ID: 1121272071

View in Genome Browser
Species Human (GRCh38)
Location 14:92644439-92644461
Sequence GGAAGAACTGCATTCCTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 508
Summary {0: 1, 1: 0, 2: 9, 3: 86, 4: 412}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121272066_1121272071 23 Left 1121272066 14:92644393-92644415 CCTAGGAACATGCTTTTTTTTTT 0: 1
1: 6
2: 38
3: 329
4: 2492
Right 1121272071 14:92644439-92644461 GGAAGAACTGCATTCCTTTCTGG 0: 1
1: 0
2: 9
3: 86
4: 412
1121272065_1121272071 30 Left 1121272065 14:92644386-92644408 CCTAAGACCTAGGAACATGCTTT 0: 1
1: 0
2: 1
3: 14
4: 179
Right 1121272071 14:92644439-92644461 GGAAGAACTGCATTCCTTTCTGG 0: 1
1: 0
2: 9
3: 86
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121272071 Original CRISPR GGAAGAACTGCATTCCTTTC TGG Intronic
900611168 1:3545203-3545225 GGAAGAAGTGCACCCCTCTCGGG - Intronic
900715677 1:4141954-4141976 CGCAGAGCTGCCTTCCTTTCTGG - Intergenic
900815063 1:4837368-4837390 GGTTGTGCTGCATTCCTTTCTGG - Intergenic
901499028 1:9640156-9640178 GGAAGCACTTCTTTTCTTTCTGG + Intergenic
902098677 1:13967311-13967333 GGAAGACTTGCATTCCTTGCAGG - Intergenic
902540959 1:17154408-17154430 GGCAGGGCTGCATTCCTTTCAGG + Intergenic
902750560 1:18506631-18506653 GGCAGGACTGCTTTCTTTTCTGG + Intergenic
902752990 1:18530295-18530317 GGAACAACTGTTTCCCTTTCAGG + Intergenic
903227627 1:21902700-21902722 GGAAAAGCTGCATTCCATCCAGG + Intronic
903780844 1:25819301-25819323 GGAAGAGCCACATTCCTTCCAGG - Intronic
905331831 1:37208506-37208528 TGAGGAACTGCGTTCCTTTGGGG - Intergenic
905839555 1:41163043-41163065 GGAAGAGCTGCAGCCCTTTGGGG + Intronic
907380025 1:54079459-54079481 GATAGGACTGCATTCCTTTCTGG + Intronic
907486079 1:54779208-54779230 GGGAGAAATGCATGCCTTTAGGG + Intergenic
908334171 1:63103481-63103503 GAAAGAAGTGCACTCCTTTAGGG - Intergenic
909868990 1:80714776-80714798 GACAGGACTGAATTCCTTTCTGG + Intergenic
910004821 1:82383535-82383557 GGTAGGACTGCATTCCTTCTAGG + Intergenic
910113030 1:83702152-83702174 GGCAGGGCTGCATTCCCTTCTGG + Intergenic
910332071 1:86085161-86085183 TGAAGAACTGCATACTTTTGGGG + Intronic
910576287 1:88768321-88768343 GGCAGGACTGCATTCCCTTCTGG + Intronic
911372274 1:97008138-97008160 GGGAGCACTACATTCCTTTTGGG - Intergenic
911385295 1:97167606-97167628 GAAAGAAATGCATTTTTTTCAGG + Intronic
911422783 1:97665573-97665595 GGTAGAAATGCATTCTTTTGTGG - Intronic
912029201 1:105218264-105218286 GGATGAACTGGAGTCTTTTCAGG + Intergenic
912718766 1:112002392-112002414 TGAAGATCTGCATTGCTCTCAGG - Intergenic
914331287 1:146673106-146673128 AGCCGAGCTGCATTCCTTTCGGG + Intergenic
914349503 1:146828046-146828068 GGAAGGGCTGTATTCTTTTCTGG + Intergenic
914394032 1:147247735-147247757 AGCAGAGCTGCATTCCTTTCTGG + Intronic
915609773 1:156982312-156982334 GGAAGCACTGAATTGCTTTCTGG - Intronic
916168333 1:161982603-161982625 GGAAGAACTGCAGCCCCTCCCGG - Intergenic
916235726 1:162585992-162586014 TTAAGAACTGTGTTCCTTTCAGG + Intronic
916373302 1:164123689-164123711 AGAAGAAATGCATACATTTCTGG - Intergenic
916826580 1:168447741-168447763 GGTAGGGCTGCATTTCTTTCTGG + Intergenic
916874371 1:168953300-168953322 GTAAGGACTTCATTCTTTTCTGG + Intergenic
918548143 1:185708480-185708502 TGAGGAACTGCGTTCCTTTGGGG - Intergenic
920447842 1:206033389-206033411 TGGTGAACTGCATTCCTTTCTGG + Intergenic
921493451 1:215807220-215807242 ACAAGAGCTGCATTCCCTTCTGG - Intronic
922403095 1:225281184-225281206 GGTATGACTGCATTACTTTCTGG + Intronic
922856002 1:228775141-228775163 AGCAGGACTGCATTCCTTTCTGG + Intergenic
922958848 1:229627167-229627189 GAAATAACTGTATTCCTTTGGGG + Intronic
923105968 1:230854190-230854212 GGAAAATCTGCACTGCTTTCTGG + Intronic
923344004 1:233033801-233033823 GGGAGAACTGGATACCTTTCAGG + Intronic
923452814 1:234135761-234135783 TGAACACCTGCTTTCCTTTCAGG - Intronic
923812744 1:237337958-237337980 GGCAGCACTGCATTGCTTCCAGG + Intronic
923914833 1:238490856-238490878 ATAAGAACTGCATTCATTTAAGG + Intergenic
924614276 1:245599840-245599862 GGTATATCTGCATTCCATTCTGG - Intronic
1063290590 10:4742945-4742967 GGAAGAACTGCTTTATTTCCAGG - Intergenic
1063782906 10:9347361-9347383 TGAAGAACTTCATTTCTTGCAGG + Intergenic
1064761371 10:18624916-18624938 GGAGCACCTGCTTTCCTTTCGGG + Intronic
1064762420 10:18635043-18635065 GGAACACCTGCTTTCCTTTTGGG + Intronic
1065928674 10:30459124-30459146 GGCTGAACTGCATTCGTTGCAGG + Intronic
1066120817 10:32285337-32285359 GCAAAAACTTCATTCCTTTTGGG + Intronic
