ID: 1121265629

View in Genome Browser
Species Human (GRCh38)
Location 14:92600644-92600666
Sequence GTGTGCTGCCTGGCACACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 10, 3: 47, 4: 344}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121265629_1121265633 -4 Left 1121265629 14:92600644-92600666 CCACTGTGTGCCAGGCAGCACAC 0: 1
1: 0
2: 10
3: 47
4: 344
Right 1121265633 14:92600663-92600685 ACACTAGGTGTTGGCGTCCATGG 0: 1
1: 0
2: 1
3: 7
4: 94
1121265629_1121265639 27 Left 1121265629 14:92600644-92600666 CCACTGTGTGCCAGGCAGCACAC 0: 1
1: 0
2: 10
3: 47
4: 344
Right 1121265639 14:92600694-92600716 GGCTCCTGCCGGTTCACTCAAGG 0: 1
1: 0
2: 0
3: 11
4: 77
1121265629_1121265634 5 Left 1121265629 14:92600644-92600666 CCACTGTGTGCCAGGCAGCACAC 0: 1
1: 0
2: 10
3: 47
4: 344
Right 1121265634 14:92600672-92600694 GTTGGCGTCCATGGCACTCCTGG 0: 1
1: 0
2: 0
3: 5
4: 87
1121265629_1121265637 16 Left 1121265629 14:92600644-92600666 CCACTGTGTGCCAGGCAGCACAC 0: 1
1: 0
2: 10
3: 47
4: 344
Right 1121265637 14:92600683-92600705 TGGCACTCCTGGGCTCCTGCCGG 0: 1
1: 0
2: 5
3: 42
4: 335
1121265629_1121265635 6 Left 1121265629 14:92600644-92600666 CCACTGTGTGCCAGGCAGCACAC 0: 1
1: 0
2: 10
3: 47
4: 344
Right 1121265635 14:92600673-92600695 TTGGCGTCCATGGCACTCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121265629 Original CRISPR GTGTGCTGCCTGGCACACAG TGG (reversed) Intronic
900109828 1:1000668-1000690 GTGTGCGGCCTGGAGCACGGAGG + Intergenic
900387203 1:2416151-2416173 GGTTGCTGCCTGGCACCCAGCGG + Intergenic
900678565 1:3903589-3903611 GCATGGTGCCTGGCACACTGTGG + Intergenic
900731823 1:4267145-4267167 GTGGGCTGCCAGGCAGTCAGTGG + Intergenic
901144763 1:7057415-7057437 GCCTGCTGCCTGCCACACGGAGG - Intronic
901598862 1:10406849-10406871 GTGTGCTGCCAGGCACAGAATGG - Intronic
902027361 1:13394110-13394132 GAGAGCTTCCTGGCCCACAGGGG - Intergenic
902244420 1:15110930-15110952 GTTTGCTCTCTGGCACAGAGGGG - Intronic
902435741 1:16397263-16397285 GGGTGGTGACAGGCACACAGCGG - Exonic
902551225 1:17220787-17220809 GTGCAGTGCCTGGCACAGAGAGG + Intronic
904376163 1:30083813-30083835 ATGTGGAGCCTGGCACACGGAGG - Intergenic
905289774 1:36913265-36913287 GTGGGCAGGCTGGCACAGAGGGG - Intronic
906484705 1:46225176-46225198 GTATGGTGCCAGGCACACACTGG + Intergenic
906581748 1:46940838-46940860 CTGTGCTCCCTGGCAAACACAGG + Intronic
906954063 1:50358105-50358127 GTGTTCTCCCTGGCATACTGGGG + Intergenic
907441314 1:54480373-54480395 GTCAGGTTCCTGGCACACAGTGG - Intergenic
907474386 1:54695737-54695759 GTCTCGTGCCTGACACACAGAGG - Intronic
907525004 1:55048936-55048958 ATATGGTGCCTGGCGCACAGTGG - Intronic
908329804 1:63060044-63060066 TTCTGGTGCCTGGCACATAGTGG - Intergenic
908429196 1:64039291-64039313 GAATGCTGACTGGCACACAAAGG + Intronic
909726540 1:78842874-78842896 CTTTTCTGCCTGGAACACAGAGG + Intergenic
910424959 1:87112463-87112485 GTGCAGTGCCTGGCAAACAGTGG - Intronic
913057959 1:115179450-115179472 GCTTGCTGCCTTGCCCACAGAGG - Intergenic
914947776 1:152081159-152081181 AGGTGCTGGCTGGCACCCAGTGG + Intergenic
915733854 1:158072362-158072384 GCCTGCTGCCTGGCACACTACGG - Intronic
916444693 1:164861513-164861535 GTCTAGTGCCTGGCACACGGTGG - Intronic
917468754 1:175307908-175307930 GTGGGCTGCCTGGGACCCAAGGG - Intergenic
917476031 1:175369833-175369855 GAATGCTGCCTGGCAGCCAGGGG + Intronic
917590941 1:176476314-176476336 GAGTAATGTCTGGCACACAGAGG + Intronic
918043371 1:180926685-180926707 GTGTGCGGGCTGGCAGCCAGAGG + Intronic
918047107 1:180948144-180948166 GGGCGCTGGATGGCACACAGGGG + Exonic
919149315 1:193675098-193675120 CTGTGCTCTCTGGCACACTGTGG - Intergenic
919544019 1:198890192-198890214 GTTTGCTGTCTGGCCCAAAGTGG + Intergenic
