123122467-123122489 TGTCAGCAGCAGCAGCAGCTTGG - Intergenic
1197812238 X:130455524-130455546 TGGCAGGAGCAGGAGCAAAGGGG - Intergenic
1198451161 X:136767918-136767940 CGGCAGCAGCATGCGCAGTGTGG - Intronic
1199707096 X:150437205-150437227 TGCCAGCAGCAGTAGCAGAACGG + Intronic
1200056695 X:153465339-153465361 TGGCTGCAGCAGAGGCAGAGAGG + Intronic
1200110073 X:153736541-153736563 CTGCAGCAGCAGCAGGGGCGGGG - Intronic
1200118860 X:153781128-153781150 CGGCGGCAGTAGCAGCAGGTAGG + Exonic
1200438329 Y:3180840-3180862 TGCCAGCAGCTGCAGCAGTGTGG + Intergenic
1200487434 Y:3786358-3786380 GGAGAGCAGCTGCAGCAGAGAGG + Intergenic
1200582329 Y:4964674-4964696 TGGCAGCAGCAGCAGCTGCATGG - Intergenic
1201142969 Y:11043706-11043728 CGGCAGCAGCAGTAGCACCTTGG - Intergenic
1201300196 Y:12498566-12498588 CAGCAGCAGGAGCGGCAGGGAGG - Intergenic