1067128203 10:43538387-43538409 GGAAGGAATGCCTTCCTTGCGGG + Intergenic
1067361547 10:45585006-45585028 AGTAGGACTGCATTCTTTTCTGG - Intronic
1067522827 10:47021062-47021084 GGTAGGACTGCATTCTTTTCTGG + Intergenic
1067564522 10:47327001-47327023 GGAAGAGCTGCAGTCCTTATCGG + Intergenic
1068554208 10:58439966-58439988 GGCACAGCTGCATTCCTTTCTGG + Intergenic
1072364656 10:94696581-94696603 TGAGGAGCTGCATTCCTTTGGGG - Intronic
1072568095 10:96634837-96634859 GTCAGGGCTGCATTCCTTTCTGG + Intronic
1073726966 10:106243915-106243937 GGTAGAACTGTGTTCCTTTGTGG - Intergenic
1073754556 10:106567106-106567128 GGAAGAACTGAATCTTTTTCTGG + Intergenic
1075210273 10:120485072-120485094 AGCAAAGCTGCATTCCTTTCTGG - Intronic
1077245045 11:1532706-1532728 GGAAAAGCTGCATACCTTTGTGG + Intergenic
1077671516 11:4161933-4161955 GCAGGATTTGCATTCCTTTCTGG - Intergenic
1078508894 11:11970810-11970832 GGCAGGGCTGCATTCCTCTCTGG - Intronic
1079429372 11:20374424-20374446 GACAGAGCTGCATTCCTTTCTGG + Intronic
1079531454 11:21459494-21459516 GGAGGAACTGCAGTACTTGCTGG + Intronic
1079986588 11:27206551-27206573 GGCAGGACTGAATTCCTTTCTGG - Intergenic
1080291061 11:30671795-30671817 GGCAGAATTACATTCCTTTCTGG - Intergenic
1080353846 11:31418198-31418220 TGAAAAACTACATGCCTTTCAGG - Intronic
1080728295 11:34918766-34918788 GTAGGAGCTGCATTCTTTTCTGG + Intronic
1081140563 11:39493834-39493856 AGAAGAATTGCATTCCTTGGGGG + Intergenic
1081188314 11:40072483-40072505 GGCAGAGCTGCTTTGCTTTCTGG - Intergenic
1081272939 11:41109156-41109178 GGAAGAACTTTATTTTTTTCTGG - Intronic
1081283941 11:41245626-41245648 AGAAGAGCTGCAGCCCTTTCAGG - Intronic
1081375405 11:42352328-42352350 AGCAGGGCTGCATTCCTTTCTGG - Intergenic
1081759009 11:45564074-45564096 GGCCGGATTGCATTCCTTTCTGG + Intergenic
1082858925 11:57835086-57835108 GGAACAACTGCCTTCCTGTAGGG + Intergenic
1083142876 11:60736111-60736133 GGAAGAAGTGAGTTCCTTTGAGG + Intronic
1083596614 11:63920754-63920776 GGAGGAACCGAATTCCTGTCTGG - Intergenic
1084905997 11:72348012-72348034 GACAGAACTGTCTTCCTTTCTGG - Intronic
1085167429 11:74415841-74415863 GGAAGTAGTGCATTCCTCTATGG - Intergenic
1085719016 11:78897059-78897081 TGAATAACTGCTTTCCTTTGGGG + Intronic
1085884344 11:80505183-80505205 AGCAGGACTGCATTCCTTTCTGG - Intergenic
1086055183 11:82638389-82638411 AGAAGGTCTGCATTTCTTTCTGG + Intergenic
1087347485 11:96990246-96990268 GCATTAACTGCAGTCCTTTCAGG - Intergenic
1087893499 11:103562007-103562029 GGTAGCACTGCATTCCCTTTTGG + Intergenic
1089074503 11:115727463-115727485 GGATGTACTGCATCCCCTTCAGG + Intergenic
1089625263 11:119747120-119747142 GGAAGGGCTGTGTTCCTTTCAGG + Intergenic
1089915529 11:122152064-122152086 TGAAGAACCTCATTCATTTCAGG + Intergenic
1089934557 11:122350389-122350411 GGAAGGATGGCATTTCTTTCTGG + Intergenic
1090186491 11:124742243-124742265 GGAAGAACAGCATACCTCTTGGG + Intronic
1090278022 11:125432959-125432981 GGGAGAAATACATTCATTTCAGG - Exonic
1090979810 11:131709604-131709626 GGAAGACCAGCAGTCATTTCTGG + Intronic
1092915579 12:13186184-13186206 GGTAGAACAGCATTTCTTTAGGG + Intergenic
1094556933 12:31510270-31510292 GACAGGGCTGCATTCCTTTCTGG + Intronic
1095107192 12:38248749-38248771 GGCAGAGCTGTGTTCCTTTCTGG - Intergenic
1095168634 12:39006192-39006214 GGCAGAACTGCCTTTCTTTCTGG - Intergenic
1095445689 12:42279850-42279872 GGCAGAACTGAATTCCTTGCAGG + Intronic
1095482147 12:42647873-42647895 TCAAGTGCTGCATTCCTTTCTGG + Intergenic
1095545453 12:43362930-43362952 AGCAGGGCTGCATTCCTTTCTGG - Intronic
1095850072 12:46792856-46792878 GGAAGAACTGGATTTATTACAGG - Intronic
1096872427 12:54601743-54601765 GGCAGGGCTGCGTTCCTTTCTGG - Intergenic
1097309378 12:58101959-58101981 GGCAGGCCTGCTTTCCTTTCTGG + Intergenic
1098270006 12:68760991-68761013 GGAGCAACTGCATTTCCTTCAGG - Intronic
1098549050 12:71742776-71742798 GGAAGGGCTGCATTCCTGTCTGG + Intergenic
1099073518 12:78076468-78076490 ATAAGAACTGCATTCGATTCTGG - Intronic
1099463498 12:82953160-82953182 GGAGGAAGTGCGCTCCTTTCAGG + Intronic
1099764989 12:86971479-86971501 TGAGGAGCTGCATTCCTTTTGGG - Intergenic
1100108339 12:91205922-91205944 GGCAGGGCTGCATTCCTTTCTGG + Intergenic
1100545880 12:95601968-95601990 AAAAGAACTGCATGCCTTTTAGG + Intergenic
1100668824 12:96786757-96786779 GGAAAAAATGCACTTCTTTCTGG - Exonic
1100924196 12:99525022-99525044 GAAAGGGCTGCTTTCCTTTCTGG - Intronic
1101339207 12:103826572-103826594 TGCAGGACTGCATTTCTTTCTGG - Intronic
1103157891 12:118702479-118702501 CGCAGAGCTGCATTCCATTCTGG - Intergenic