919747108 1:201015693-201015715 CTAGTCTGCCTGGCACACAGGGG + Intronic
919753346 1:201052024-201052046 GTGAGCTTCCTGGCCCACAGTGG - Intronic
919905649 1:202076626-202076648 GAATGGTGCCTGGCACAAAGTGG - Intergenic
920432625 1:205928443-205928465 GCATGGTGCCTGGCACAGAGTGG + Intronic
921500367 1:215895069-215895091 GTGTGCTCCTTGCCAGACAGAGG + Intronic
922581048 1:226698197-226698219 GCCTACTGCCTGGCACAGAGTGG + Intronic
1063550837 10:7031187-7031209 GTATGCTGCCTGCTAGACAGTGG + Intergenic
1063892486 10:10644763-10644785 CTGGGCTTCCTTGCACACAGCGG + Intergenic
1064703351 10:18045247-18045269 GTGTGCTGCCTTGGACCCTGGGG + Intergenic
1066540987 10:36446800-36446822 ATGTGCTGCTTTGCACACATTGG - Intergenic
1067105800 10:43365447-43365469 GTATCTTACCTGGCACACAGTGG + Intergenic
1067426985 10:46217843-46217865 GTGTCCTGCCTTGTCCACAGGGG + Intergenic
1067694784 10:48527008-48527030 GTGAGTTGCCTGGCACATGGTGG - Intronic
1067764503 10:49075011-49075033 ATGAGGTGCCTGGCCCACAGCGG + Intronic
1067835251 10:49634323-49634345 GGCTGGCGCCTGGCACACAGAGG + Intronic
1069294899 10:66831321-66831343 GAGTGAAGCCTGGCACACAAGGG - Intronic
1069682400 10:70294624-70294646 GAGTGATGCCTGGCTCATAGTGG - Intergenic
1070744801 10:78927317-78927339 GTGCAGTGCATGGCACACAGAGG + Intergenic
1072122412 10:92415902-92415924 CTGTGCTGCCATGCACAGAGAGG - Intergenic
1072548876 10:96461794-96461816 GGATGGTGCCTGGCACAGAGAGG - Intronic
1073442300 10:103559351-103559373 GCCTGGCGCCTGGCACACAGTGG + Intronic
1073447905 10:103592081-103592103 ATGCCCTGCCTGCCACACAGAGG - Exonic
1074491771 10:113945079-113945101 GTGTGCGGCCTTGGGCACAGTGG - Intergenic
1074544124 10:114389171-114389193 GTGTCCTGCCTGGGCCCCAGAGG - Intronic
1074937949 10:118204743-118204765 GTGTGGTGCCTCCCACACACTGG + Intergenic
1074960007 10:118435780-118435802 GAGTACTGCCTGGCACATAGGGG - Intergenic
1075699331 10:124458880-124458902 GTATGCTTCCTGGCACACTATGG + Intergenic
1076381399 10:130026816-130026838 CTGTGCTCCCTGGAACACCGTGG - Intergenic
1078935498 11:15945841-15945863 CATTGCTGCCTGGCACACAGTGG - Intergenic
1078982678 11:16554441-16554463 GTGTTGTGCCTGGCACATGGTGG - Intronic
1080788584 11:35499039-35499061 CAGGGCTGGCTGGCACACAGAGG + Intronic
1080849799 11:36058253-36058275 GTGTTGTGCCTGGAAGACAGAGG - Intronic
1081851024 11:46275419-46275441 GTGTAGAGCCGGGCACACAGAGG - Intergenic
1081999885 11:47388459-47388481 TTGGGCTGCCTGGCATGCAGAGG - Intergenic
1082774044 11:57232352-57232374 GTGAGATGCCTGGCACACAGTGG - Intergenic
1083334285 11:61913733-61913755 GTGGGGTGCCTGGCACATAATGG - Intronic
1084622750 11:70284623-70284645 GTGGGCTGCCAGGCACACTGTGG + Intronic
1085062962 11:73465050-73465072 GTGTCGTGCCTGGCTCATAGTGG - Intronic
1085936676 11:81153983-81154005 AAGTGTTGCTTGGCACACAGAGG + Intergenic
1086811245 11:91312879-91312901 ATATGATGTCTGGCACACAGTGG - Intergenic
1088001227 11:104883496-104883518 TTGCACTGCCTGCCACACAGTGG - Intergenic
1088439781 11:109857017-109857039 GTGTGCTGACTTGCTCAGAGAGG - Intergenic
1088628086 11:111747270-111747292 CACTGCTGCCTGGCACACAAGGG + Intronic
1089321719 11:117630993-117631015 GAATGTTGCCTGGCACATAGTGG + Intronic
1089735555 11:120548164-120548186 TTGTGCTGCCTGGCACCCAGGGG + Intronic
1090733610 11:129592359-129592381 GTATGGTGCCTTGCACACACTGG - Intergenic
1091341217 11:134815535-134815557 GTGTGGTGGCTGACACTCAGTGG + Intergenic
1091386539 12:99542-99564 GTAGGGTGCCTGGCACACAGTGG + Intronic
1091456789 12:613993-614015 GTGTGGGGCCTGGCACATGGTGG - Intronic
1092049370 12:5456886-5456908 GTGTGCTGAGTGGCCCATAGGGG + Intronic
1092913860 12:13172096-13172118 CTGTGTTGCCTGGCAACCAGAGG - Intergenic
1096528830 12:52230986-52231008 GTGTGCCACCTGGCACAGAGTGG + Intergenic
1096795877 12:54077295-54077317 GTCTGCTGTCTGGCACAGAATGG - Intergenic
1098100051 12:67005661-67005683 GTGCAGTGCCTGGCACTCAGTGG - Intergenic
1098137152 12:67414797-67414819 TTGTGATGCCTGGCACAGTGGGG - Intergenic
1098872599 12:75833825-75833847 GCATGGTGCCTGGCACAGAGTGG - Intergenic
1099304416 12:80937088-80937110 CTGGGCTGCCGGGCGCACAGTGG - Intronic
1100760837 12:97805021-97805043 GTATAATGCCTGGCACATAGTGG + Intergenic
1101377765 12:104185501-104185523 CTGTGATGCCTGAAACACAGAGG + Intergenic
1101583054 12:106060992-106061014 ACGTGGTGCCTGGCACATAGTGG - Intergenic
1101871110 12:108566251-108566273 CTGAGCTTCCTGGCCCACAGGGG - Intronic
1101993636 12:109508411-109508433 GTGCAGTGCCTGGCACAGAGTGG + Intronic
1102735685 12:115157293-115157315 ATGTGGTGCCTGGCACATACAGG - Intergenic
1103033850 12:117640603-117640625 CTGTACTGCCTGCCACACTGTGG - Intronic
1103955643 12:124575245-124575267 GTGTGGTGCCTCGCACACAGTGG - Intergenic
1104963081 12:132497488-132497510 GGGGGCAGCCTGGGACACAGGGG - Intronic
1105003660 12:132707649-132707671 GAGTGCTGTCAGGCACACAGGGG + Intergenic
1105069802 12:133227556-133227578 TCCTGGTGCCTGGCACACAGTGG + Intronic
1106476039 13:30098982-30099004 CAGTAGTGCCTGGCACACAGTGG - Intergenic
1106646374 13:31638622-31638644 GTGTGCTTCCTGGCTCCCTGAGG + Intergenic
1107559333 13:41545975-41545997 GTGTGGAGCCTGGCGAACAGAGG - Intergenic
1107739905 13:43438675-43438697 GTTGTATGCCTGGCACACAGTGG + Intronic
1108203244 13:48062442-48062464 GAGAAGTGCCTGGCACACAGAGG + Intronic
1108410451 13:50141185-50141207 TTGTGGTGCCTGAGACACAGCGG + Intronic
1110614038 13:77521417-77521439 GTGAGCTGCCTGTCACCCTGGGG - Intergenic
1110626976 13:77662977-77662999 AGGTGCTGGCTGGCACCCAGTGG + Intergenic
1111759548 13:92444371-92444393 GTATAATTCCTGGCACACAGAGG - Intronic
1112189746 13:97164412-97164434 GTGCAATGCCTGGTACACAGAGG + Intergenic
1113796647 13:113062027-113062049 GTGTTCTGCATGGCACCCATGGG + Intronic
1114183107 14:20381734-20381756 GTGAGCTTCCTGGCACACAGTGG + Intronic
1116949621 14:50867349-50867371 GAGTGCAGCCTGGGACACAAAGG + Intronic
1117264718 14:54075184-54075206 GTCTGCTGCCAGACACACTGGGG + Intergenic
1117430871 14:55659387-55659409 GTGTGCTTCCATGCACATAGTGG + Intronic
1118298423 14:64591805-64591827 ATGTGGTGCCTAGCACAGAGTGG - Intergenic
1119776767 14:77253878-77253900 GGGTGCTGTCTCTCACACAGTGG + Intronic
1120819120 14:88895604-88895626 GTCTAGTGCCTGCCACACAGTGG - Intergenic
1121265629 14:92600644-92600666 GTGTGCTGCCTGGCACACAGTGG - Intronic
1121797816 14:96750112-96750134 ACGTGGTGCCTGGCACACAAGGG - Intergenic
1121999556 14:98635682-98635704 GTGATCTGCCTGGCTCTCAGTGG - Intergenic
1202920779 14_KI270723v1_random:29045-29067 CTGAGCTGCCTAACACACAGTGG - Intergenic
1202924137 14_KI270724v1_random:8536-8558 CTGAGCTGCCTAACACACAGTGG + Intergenic
1124086226 15:26552797-26552819 ATGAGCTGCCTGGCTCACACTGG + Intronic
1124140017 15:27068934-27068956 GTGTGCTTGCTGGGAAACAGTGG - Intronic
1125608931 15:40957999-40958021 GAATGGTGCATGGCACACAGTGG - Intergenic
1125745245 15:41993178-41993200 CTGTTATGCCTGGCACACAGTGG - Intronic
1127359555 15:58232804-58232826 GAGTAGTGCCTGGCACATAGTGG - Intronic
1128684012 15:69670627-69670649 GTGTGAAGCCTGGCACATAGTGG + Intergenic
1128699920 15:69796690-69796712 ATCTGCTGCCGGGCACGCAGTGG - Intergenic
1128702449 15:69814122-69814144 ATCTGGTGCCGGGCACACAGCGG - Intergenic
1129143834 15:73629741-73629763 GTGTGGTACCCGGCACACAGTGG - Intronic
1129329321 15:74818914-74818936 GTGAGGTCCCTGGCACACACGGG + Intronic
1129714386 15:77838464-77838486 GTATGGTGACTGGCACACAATGG - Intergenic
1130349226 15:83075821-83075843 GTGTGATTCCTGTCACACAAGGG + Intergenic
1130578974 15:85117936-85117958 GTGTGCAGCCTGGCACAGGAAGG + Intronic