1104282092 12:127387667-127387689 GGCAGCACTGCACTCCATTCTGG - Intergenic
1106036541 13:26050210-26050232 TGAGGAGCTGCCTTCCTTTCGGG + Intronic
1106387235 13:29299659-29299681 TGGGGAACTGCATTCCATTCAGG + Intronic
1106833123 13:33606791-33606813 GGCAGAGCTGCGCTCCTTTCTGG + Intergenic
1107702983 13:43067118-43067140 GGCAGAGCTGCATTCCATTTTGG + Intronic
1108118040 13:47151708-47151730 GGAACACCTGCTTTCCTTTTGGG + Intergenic
1108783401 13:53865401-53865423 GCAAGAACTGCATGAATTTCAGG + Intergenic
1108793152 13:53997123-53997145 AGCAGGACTGCATTTCTTTCTGG - Intergenic
1109622701 13:64929939-64929961 GGAAGAGATTCATGCCTTTCTGG + Intergenic
1109706046 13:66094275-66094297 GAAAGCAATGCATTCATTTCAGG + Intergenic
1110302138 13:73940968-73940990 AGAACAACTACATGCCTTTCTGG + Intronic
1110350206 13:74498315-74498337 GGCAGGGCTGCCTTCCTTTCTGG + Intergenic
1110534841 13:76639089-76639111 GGGAGGAAGGCATTCCTTTCTGG - Intergenic
1110729134 13:78859947-78859969 TGAGGAGCTGCATTCCTTTGGGG + Intergenic
1110912413 13:80981101-80981123 GGGAGAACTGCACTCCATCCTGG + Intergenic
1111882718 13:93978225-93978247 GGCAGAGCTGCATTCCTCTCTGG - Intronic
1112124194 13:96446820-96446842 GGGCGAACTGCTTGCCTTTCTGG - Intronic
1113057481 13:106285030-106285052 GGCAGGGCTGCATTCCTTTCTGG + Intergenic
1113320408 13:109227389-109227411 GGCAGGATTGCATTCCTTTTGGG + Intergenic
1113472434 13:110556425-110556447 TGCAGGATTGCATTCCTTTCTGG - Intronic
1114556199 14:23563777-23563799 GCAAGAGCTGCAGGCCTTTCTGG - Exonic
1114673554 14:24427487-24427509 GGAAGATCTGCACTACTTTGCGG - Exonic
1115890541 14:38022737-38022759 GGAAAAAATGCATTCTTTTCAGG - Intronic
1116424880 14:44778825-44778847 GGGAGAACTGCATTCCTCATAGG - Intergenic
1117489280 14:56229692-56229714 TGAGGAGCTGCATTCCTTTGGGG - Intronic
1119179541 14:72596159-72596181 AGGAGGGCTGCATTCCTTTCAGG + Intergenic
1119709796 14:76813250-76813272 GGAATAACTCGCTTCCTTTCTGG - Intronic
1119995457 14:79248582-79248604 GCCATAACTGCATACCTTTCTGG + Intronic
1120978744 14:90272883-90272905 GGAAGTACAGCTTTCCTTTTTGG + Exonic
1121272071 14:92644439-92644461 GGAAGAACTGCATTCCTTTCTGG + Intronic
1121436480 14:93923971-93923993 GAAAGAACTCCCTTCCCTTCTGG + Intronic
1124019374 15:25905216-25905238 GGAAGAACTGCATCTCCATCAGG - Intergenic
1124205062 15:27710943-27710965 GGCAGGGTTGCATTCCTTTCTGG - Intergenic
1124205263 15:27713108-27713130 GACAGAGCTGCCTTCCTTTCGGG - Intergenic
1125425256 15:39542395-39542417 GGTAGAGCTGCATTCCTTTCTGG + Intergenic
1126215282 15:46146885-46146907 AGAAGAACTGCAGCCCTTTGGGG + Intergenic
1126525864 15:49653401-49653423 AGCTGAACTGCATTCCTTTCTGG - Exonic
1131670868 15:94618506-94618528 GGAAGAACAGCATTCCTCCCAGG + Intergenic
1131737208 15:95346528-95346550 AGTAGAACTTTATTCCTTTCTGG - Intergenic
1132154726 15:99487292-99487314 GGATGTACTGCATTCCTGTGTGG + Intergenic
1132244462 15:100283666-100283688 GAAAGAGCTGCATTCCTAGCAGG + Intronic
1132356541 15:101174935-101174957 GGAAGTACTGCCTCCCTTCCAGG - Intergenic
1133261746 16:4555349-4555371 TGAAGAACTACATTCATTTCTGG - Intergenic
1133481250 16:6172888-6172910 GGCAGAGCTGCACTCCTTTCTGG + Intronic
1135995223 16:27242919-27242941 GGAAGAACTGCTCTGGTTTCAGG - Intronic
1136925342 16:34367177-34367199 GGAAGAAATGCATTCCTGGGGGG + Intergenic
1136979232 16:35044629-35044651 GGAAGAAATGCATTCCTGGGGGG - Intergenic
1137583298 16:49647705-49647727 GGCAGGGCCGCATTCCTTTCTGG - Intronic
1137649232 16:50105067-50105089 GGAAGAACTGGTTTCTTTTTTGG - Exonic
1137952397 16:52796119-52796141 GCAAAAGATGCATTCCTTTCTGG - Intergenic
1138234551 16:55370975-55370997 GGTAGAAAAGCATGCCTTTCCGG + Intergenic
1139353432 16:66352382-66352404 GGCAGGGCTGCATGCCTTTCAGG + Intergenic
1139984534 16:70887508-70887530 GGAAGGGCTGTATTCTTTTCTGG - Intronic
1140002269 16:71037795-71037817 AGCCGAGCTGCATTCCTTTCGGG - Intronic
1140558469 16:75948433-75948455 GGAAGAGCTGTGTTCTTTTCCGG - Intergenic
1140642340 16:76990880-76990902 GGCAGGGCTGGATTCCTTTCTGG + Intergenic
1140816989 16:78630403-78630425 GGAATACCTGCTTTCCTTTGTGG + Intronic
1141507723 16:84489822-84489844 GGAAGACTTGCCTTCCTTTTTGG - Intronic
1142833489 17:2566854-2566876 GGTAGGCCTGCATTCTTTTCTGG - Intergenic
1143365264 17:6404161-6404183 GGCAGGGCTGCATTCCTTTCTGG + Intronic
1145233638 17:21193105-21193127 GGTAAACCTGCATTCCTTTGAGG - Intronic
1146107533 17:30054145-30054167 AGAAGAACTGCATTACTACCTGG - Exonic
1146537815 17:33668344-33668366 AGAAGGGCTGCGTTCCTTTCTGG + Intronic