1130986027 15:88845364-88845386 GCAAGGTGCCTGGCACACAGTGG + Intronic
1131440010 15:92452649-92452671 GTCTGCTGCCTGCCTCACAAAGG - Intronic
1132011337 15:98279270-98279292 GTGATCTGACTGGCACACAAAGG - Intergenic
1132662725 16:1068826-1068848 GAGAGCTGCCTGGCACACCCCGG + Intergenic
1132875199 16:2134045-2134067 GTGACCGGCCTGGCAGACAGAGG + Intronic
1133139834 16:3735621-3735643 CTGCACTGCCTGGCACTCAGGGG + Intronic
1133566248 16:6996835-6996857 GTTTGCTGAATGGGACACAGAGG + Intronic
1134518016 16:14902717-14902739 GGGTGCTGCTTGGCATACTGGGG + Intronic
1134519788 16:14913345-14913367 GTGACCGGCCTGGCAGACAGAGG - Intronic
1134554143 16:15152890-15152912 GTGACCGGCCTGGCAGACAGAGG + Intergenic
1134677227 16:16099205-16099227 ATGAAGTGCCTGGCACACAGTGG + Intronic
1134705687 16:16301372-16301394 GGGTGCTGCTTGGCATACTGGGG + Intergenic
1134707460 16:16312001-16312023 GTGACCGGCCTGGCAGACAGAGG - Intergenic
1134960083 16:18400124-18400146 GTGACCGGCCTGGCAGACAGAGG + Intergenic
1134961854 16:18410742-18410764 GGGTGCTGCTTGGCATACTGGGG - Intergenic
1134966152 16:18493341-18493363 GGGTGCTGCTTGGCATACTGGGG - Intronic
1135343127 16:21665613-21665635 GTGTGATGCCCGGCTCATAGAGG + Intergenic
1135725219 16:24849064-24849086 ATGTAGTGCCTGGCACATAGAGG + Intronic
1136405046 16:30040327-30040349 GCCTGGTGCCTGGCATACAGTGG - Intronic
1136656344 16:31711528-31711550 CTGAGCTGCCTGACACACGGAGG + Intergenic
1138022486 16:53497228-53497250 CTGTGGTGCCTGGCACACACGGG - Intronic
1138829634 16:60360052-60360074 AGGTGCTGGCTGGCACCCAGTGG + Intergenic
1139270493 16:65678111-65678133 CTCTGCTGCCTGGCACTCCGGGG + Intergenic
1140197378 16:72866250-72866272 GTGTGGAGCCTGGCACATAGTGG - Intronic
1140219390 16:73032965-73032987 TCCTGCTGCCTGGCACCCAGTGG - Intronic
1141031330 16:80591605-80591627 GTGTGCTTCTCTGCACACAGTGG + Intergenic
1142322621 16:89394017-89394039 GTTTGCTGACTGCAACACAGCGG + Intronic
1143309634 17:5977758-5977780 GTCTGCAGCCTGGGCCACAGAGG + Intronic
1145183605 17:20774989-20775011 GTTTGTTGTCTGGTACACAGAGG - Intergenic
1145871034 17:28273307-28273329 GTGTGATGCTGGGCATACAGTGG - Intergenic
1146528657 17:33589241-33589263 GTATGTTCCCAGGCACACAGAGG + Intronic
1146922848 17:36724980-36725002 GTTTAGTGCCTTGCACACAGTGG + Intergenic
1148208470 17:45794038-45794060 GTGTGATGCCTGGCTCACCAGGG - Intronic
1148318957 17:46732937-46732959 GGGTGCTCACTGTCACACAGAGG + Intronic
1148757940 17:49984362-49984384 GTGTGCTTCCCTGCACACTGAGG - Intergenic
1150525794 17:65920800-65920822 GTGTGGTGCCTGGGACACAGGGG - Intronic
1150574240 17:66416015-66416037 GGATACTGACTGGCACACAGTGG + Intronic
1151397526 17:73833770-73833792 ATGTGCAGCCATGCACACAGTGG + Intergenic
1151785717 17:76273962-76273984 GGGGGCTGCCTGGCCAACAGCGG + Intergenic
1152512184 17:80797984-80798006 CTTGGCTGCCTGGAACACAGGGG - Intronic
1153781741 18:8500851-8500873 GGGTGGTGCCTGGCATACAGTGG + Intergenic
1155991599 18:32284591-32284613 AGGTCCTACCTGGCACACAGTGG - Intronic
1156722237 18:40084419-40084441 GTCTGCTGCTTGGCATGCAGGGG - Intergenic
1157003813 18:43558972-43558994 GTCTGCTTCCTGGCAAACATGGG + Intergenic
1159730750 18:72024200-72024222 GTGTGCTGCCTCGGAGCCAGGGG + Intergenic
1160382436 18:78470908-78470930 GTGAGCTGCCAGTCCCACAGAGG + Intergenic
1160978431 19:1805724-1805746 GGGTGCTGCCAGGCACTGAGGGG - Intronic
1161037382 19:2092858-2092880 GTGTGCAGCCAGGCACACGCTGG + Intronic
1162018627 19:7858627-7858649 GTCTGCTGCCTGTGACACAGAGG - Intronic
1163648626 19:18504266-18504288 GTGTGCTCACTGACGCACAGAGG + Intronic
1164862244 19:31570922-31570944 ATAGGCCGCCTGGCACACAGTGG - Intergenic
1165059286 19:33197037-33197059 GTGTGGTGCCTGGCACGTGGTGG + Intronic
1165178249 19:33945929-33945951 GCATGCTGCCTGGCATACATAGG + Intergenic