1147020325 17:37526578-37526600 AGAAGGACTGCATTCCTTCTAGG + Intronic
1147594479 17:41707912-41707934 GGCAGGGCTGCATTTCTTTCTGG + Intergenic
1147723515 17:42553081-42553103 GGAAGATCTGACTTCCCTTCTGG - Intronic
1148625340 17:49065086-49065108 GGTAGGACTGCATTCCTTTCTGG + Intergenic
1149337304 17:55649242-55649264 GTTAGGAATGCATTCCTTTCTGG + Intergenic
1149656880 17:58314594-58314616 GGCAGAACTGCATCCCCTTGGGG - Intronic
1150047427 17:61927448-61927470 GTAAAAACTGCTTTGCTTTCAGG + Intronic
1150968901 17:70004269-70004291 GGCAGTGCTGCATTCTTTTCTGG + Intergenic
1150990671 17:70254619-70254641 AGCAGAGCTACATTCCTTTCTGG - Intergenic
1152694936 17:81739296-81739318 GGTGGAGCTGCATTCGTTTCCGG + Intergenic
1153256020 18:3172271-3172293 GGAACAACTGCATTCAATTCGGG + Intronic
1153892563 18:9531892-9531914 CCTAGAACTTCATTCCTTTCTGG - Intronic
1153902020 18:9625703-9625725 AGCAGGGCTGCATTCCTTTCTGG + Intergenic
1154145723 18:11864804-11864826 GCAAACACTGCCTTCCTTTCAGG - Intronic
1157328021 18:46682920-46682942 TGCAGAACTGCATTCCTTTCTGG - Intronic
1158006456 18:52677599-52677621 GGAAGAAATGCCTTTCTTTGGGG + Intronic
1158486443 18:57870498-57870520 GGAAGAACTTCCTTCCTTTATGG - Intergenic
1158973190 18:62687296-62687318 GGCAGGGCTGCATTCATTTCTGG + Intergenic
1159687680 18:71443766-71443788 AGCAAATCTGCATTCCTTTCTGG + Intergenic
1159754623 18:72348995-72349017 GGCAGGACTGCTGTCCTTTCTGG - Intergenic
1160185661 18:76674617-76674639 GGAGGAACAGCATTTCTTCCTGG + Intergenic
1165055182 19:33171644-33171666 AACAGGACTGCATTCCTTTCAGG + Intronic
926889172 2:17624722-17624744 GGCAGAGCTACATTCCCTTCTGG - Intronic
927099626 2:19778027-19778049 TAAAGAACTGAATTTCTTTCGGG + Intergenic
927362158 2:22248653-22248675 GTCAGGACTGCATTCCTTTTGGG - Intergenic
927710278 2:25321218-25321240 GGCAGGGCTGCATTCTTTTCTGG + Intronic
928200368 2:29244154-29244176 AGAAGCACCCCATTCCTTTCCGG + Intronic
929131894 2:38583631-38583653 GGAAGCACTAGATTGCTTTCTGG + Intronic
929492537 2:42408829-42408851 AGAAGAGCTGCAGTCCTTTGCGG + Intronic
930408585 2:50995118-50995140 GAGAGAACTGCATTGCTTTAGGG + Intronic
930832417 2:55759278-55759300 GGTAGGGCTGCATTCCTTTTTGG + Intergenic
931943205 2:67276126-67276148 GCAAGAGCTGCATTTCTTTCAGG + Intergenic
932696644 2:73962400-73962422 GAAATAGCTGCATTTCTTTCTGG + Intergenic
933128618 2:78643813-78643835 TGAAGACCTGCATTGCCTTCAGG + Intergenic
933244362 2:79958596-79958618 AGGAGACCGGCATTCCTTTCTGG - Intronic
933472857 2:82749247-82749269 GGAAGAAGTGGATAACTTTCTGG - Intergenic
933648003 2:84827901-84827923 GGCAGGGCTGCATTCCCTTCTGG - Intronic
933736911 2:85502658-85502680 GTAACATCTGCATTCTTTTCTGG + Intergenic
934063384 2:88317835-88317857 GGCAGAGCTGCTTTCCTTTCTGG - Intergenic
934956576 2:98626726-98626748 AGAAGAACATAATTCCTTTCGGG + Intronic
937069895 2:119055106-119055128 GGAAGGAATGCATTCCTTGGGGG - Intergenic
938421520 2:131151159-131151181 GGAGGAACTATATTCCTTGCTGG - Intronic
939379245 2:141413477-141413499 GGCCGGGCTGCATTCCTTTCTGG - Intronic
940002439 2:148979821-148979843 TGAAGAACTGAATGCCTTTGGGG - Intronic
940184201 2:150964488-150964510 GGAAGAACTTACTTCCTTACTGG + Intergenic
942144226 2:173010614-173010636 GGAAAAACTATATTCCCTTCAGG - Intronic
942359454 2:175156720-175156742 GGCAGAGCTGCATTCCTTTTTGG - Intronic
943026000 2:182629191-182629213 GGCAGGACTGAATTCCCTTCTGG - Intergenic
943070966 2:183140195-183140217 AGCAGGACTGCATTCCTTTCTGG + Intronic
944333147 2:198496153-198496175 GGAAGAAGTTCAGTTCTTTCTGG - Intronic
945061781 2:205915722-205915744 AGCAGGGCTGCATTCCTTTCTGG + Intergenic
945101557 2:206267062-206267084 GAAAAAACAGTATTCCTTTCTGG - Intergenic
945191175 2:207189162-207189184 GGAAACACTTCATTCATTTCTGG + Intergenic
945230942 2:207589217-207589239 AGCAGGACTGCATTCCTTCCTGG + Intronic
945322041 2:208435724-208435746 GGCAGGGCTGCATTCCTCTCTGG - Intronic
945394938 2:209306177-209306199 AGAAGAGCTGCAGTTCTTTCAGG - Intergenic
946805254 2:223464827-223464849 GGCAGAGCTGCATTGCATTCTGG + Intergenic
946816238 2:223581660-223581682 AGAAGAACTGCTTTCGTTACAGG - Intergenic
946839466 2:223806076-223806098 AGAAAAACTGCATACCTCTCTGG + Intronic
947256696 2:228173660-228173682 GCCAGGGCTGCATTCCTTTCTGG - Intronic
947283606 2:228484169-228484191 TGAACAACTGCTTTCCTTTAGGG - Intergenic
947999962 2:234559739-234559761 GGAAGAGATGCATTACCTTCCGG + Intergenic
948114320 2:235482906-235482928 GGCAGGGCTGCATTCCTTTCTGG - Intergenic
1168935713 20:1663830-1663852 GGGAGAACTGCTTTCTTTTTAGG + Intergenic
1169775543 20:9248927-9248949 GGCAGAGCTGCTTTCCTTTCTGG + Intronic
1172106048 20:32517834-32517856 GGAAGGAATGCCATCCTTTCAGG - Intronic
1173492719 20:43496245-43496267 AGCAGAGCTGCATTCCTTTCTGG - Intergenic
1175158106 20:56987871-56987893 GGAAGAACAGAATTTCTCTCCGG + Intergenic
1175176433 20:57115139-57115161 GGGAGAGCTGCATTCCTTTATGG + Intergenic
1175242951 20:57563142-57563164 GGAAGAAGTGCTTTGCTCTCAGG + Exonic
1175274653 20:57759951-57759973 AGCAGGGCTGCATTCCTTTCTGG + Intergenic
1175711179 20:61222247-61222269 CGAAGGGCTGCATTCCTTTCTGG - Intergenic
1176896535 21:14384907-14384929 AGCAAAGCTGCATTCCTTTCTGG + Intergenic
1177344578 21:19853504-19853526 AGAAGAGCTGCATTCCTTCGGGG - Intergenic
1177447243 21:21213602-21213624 AGAAGAACAGTATTCCTTTTAGG - Intronic
1178435070 21:32551037-32551059 CTAAGCACTGCATTTCTTTCAGG - Intergenic
1178602056 21:34003049-34003071 GGGAGAGCTGCCATCCTTTCAGG + Intergenic
1179008553 21:37535132-37535154 GGCAGGACGGCATTTCTTTCTGG - Intergenic
1179147266 21:38779022-38779044 GGCAGGGTTGCATTCCTTTCTGG - Intergenic
1179252580 21:39684887-39684909 GGCAGGGCTGCATTCCTTTCTGG + Intergenic
1180607698 22:17072275-17072297 AGAAGAAATGCATACATTTCCGG - Intergenic
1181123728 22:20689909-20689931 GCAAGCCCTGCCTTCCTTTCTGG + Intergenic
1181311569 22:21947510-21947532 AGAAAAACTGCATTCTTTTATGG + Intronic
1181914089 22:26265300-26265322 GGCAGATCTGAATTCCTATCAGG - Intronic
1182067485 22:27441094-27441116 GCAAGAACCGCATTCTTTTCTGG + Intergenic
1184560838 22:45262111-45262133 GGAAGAGCTGCAGCCCTTTGGGG - Intergenic
1184967532 22:47991746-47991768 GAGAGCACAGCATTCCTTTCCGG - Intergenic
949091279 3:32470-32492 GGAATAATGGAATTCCTTTCTGG - Intergenic
949171853 3:1009364-1009386 GGAGGCTCTGCATTCTTTTCTGG - Intergenic
950067495 3:10124672-10124694 AGCAGGACTGCCTTCCTTTCTGG + Intronic
951704555 3:25530459-25530481 GGCAGCGCTGCATTCCTTTTTGG + Intronic
951763720 3:26173331-26173353 GAAAGACCTGCACTGCTTTCTGG - Intergenic
952258085 3:31712627-31712649 GGCAGGGCTGCATTGCTTTCTGG - Intronic
952293800 3:32043161-32043183 GGAAGGAATGCATTCCTTGGGGG - Intronic
952780633 3:37093715-37093737 GGTAAAACTGAATTCCTTTCAGG + Intronic
952920873 3:38283007-38283029 AGAAGGATTGCCTTCCTTTCTGG + Intronic
953706777 3:45237230-45237252 GAAAGAGCAGCCTTCCTTTCTGG - Intergenic
953798047 3:46000545-46000567 GAAAGAAGTCCATTCCATTCTGG + Intergenic
954484550 3:50835894-50835916 GGAATATCTTCATTCCTTCCAGG + Intronic
954977702 3:54712307-54712329 AGCTGAACTGTATTCCTTTCTGG + Intronic
955413162 3:58668901-58668923 GGCAGGCTTGCATTCCTTTCTGG + Intergenic
955463221 3:59208462-59208484 AGCAGGACTGCATTCCTTTCTGG - Intergenic
956336610 3:68171337-68171359 AGAAGGACTGCATTTCTTTCTGG - Intronic
956764315 3:72471532-72471554 AGCAGGGCTGCATTCCTTTCTGG + Intergenic
956890202 3:73605974-73605996 GGAAGAACTGTATTCCAGTGGGG + Intronic
957031596 3:75248690-75248712 GGAATAATGGAATTCCTTTCTGG - Intergenic
957118774 3:76061810-76061832 AGCAGGACTGAATTCCTTTCTGG + Intronic
957356252 3:79091162-79091184 GGAAAAAATGCATACTTTTCAGG + Intronic
957946493 3:87069736-87069758 GGCAGGGCTGCATTCCTTTCTGG - Intergenic
958584405 3:96068598-96068620 AGAAGATCTGCATCCCTTTGGGG - Intergenic
958997580 3:100922712-100922734 GGCAGGGCTGCATTCCTTTCTGG - Intronic
959016843 3:101144308-101144330 AGCAGGGCTGCATTCCTTTCTGG - Intergenic
959804033 3:110529587-110529609 GAAAGAAGCGCAATCCTTTCAGG + Intergenic
960646349 3:119888794-119888816 GAAAGAAATGCATTCCTTGGGGG + Intronic
960748504 3:120917991-120918013 CACAGAACTGCATTCCTTTCTGG + Intronic
960757116 3:121027462-121027484 GGAAGAGCTGCACTTCTTTCTGG + Intronic
960875146 3:122288308-122288330 GGCAGGGCTGCATTCCTTTCTGG - Intergenic
961082854 3:124041479-124041501 AGAAGAACTGCATCTCTTCCTGG - Intergenic
961580425 3:127876164-127876186 GGCAGGACTGCATTCCTCTCTGG - Intergenic
961744982 3:129058945-129058967 GGCAGGGCTGCATTCCTCTCTGG + Intergenic
962279207 3:134037516-134037538 GCAAGAACTGGATTCCTCACCGG + Intronic
962305460 3:134282182-134282204 GGGAAGGCTGCATTCCTTTCTGG - Intergenic
963204481 3:142618494-142618516 AGCAGGACTGCGTTCCTTTCTGG + Intronic
963220425 3:142804061-142804083 AGAAGAACTGCAGTCCTTTGTGG + Exonic
963405007 3:144852851-144852873 GTAAGAACTGCAGTACTATCAGG - Intergenic
963565089 3:146919422-146919444 TTAAGGACTGCCTTCCTTTCAGG + Intergenic
964496249 3:157293446-157293468 GGAAGAACTGAATTTCTTCTTGG + Intronic
964561013 3:157996697-157996719 TGCAGAGCTGCATTCCTTTCTGG + Intergenic