1167299472 19:48670689-48670711 GTCTGCTGCCTGGGCCTCAGGGG - Exonic
1167385554 19:49160967-49160989 CTCTGCTGACTGGGACACAGTGG + Intronic
1167621515 19:50563479-50563501 GAGCGCTGCCAGGCACAGAGGGG + Intronic
925140837 2:1549078-1549100 GTGTCCTGCTGGGCACCCAGGGG + Intergenic
925444728 2:3918153-3918175 GTGTGGTGCCAGGCACATTGTGG + Intergenic
926394725 2:12428971-12428993 ATGGGCTGCCTGTCACACATTGG + Intergenic
927668901 2:25052474-25052496 GAATTCTGCCTGGCACATAGTGG - Intronic
927688566 2:25190662-25190684 CTCTCCTGCCTGGCACATAGCGG - Intergenic
927751139 2:25672374-25672396 GAATGTTGCCTGGCTCACAGCGG - Intronic
928063323 2:28136746-28136768 GTTTGCTGCCAGGCACGCTGTGG - Intronic
928276015 2:29900568-29900590 CTGTGGTGCCTTGCACAGAGTGG + Intronic
929543583 2:42841313-42841335 CTCTGCTGCCAGGCTCACAGTGG + Intergenic
930100520 2:47599610-47599632 AGGAGCTGCCTGGCACACAGCGG - Intergenic
930858169 2:56041229-56041251 GTGTGCTGCCTTTCACCAAGGGG - Intergenic
932063537 2:68529814-68529836 AGGTGCTGGCTGGCACCCAGTGG + Intronic
932199087 2:69809996-69810018 CTGTGCTTCCTGCCACCCAGGGG - Intronic
933848832 2:86349303-86349325 GAGGGCTGCCTGACTCACAGGGG + Intergenic
936617673 2:114064636-114064658 ATGTGGTGCCTGGCACATAAAGG + Intergenic
937251697 2:120527997-120528019 GTGTGGTGACTGGAACACAACGG - Intergenic
937259152 2:120574371-120574393 ATGGGCAGCCTGGCACACAGTGG - Intergenic
939708622 2:145486635-145486657 ATGTTCTGTCTGCCACACAGTGG - Intergenic
940135131 2:150426885-150426907 CTGTGGTGCCTGGCACACAGTGG + Intergenic
940778692 2:157910512-157910534 GTGGGCTGCCTGGCAGGCAGTGG + Intronic
941838740 2:170055270-170055292 GTGTGGTGCCTGGAGTACAGTGG - Intronic
942067056 2:172281310-172281332 ATATGGTGCCTGGCACACACTGG + Intergenic
942117074 2:172738481-172738503 GTGTCCTGCCTAGAACTCAGAGG + Intronic
942961115 2:181830718-181830740 CTGCTCTCCCTGGCACACAGAGG - Intergenic
943395493 2:187328374-187328396 ATGTGCTGCCTGGCAGAATGTGG + Intergenic
946326764 2:218988655-218988677 CTGTCCTGCCTGTCTCACAGGGG - Intergenic
946791982 2:223310014-223310036 GTGAGCTGCTTGGGACCCAGAGG + Intergenic
947520898 2:230845287-230845309 GTGTCCTGCCTGGCAGCCACAGG - Intergenic
948074485 2:235155389-235155411 GGGTTCGACCTGGCACACAGTGG + Intergenic
948197481 2:236106479-236106501 GTGTGGTGCCCATCACACAGAGG - Intronic
948320356 2:237063994-237064016 GACTGCTGCTTGGCAAACAGTGG + Intergenic
948718817 2:239883348-239883370 GTGTGCAGCCAGGAACAAAGAGG + Intergenic
1169350450 20:4864012-4864034 GTGTGGTGCCGGGAACCCAGGGG - Intronic
1170791478 20:19512644-19512666 ATGTGCTCCCTGGCCCTCAGTGG + Intronic
1171205153 20:23273316-23273338 ATGTCCTTCATGGCACACAGAGG - Intergenic
1172009252 20:31836900-31836922 GTGTGCTCCGTGGCCCTCAGTGG - Intergenic
1172179719 20:32994832-32994854 GTGAGCTGCCTGGGCGACAGAGG + Intronic
1172566411 20:35934216-35934238 TTGTGCTCTCTGGCACACAGAGG + Intronic
1172903128 20:38349385-38349407 TCATGCTACCTGGCACACAGAGG + Intronic
1172908277 20:38385900-38385922 GTCAGCAGCCTGCCACACAGTGG - Intergenic
1172945126 20:38681457-38681479 GTGCAGTGCCTGGCACACACAGG - Intergenic
1173010083 20:39174571-39174593 GTGTCATGCTTGGCACACAGGGG - Intergenic
1173534400 20:43798344-43798366 GTCTGGTGCCTGGCACACAGAGG + Intergenic
1173606857 20:44337668-44337690 GTGCAGTGCCTGGCGCACAGTGG - Intronic
1173815478 20:45985022-45985044 CTGTGGTGCCTGGGACAGAGGGG - Intergenic
1174361343 20:50030594-50030616 GAAGACTGCCTGGCACACAGGGG - Intergenic
1175178473 20:57128169-57128191 GTGGGCTGCCAGCCACACAGTGG + Intergenic
1175240593 20:57545367-57545389 GTGGGTTGCCAGGCAGACAGTGG + Intergenic
1175477886 20:59289656-59289678 GTGTGGTGCCTGGCACATAGTGG + Intergenic
1175648246 20:60694375-60694397 GGGTGCTGCCTGGCACAGAGTGG - Intergenic