964827603 3:160847469-160847491 TGAAGTCTTGCATTCCTTTCAGG - Intronic
964876730 3:161375845-161375867 GGAAAAACAGCATTCCATTAAGG + Intergenic
965081952 3:164045128-164045150 AGCAGGACTGCATTCCTTTCTGG + Intergenic
965294544 3:166926879-166926901 TGAAGAACTGTATTCCTTTCAGG + Intergenic
965837807 3:172870404-172870426 GGCAGGGCTGCATTCCCTTCTGG + Intergenic
966856982 3:184201159-184201181 GGAAGAACTGCATTTGAGTCTGG + Intronic
967346940 3:188467825-188467847 GGCAGGGCAGCATTCCTTTCTGG - Intronic
968024416 3:195427242-195427264 GGCAGGGCTGCATTCTTTTCTGG - Intronic
968725548 4:2246303-2246325 GGAGGAACTGCTTTCTTTCCTGG + Intergenic
970150562 4:13085137-13085159 GGAAGAAATGGATGACTTTCTGG + Intergenic
970360705 4:15306012-15306034 GGCAGAGCTGCATTTCATTCTGG - Intergenic
970858760 4:20677936-20677958 GGCAGGGCTGCATTCCTTTCTGG - Intergenic
970956476 4:21817627-21817649 GAAAGGAATGCATTCCTTGCGGG + Intronic
971285197 4:25282224-25282246 AGTAGGGCTGCATTCCTTTCTGG + Intergenic
971795326 4:31219586-31219608 GGCAGGGCTGCATTCTTTTCTGG + Intergenic
972039887 4:34579763-34579785 GGCAGGAGTGCATTCCTTTCTGG - Intergenic
973000499 4:44942734-44942756 GGCAGTGCTGCATTCCTCTCTGG - Intergenic
973196851 4:47454568-47454590 TGAAGAACTGCAATTCTGTCAGG + Intronic
974214202 4:58824010-58824032 GGCAGATCTTCATTCCCTTCTGG + Intergenic
975289349 4:72658703-72658725 TGAGGAACTGCATGGCTTTCTGG - Intergenic
975849467 4:78557039-78557061 GTTGGGACTGCATTCCTTTCTGG + Intronic
976044325 4:80927580-80927602 GGCAGAGCTGCATTTCTTTCCGG + Intronic
976172588 4:82319293-82319315 GTAAGAACTCCATTCATTGCTGG + Intergenic
976350796 4:84057504-84057526 GGAAGAACTGTATGTCTTTGCGG - Intergenic
976838899 4:89408037-89408059 GGCAGGGCTGCATTGCTTTCTGG - Intergenic
978362479 4:107946194-107946216 GACAGGGCTGCATTCCTTTCTGG + Intronic
978457560 4:108910904-108910926 TGAGAAACTGAATTCCTTTCAGG - Intronic
978734770 4:112073308-112073330 GGAAGGAATGCATTCCTTGGGGG + Intergenic
979819127 4:125149140-125149162 AGAAGAAATGCATACATTTCTGG - Intergenic
980473397 4:133278185-133278207 AGAAGAATTGCATTCCTGTGGGG - Intergenic
981977202 4:150745138-150745160 GGTCAAACTGCATTTCTTTCTGG - Intronic
982276918 4:153645328-153645350 GGCAGGGCTGCATTCCTTTCTGG + Intergenic
982866154 4:160514422-160514444 GGAAAAACAGCATTCCTATGAGG - Intergenic
983302571 4:165946212-165946234 AGCAGAGCTGCATTCCATTCTGG - Intronic
983885338 4:172975000-172975022 GGAAGAGCTGCAGTCCTTTGGGG - Intronic
984155398 4:176190518-176190540 GGCAGGGCTGCATTCCTTTCTGG + Intronic
985037678 4:185857682-185857704 GGAAGGAATGCATTCCTGTGGGG + Intronic
985758874 5:1734592-1734614 GCAAGGACTGTATCCCTTTCGGG - Intergenic
986650983 5:9963171-9963193 TGAAGAGCTGAATTCCCTTCAGG - Intergenic
987228483 5:15868299-15868321 AGGAGAGCTGCATTCTTTTCTGG - Intronic
987466458 5:18277742-18277764 AGAAAGGCTGCATTCCTTTCTGG + Intergenic
987914101 5:24189351-24189373 GGTAGAGCTGCATCCCTTTCTGG + Intergenic
988183440 5:27828551-27828573 GGCAAAGCTGCATTCCTTGCTGG - Intergenic
988995050 5:36706659-36706681 GGCAGAGCTGAGTTCCTTTCTGG - Intergenic
989114515 5:37939452-37939474 GGCTGAACAGAATTCCTTTCTGG + Intergenic
991603229 5:68374114-68374136 AGAAGGGCTGCATTCCTTTCTGG - Intergenic
992302602 5:75399564-75399586 GGAAGCACTACATTCTTTTTTGG - Intronic
992737447 5:79737292-79737314 GTATGAACTGTATGCCTTTCTGG - Exonic
992815065 5:80428557-80428579 TGAGGAACTGCGTTCCTTTGGGG - Intronic
993166057 5:84356386-84356408 TCCAGAACTGCACTCCTTTCTGG + Intronic
993314705 5:86387243-86387265 GGAAGAACTTCCTTCCCTTTTGG + Intergenic
993784544 5:92112682-92112704 GGGAGAAATGCTTTCCTTGCTGG - Intergenic
993917661 5:93762152-93762174 TGAGGAGCTGCATTCCTTTGAGG - Intronic
994408995 5:99382466-99382488 GGAAGAAATGGATACTTTTCTGG + Intergenic
995404140 5:111774764-111774786 AGCAGGGCTGCATTCCTTTCTGG - Intronic
995788694 5:115860039-115860061 GGTATAGCTGCATCCCTTTCTGG + Intronic
995937330 5:117532639-117532661 TGAGGAACTGCGTTCCTTTGGGG + Intergenic
996379189 5:122845995-122846017 GGATGGGCTGCGTTCCTTTCTGG + Intronic
997007120 5:129831090-129831112 ATCAGAACTTCATTCCTTTCTGG - Intergenic
997060752 5:130499629-130499651 GTTAGGGCTGCATTCCTTTCTGG + Intergenic
997277879 5:132612976-132612998 GGATGGACTGCATAGCTTTCAGG + Intronic
997816278 5:137021691-137021713 AGAATAACTGCATTCCATTTTGG - Intronic
998634734 5:143940795-143940817 GGCAGGCCTGTATTCCTTTCTGG - Intergenic
999403513 5:151285899-151285921 GGCAGAGCAGCATTCCTTTCTGG - Intronic
1000136232 5:158354055-158354077 TGAAGAACTGCAATACTTTCTGG - Intergenic
1000792777 5:165627531-165627553 GGCAGAGCGGCATTTCTTTCTGG + Intergenic
1003568953 6:7243430-7243452 GGAAGAACTGCATATTTTTAAGG + Intronic
1003820499 6:9891236-9891258 TGAGAAACTGCATTGCTTTCAGG - Intronic
1005519951 6:26591790-26591812 GGAAGAACTGCACTCCAGCCTGG - Intergenic
1005783285 6:29216277-29216299 GAAAGAGCTGCATTCTGTTCAGG + Intergenic
1005873861 6:29996761-29996783 GGAAGGCCTGCATTCCTTCCTGG - Intergenic
1006276028 6:33006356-33006378 GGATAATCTGCATCCCTTTCAGG + Exonic
1007246245 6:40465230-40465252 GGCAGAGCTACATTCCTTTCAGG - Intronic
1007822023 6:44567483-44567505 GGAAGGATTCCATTCCTTGCTGG + Intergenic
1008416709 6:51249207-51249229 AGCAAAGCTGCATTCCTTTCAGG + Intergenic
1008881553 6:56385354-56385376 GGCAGAGCTGCATTCCTTTCTGG + Intronic
1009996026 6:70896019-70896041 TGAACAACTGCTTTCCTTTCAGG + Intronic
1010646071 6:78389105-78389127 AGCAGGACTACATTCCTTTCTGG + Intergenic
1010726919 6:79345451-79345473 GGTGGGGCTGCATTCCTTTCTGG - Intergenic
1010851238 6:80780971-80780993 AGAACTACTGCATTCCTTTTGGG + Intergenic
1012076864 6:94698935-94698957 GGCAGAACTGAATGCCTTCCAGG - Intergenic
1012435560 6:99211653-99211675 GGCAGGGCTGCATTCCTTTCTGG + Intergenic
1012738759 6:102985685-102985707 AGAAGAACTGCATTTCTTTCTGG - Intergenic
1013525327 6:110968791-110968813 GGCAGGAATGCATTCCTTTATGG + Intergenic
1013920965 6:115402915-115402937 GGAAGGAATGCATTCCTTGGGGG - Intergenic
1014391776 6:120873119-120873141 AGAAGAGCTGCATTCCTTTGGGG + Intergenic
1015070360 6:129086820-129086842 GGTAGTATTGCATTTCTTTCTGG + Intronic
1015622774 6:135149654-135149676 GGAAGAACTGAAATGGTTTCTGG + Intergenic
1019156747 6:170044423-170044445 GGCAGCACTGCCTTCATTTCAGG + Intergenic
1019593434 7:1847247-1847269 GGAAGCACTGGTTTTCTTTCGGG + Exonic
1020393395 7:7685162-7685184 GGAAGACCTGAATGTCTTTCTGG + Intronic
1021160316 7:17264518-17264540 AGCAGAGCTGCATTCCTTTTTGG - Intergenic
1021421108 7:20445584-20445606 GACAGAGGTGCATTCCTTTCCGG + Intergenic
1021620276 7:22544435-22544457 AGCAGGACTGCATTCCTTTCTGG + Intronic
1022287569 7:28968753-28968775 GGCAGGATTGCATTTCTTTCCGG - Intergenic
1022349321 7:29552554-29552576 GGCAGGACTGCATTCCTTTATGG + Intergenic
1022407550 7:30105438-30105460 TGCACTACTGCATTCCTTTCTGG + Intronic
1023453575 7:40314167-40314189 GGAAGAACTGGATTCCTGGCTGG - Intronic
1024559619 7:50632121-50632143 GGCAGAATTACATTCCTTTTTGG - Intronic
1025937429 7:66048455-66048477 GGTAGGGCTGCAGTCCTTTCTGG - Intergenic
1026173907 7:67978711-67978733 GGCAGAGCTGCATCCCTTTCTGG - Intergenic
1026930199 7:74219596-74219618 GGAGGAACTGCTGCCCTTTCAGG - Intronic
1027464817 7:78502417-78502439 GGCAGAGCTGTGTTCCTTTCCGG - Intronic
1027966415 7:85015837-85015859 GGAAGTAATGCATTACTTTCAGG - Intronic
1028303378 7:89229402-89229424 GGAAGAGCAGCATTAATTTCAGG + Intronic
1028495715 7:91457463-91457485 GGCAGCACTGTGTTCCTTTCTGG - Intergenic
1028527643 7:91803030-91803052 GGCACAGCTGCATTCCTTTCTGG + Intronic
1028668814 7:93377299-93377321 AGAGGAAATGCAGTCCTTTCAGG + Intergenic
1028720754 7:94028047-94028069 AGCAGGACTGCATTCCTTCCTGG - Intergenic
1028879465 7:95863797-95863819 AAAAGAGCTCCATTCCTTTCAGG - Intronic
1030758541 7:113320884-113320906 AGAAAAACTGCAGTCTTTTCAGG + Intergenic
1030914449 7:115295329-115295351 GGAAGTACTGGGTTCCTTTTTGG - Intergenic
1030979272 7:116167054-116167076 GGCAGGGCTGTATTCCTTTCTGG - Intergenic
1032125696 7:129190716-129190738 GGAAGAGCTGCATCCTTTTTGGG + Intronic
1033183581 7:139204286-139204308 GGCAGGACTGCATTCCTTTCTGG - Intergenic
1033982135 7:147178410-147178432 GGCAGGACTACATTCCTTTCTGG - Intronic
1037072070 8:14663040-14663062 GGCAGAACTGCATTTCTTTCTGG - Intronic
1037379268 8:18266910-18266932 GGCAGAACTGAATTCCTCACAGG - Intergenic
1039101469 8:33946527-33946549 AGCAGGACTGCATTCCCTTCTGG + Intergenic
1039146244 8:34450789-34450811 TGAGGAGCTGCATTCCTTTGGGG + Intergenic
1039855694 8:41411142-41411164 GGCATAACTGCATACCTATCTGG - Intergenic
1041943795 8:63419376-63419398 GAAAGAACTTAATTACTTTCAGG + Intergenic
1042109162 8:65361026-65361048 GGTGAAGCTGCATTCCTTTCTGG + Intergenic
1042440295 8:68818273-68818295 TGAATAACTGCATTTCTTTAAGG - Exonic
1042556830 8:70040743-70040765 TGAAAAGCTGCATTCTTTTCAGG - Intergenic
1044270705 8:90239810-90239832 GGCAGGGCTGCATTCCTTACTGG - Intergenic
1044432427 8:92124253-92124275 GGTAGAGCTGCATTCATTCCAGG - Intergenic