1175722818 20:61297608-61297630 GGGCGGTGCCTGGCACACAGTGG + Intronic
1176311612 21:5153805-5153827 GTTTGGTGCTGGGCACACAGCGG + Intronic
1176375329 21:6084196-6084218 CTGTGCTGCATGGGACACTGAGG - Intergenic
1179586197 21:42375494-42375516 GGGTGCAGCCTGGCAGGCAGAGG - Intronic
1179748145 21:43454048-43454070 CTGTGCTGCATGGGACACTGAGG + Intergenic
1179845438 21:44108230-44108252 GTTTGGTGCTGGGCACACAGCGG - Intronic
1180197809 21:46208058-46208080 CTGAGCTGCCTGGCACATGGAGG - Intronic
1181825546 22:25512549-25512571 GTGTGATGCCTGGTACCTAGTGG + Intergenic
1182080254 22:27523811-27523833 AGATGCTGCCTGGCTCACAGGGG - Intergenic
1183028048 22:35081002-35081024 GTGTTGTGCCTGGCAGAAAGGGG + Intronic
1183441965 22:37828246-37828268 GTGTGCTGACTGGAGCAGAGAGG + Intergenic
1184159792 22:42691558-42691580 GGGTGCTGCCAGGAACACTGGGG - Intergenic
1184362435 22:44026409-44026431 TTGGGGTGCCTGGCAAACAGAGG + Intronic
1184647576 22:45904410-45904432 GGGCTCAGCCTGGCACACAGAGG - Intergenic
1184943439 22:47784687-47784709 GTGGGCTTCCTGGCATGCAGAGG - Intergenic
949397846 3:3634253-3634275 GTTTGGTGCCTGGCACATATAGG - Intergenic
949897630 3:8780142-8780164 GCATGATGCCTGGCACATAGTGG + Intronic
950676007 3:14554877-14554899 ATGTACTGCTTGGCACAGAGTGG + Intergenic
951140745 3:19155612-19155634 GTGTGTAGCCTGGGAGACAGTGG - Intronic
953183239 3:40615728-40615750 TTGCGCAGGCTGGCACACAGCGG - Intergenic
953604739 3:44404381-44404403 GATGGGTGCCTGGCACACAGGGG + Intronic
954702283 3:52456514-52456536 GTGGGCTGCCTGGCAAAAACCGG + Intronic
955187532 3:56729473-56729495 GTGTGCTGCCGGGCAAGCTGGGG - Exonic
955481296 3:59393245-59393267 GTACAGTGCCTGGCACACAGTGG - Intergenic
961187982 3:124932644-124932666 GGATACTGCCTGGCACATAGGGG - Intronic
961627722 3:128275293-128275315 GGGTGCTGCCTGGTCCACAAAGG + Intronic
961785667 3:129345106-129345128 GTGTGCTGCCTGGCATCCCATGG - Intergenic
963276075 3:143331259-143331281 GTGGGCTGCCTTGCCCACATGGG + Intronic
964019336 3:151989274-151989296 ATGTCCTGCATGACACACAGAGG - Intergenic
964545784 3:157831562-157831584 GTGGGATGCCTGGGGCACAGAGG - Intergenic
965512662 3:169585633-169585655 GTTTGCTGCCTGGACCGCAGAGG + Intronic
965619823 3:170632116-170632138 GTGTGGTACTTGGCACAGAGTGG + Intronic
966278358 3:178202472-178202494 GAGTCCTGCCTGGGTCACAGGGG + Intergenic
967108397 3:186272055-186272077 GCATGGTGCCTGGCACATAGTGG + Intronic
967149950 3:186639332-186639354 GTGTGCTTGCTGGTACACAGTGG - Intronic
967949554 3:194830279-194830301 GTTGCCTGCCAGGCACACAGGGG + Intergenic
968009785 3:195266623-195266645 GCATGATGCCTGGCTCACAGTGG - Intronic
968799464 4:2732726-2732748 CTGCTCTGCCTGGCACACAGAGG - Intergenic
969266718 4:6069197-6069219 CTGTCATGACTGGCACACAGTGG + Intronic
970025888 4:11623618-11623640 GCATGCTGCCTGACACACACTGG + Intergenic
970133285 4:12894389-12894411 GCATGGTGCCTGGCACAGAGCGG + Intergenic
974389341 4:61245276-61245298 GGGAGCTGCCTGGGAGACAGGGG - Intronic
975818377 4:78243448-78243470 GTGGGCTGCATGGAACACAAAGG - Intronic
976437705 4:85037245-85037267 GTGTAGTACCTGGCACATAGTGG + Intergenic
978167179 4:105623242-105623264 GTGCATTGGCTGGCACACAGAGG + Intronic
980092541 4:128457451-128457473 GTGTGCTGCCGGGATCACTGTGG + Intergenic
984712148 4:182894926-182894948 GTGTGCTGACACGCACACATGGG + Intronic
985777582 5:1852760-1852782 GTGTGGTGTGTGTCACACAGTGG - Intergenic
986102816 5:4629628-4629650 GTCTGCAACCCGGCACACAGTGG - Intergenic
988835241 5:35025668-35025690 GCTTTCTGCCTGGAACACAGAGG + Intronic
990896397 5:60704122-60704144 GTATGGTGCTTGGCACATAGTGG + Intergenic
992384364 5:76269490-76269512 GTGAGGTGCCTGGCACATGGTGG + Intronic
992668609 5:79036160-79036182 GTATACTGCATGGCACATAGTGG + Intronic
994759013 5:103830123-103830145 GTGTTCTACCTGGCACCCAGAGG - Intergenic
995767995 5:115639654-115639676 ACCTACTGCCTGGCACACAGAGG + Intergenic
996340469 5:122433208-122433230 GCGTGGTGCCTGGCACACATAGG - Intronic
996758253 5:126958722-126958744 GATTGATTCCTGGCACACAGAGG + Intronic
996823026 5:127651654-127651676 TAGTCCTGCCTGGCACATAGTGG - Intronic
997270036 5:132528639-132528661 GCATGGTGCCTGGCACATAGTGG + Intergenic
998167036 5:139849996-139850018 GTGAGGTGCCTGGAACAGAGTGG - Intronic
999670620 5:153956223-153956245 GTATGAGGCCTGCCACACAGTGG + Intergenic
999910527 5:156193479-156193501 ATGTGCTTTCTGCCACACAGAGG - Intronic
1000171675 5:158708398-158708420 GCACACTGCCTGGCACACAGTGG - Intronic
1001051582 5:168418509-168418531 GTGAGATGCCTGGCACACGCTGG - Intronic
1001117004 5:168948224-168948246 ATGCACTGCCTGGCACACAGTGG + Intronic
1001256718 5:170189125-170189147 ATGAGCTGCCGAGCACACAGGGG + Intergenic
1001543551 5:172555945-172555967 GGCTGATGCCTGGCACACAGCGG + Intergenic
1001576260 5:172765931-172765953 GTAAAGTGCCTGGCACACAGTGG - Intergenic
1002301161 5:178257838-178257860 CTCAGCTGCCTGGCCCACAGGGG - Intronic
1002308872 5:178301890-178301912 CTGTGCTGCGGCGCACACAGAGG - Intronic
1002569704 5:180133190-180133212 GTCTGCTGCCTAGCACAGGGTGG + Intronic
1002633907 5:180597853-180597875 GAGTGCTGCTGGGCACACAGAGG - Intergenic
1002790077 6:430782-430804 TCTTGGTGCCTGGCACACAGAGG + Intergenic
1002795881 6:470868-470890 GTGTGCTGCTTGACACCCAGAGG - Intergenic
1002883589 6:1274213-1274235 GTGTGCCGACGGGGACACAGAGG - Intergenic
1002948191 6:1782764-1782786 GGGTAGTGCCTGGCCCACAGTGG - Intronic
1003078961 6:3005755-3005777 GTGCGGTGGCTGGCACACAATGG - Intronic
1004127488 6:12887644-12887666 GAGTAATGCCTGGCACATAGTGG - Intronic
1005243010 6:23853839-23853861 AGGTGCTGGCTGGCACCCAGTGG - Intergenic
1005272790 6:24183974-24183996 GTGTGATGTTTGGCACAGAGCGG - Intronic
1005528941 6:26682436-26682458 GTGGGTGGCCTGGAACACAGGGG - Intergenic
1005541855 6:26819210-26819232 GTGGGTGGCCTGGAACACAGGGG + Intergenic
1006427940 6:33977786-33977808 GAGGGCTGCCTGGCACCCAGTGG + Intergenic
1006586722 6:35119827-35119849 GTGTGATGGCCTGCACACAGCGG + Intronic
1006625647 6:35395934-35395956 GAATAATGCCTGGCACACAGAGG + Intronic
1007955352 6:45913168-45913190 GTGTGATGGTGGGCACACAGTGG - Intronic
1008127161 6:47681738-47681760 GTGTGTTGGCTGGCACTCTGTGG + Exonic
1009012660 6:57861267-57861289 GTGGGTGGCCTGGAACACAGGGG + Intergenic
1011624345 6:89271179-89271201 GTGTCCTGCAAGGCTCACAGTGG - Intronic
1013640480 6:112072705-112072727 GTGTGCTGCTTGGGACAGTGTGG - Intronic
1015815319 6:137205031-137205053 CAGACCTGCCTGGCACACAGTGG - Intronic
1016980647 6:149850947-149850969 CTAAGCTGCCTGGCACTCAGTGG + Intronic
1016985961 6:149896137-149896159 GCATACTGCCCGGCACACAGAGG - Intronic
1017616174 6:156249250-156249272 GAGAGCTTCCTGGCCCACAGAGG + Intergenic
1017889558 6:158627439-158627461 GTCTGCAGCATGGCACGCAGGGG - Intronic
1018164007 6:161076811-161076833 GGTGCCTGCCTGGCACACAGTGG - Intronic
1018825191 6:167403608-167403630 GTGAGCTGCTGGGGACACAGTGG + Intergenic
1019621392 7:1994122-1994144 GTTTGCTGCCAGGATCACAGGGG + Intronic
1020098897 7:5383436-5383458 GTGGGCTGACGGGCACATAGTGG - Intronic
1025026259 7:55518679-55518701 GGATAGTGCCTGGCACACAGCGG - Intronic
1026547746 7:71338658-71338680 GAGTTCTGCCTGGAACACAGGGG - Intronic
1027014765 7:74772797-74772819 ATCTAGTGCCTGGCACACAGAGG - Intergenic
1027073266 7:75173158-75173180 ATCTAGTGCCTGGCACACAGAGG + Intergenic
1027889779 7:83957015-83957037 GCATGATGCCTGGCACAAAGAGG - Exonic
1029218707 7:98970769-98970791 GAATGCTGCCTGCCACACAGGGG + Intronic
1033343078 7:140507028-140507050 GTTAGCTGCCTGGCAGACATGGG + Intergenic
1034978451 7:155461138-155461160 GAGAGCTGCCGGGCACACTGAGG - Intronic
1036958249 8:13214602-13214624 GTGTTCTGCCAGGCACACACCGG + Intronic
1037761012 8:21741586-21741608 GCATGGTGCCTGGCACAGAGTGG + Intronic
1037853097 8:22348952-22348974 GTGTGGTGCCTTGAACTCAGTGG + Intronic
1038165727 8:25083493-25083515 GTGTGCTTCCTGGCTCCCTGAGG - Intergenic
1038963823 8:32549277-32549299 CTGCGCTGCCAGGCACACCGAGG - Intronic
1041991717 8:64000849-64000871 GTGTGCTGCCTGAGTCACACAGG - Intergenic
1042572667 8:70183856-70183878 ATTTGCTGCCTGGCACATAGTGG + Intronic
1044343843 8:91079863-91079885 GAGTAGTGCTTGGCACACAGCGG - Intronic
1044419086 8:91970846-91970868 TTGGCCTGACTGGCACACAGAGG - Exonic
1045055730 8:98366872-98366894 GCATGCTGCCTAGCATACAGTGG - Intergenic
1047695115 8:127395703-127395725 GAATGATGGCTGGCACACAGTGG - Intergenic
1049320967 8:141996139-141996161 CCGTGCTGCCTGGCACACAGTGG - Intergenic
1049446414 8:142633508-142633530 GACTGCTGCCTGTCACCCAGAGG + Intergenic
1049584361 8:143426025-143426047 TGGTGCTGCCTTGCACACAAGGG + Intronic
1049731544 8:144180952-144180974 GTCCCCTGCCAGGCACACAGAGG - Intronic
1050061971 9:1718872-1718894 GTGTGCCGGCTGGAACCCAGTGG - Intergenic
1050296455 9:4210063-4210085 GTATAATGCCTGGCACATAGTGG + Intronic
1051362218 9:16291305-16291327 GAGCGCTGTCTGGCACACAGTGG - Intergenic
1052413123 9:28147613-28147635 AGGTGCTGGCTGGCACCCAGTGG - Intronic
1053312825 9:37030135-37030157 TTCTGCTGCGTGGCACACACAGG + Intronic
1053785499 9:41649966-41649988 GTCTGCTGCCTGGCACAGAATGG - Intergenic
1053803073 9:41776130-41776152 CTGTGCTTCCTGGCAGGCAGGGG + Intergenic
1054159532 9:61664207-61664229 GTCTGCTGCCTGGCACAGAATGG + Intergenic
1054174218 9:61863918-61863940 GTCTGCTGCCTGGCACAGAATGG - Intergenic
1054449077 9:65392985-65393007 GTCTGCTGCCTGGCACAGAATGG - Intergenic
1054663319 9:67716863-67716885 GTCTGCTGCCTGGCACAGAATGG + Intergenic
1054884108 9:70177360-70177382 GTGTTCTGCTTGGGACAGAGTGG + Intronic
1055558361 9:77498593-77498615 ACATGATGCCTGGCACACAGTGG + Intronic
1056020487 9:82433481-82433503 AGGTGCTGGCTGGCACCCAGTGG + Intergenic
1056694038 9:88831243-88831265 GTATGGAGCCTGGCACACACTGG + Intergenic
1057071409 9:92103834-92103856 AGGTGCTGGCTGGCACCCAGTGG - Intronic
1057196820 9:93120080-93120102 GTGTGAGGCCAGGCACACAGGGG + Intergenic
1057455384 9:95204421-95204443 GTGGGCTGCCTGAGACCCAGTGG - Intronic
1057910371 9:99015581-99015603 GTGTCCTCTCTGGCTCACAGGGG + Intronic
1059353680 9:113683872-113683894 CTGTGCTCCCTGGCTCACTGAGG - Intergenic
1060278170 9:122197947-122197969 GCTTGCTGCCTGGCACACTCTGG - Intronic
1060901607 9:127262793-127262815 GCCTACTGCCTGGCACATAGTGG - Intronic
1061632572 9:131882486-131882508 CTGTGCTTCCTGGCACACTGTGG + Intronic
1061934785 9:133851340-133851362 GTATAGTGCCTGGCACACAGTGG - Intronic
1186191700 X:7073104-7073126 GCACCCTGCCTGGCACACAGTGG + Intronic
1188776633 X:34227955-34227977 ATGTGCTGACTGTGACACAGCGG + Intergenic
1189222109 X:39381404-39381426 GTACAGTGCCTGGCACACAGTGG - Intergenic
1190067029 X:47248493-47248515 GAATCGTGCCTGGCACACAGAGG - Intergenic
1190102580 X:47533452-47533474 GGTGGCTGCCTGGCAGACAGCGG + Intergenic
1190727556 X:53199565-53199587 GCGTGGTGCCTGGAACACAGTGG - Intronic
1196351158 X:114731924-114731946 GTGTACTGCCCAGAACACAGGGG - Intronic
1198034007 X:132783248-132783270 GCCTGGTGCTTGGCACACAGTGG + Intronic
1198405115 X:136304684-136304706 GCATGCTGCCTGGCACATAGAGG - Intronic
1199032556 X:143017364-143017386 GTGTTGTGGCTGGCACCCAGTGG + Intergenic
1199779768 X:151047499-151047521 ATGTGTTGGCTGGCACACAAGGG + Intergenic
1200205252 X:154310948-154310970 GTGAACCGCCTGGGACACAGTGG + Exonic
1200226194 X:154419235-154419257 TGATGCTGCCTGGCACATAGGGG + Intronic