1044501241 8:92960760-92960782 GACAGGGCTGCATTCCTTTCTGG - Intronic
1044503695 8:92992019-92992041 GGAAGAACTGCACTCCAGCCTGG + Intronic
1044796188 8:95900539-95900561 GACAGAGCTGCATTCTTTTCTGG + Intergenic
1044875240 8:96658868-96658890 GGCAGGACTGCATCCCTTTCTGG - Intronic
1045280749 8:100747545-100747567 GGCACCACTGCATTCCATTCCGG + Intergenic
1045363640 8:101455423-101455445 AGAAGAACTGCCTTCCTTGTGGG - Intergenic
1045635200 8:104178184-104178206 GGCAGGACTACATTCCTTTCTGG + Intronic
1045726522 8:105179729-105179751 GGAACTTCAGCATTCCTTTCAGG - Intronic
1045939033 8:107716967-107716989 TGAGGAGCTGCATTCCTTTGGGG + Intergenic
1045956130 8:107910103-107910125 GGAGGAACTTAATTCTTTTCTGG - Intronic
1046196018 8:110863460-110863482 GCAAGAAGTGTATTGCTTTCGGG + Intergenic
1046275268 8:111950774-111950796 GGAGAGGCTGCATTCCTTTCTGG - Intergenic
1046358751 8:113122712-113122734 ATCAGAGCTGCATTCCTTTCTGG - Intronic
1047436154 8:124836858-124836880 GGCAGGGCTGCATTCCTCTCTGG + Intergenic
1047751990 8:127888778-127888800 GGGAGGGCTGCATTTCTTTCTGG - Intergenic
1047809712 8:128395386-128395408 TAATGAACTGCATTTCTTTCTGG - Intergenic
1047820720 8:128517281-128517303 GGGAGAACTGTTTTCCTCTCTGG + Intergenic
1047919316 8:129617529-129617551 AGCAGGGCTGCATTCCTTTCTGG - Intergenic
1048519077 8:135137265-135137287 GGCAGGGCTGCACTCCTTTCTGG - Intergenic
1050684318 9:8149981-8150003 AGAAGAATTGCATTCTTTTATGG - Intergenic
1051160015 9:14197159-14197181 TCAAGCTCTGCATTCCTTTCTGG - Intronic
1051599425 9:18857895-18857917 TTAAGAACTTCATTACTTTCTGG + Intronic
1051658271 9:19403363-19403385 AAAAGAATTGCATTCCTTTGGGG + Intergenic
1052278229 9:26702874-26702896 GGAAAAGCTGCTTTCTTTTCTGG + Intergenic
1052692847 9:31836943-31836965 GGAAGAAATGCTTTCTGTTCAGG + Intergenic
1053388565 9:37716069-37716091 GGTGGAACTGTGTTCCTTTCTGG - Intronic
1053531747 9:38888973-38888995 GGAGGAGCTGCATTTCTTTCTGG - Intergenic
1054203970 9:62113401-62113423 GGAGGAGCTGCATTTCTTTCTGG - Intergenic
1054634392 9:67474964-67474986 GGAGGAGCTGCATTTCTTTCTGG + Intergenic
1055678470 9:78690462-78690484 GGTAGGTCTGCATTTCTTTCTGG + Intergenic
1055955342 9:81768212-81768234 GGCACAGCTACATTCCTTTCTGG + Intergenic
1056082716 9:83113603-83113625 GGAAGGAATGCATTCCTTGGGGG + Intergenic
1056479075 9:86982593-86982615 GGCAGAGTTGCATTCCTTTCTGG - Intergenic
1056773013 9:89493117-89493139 GAAGGAACTGCTTACCTTTCAGG - Intronic
1056914747 9:90736205-90736227 GGCAGAGATGCATTCCTCTCTGG - Intergenic
1057251214 9:93504131-93504153 GGAAGAAGTGTATTCCATGCAGG + Intronic
1057992093 9:99781307-99781329 GGTAGGGCTGCATTCCCTTCTGG + Intergenic
1058225447 9:102356117-102356139 GGAAGGAATGCATTCCTTGGGGG + Intergenic
1059094886 9:111401698-111401720 GGAAGGAATGCATTCCTGGCGGG - Intronic
1059151137 9:111950630-111950652 GGATGAACTGCACTCCTTATGGG + Intergenic
1059710003 9:116858982-116859004 GGCAGGGTTGCATTCCTTTCTGG + Intronic
1059894176 9:118841910-118841932 GGTAGAACTTGATTCCTTTCTGG + Intergenic
1186081192 X:5934569-5934591 GGCAGGGCTGCATTCCTTTCTGG - Intronic
1186280793 X:7990569-7990591 GGTGGGGCTGCATTCCTTTCTGG - Intergenic
1186419204 X:9410541-9410563 AGAAGAACACCATTCCTTCCGGG + Intergenic
1186676059 X:11818577-11818599 AGCAGGGCTGCATTCCTTTCTGG - Intergenic
1186965710 X:14784313-14784335 AGCAGAGCTGCATTCCTTTCTGG + Intergenic
1188200327 X:27288251-27288273 TGAAGAACTTCTTTACTTTCTGG - Intergenic
1188400209 X:29735121-29735143 GGCAGGGCTGCATCCCTTTCTGG + Intronic
1188434480 X:30145248-30145270 GTAAGAACTTCACTCCTCTCTGG - Intergenic
1188480414 X:30631202-30631224 GGCAAGGCTGCATTCCTTTCTGG - Intergenic
1192851748 X:74963841-74963863 GGCTGAGGTGCATTCCTTTCTGG + Intergenic
1192913914 X:75634326-75634348 GCAACAACTGCTTTCCTTCCTGG - Intergenic
1192921125 X:75707572-75707594 GGAAGGAATGCATTCCTTGGGGG + Intergenic
1193441385 X:81543770-81543792 GGAAGGAATGCATTCCTTGGGGG + Intergenic
1193629866 X:83870889-83870911 GGAAATACTGCATTCCATTTTGG - Intronic
1194129242 X:90059707-90059729 GGCAGAGTTGCATTCTTTTCTGG - Intergenic
1194581980 X:95684595-95684617 GGCAGAGCTGCATTCCTTTCTGG - Intergenic
1194754931 X:97727710-97727732 GTCATAGCTGCATTCCTTTCTGG - Intergenic
1195026527 X:100883060-100883082 GACAGGGCTGCATTCCTTTCTGG - Intergenic
1195433459 X:104815314-104815336 GGCAGGGCTGCATTCTTTTCTGG + Intronic
1195622764 X:106973854-106973876 GGCAGGGCTGCATTCCTTTCTGG - Intronic
1195637328 X:107132972-107132994 GGCAGGAATGCATTCCTTTATGG + Intronic
1196579740 X:117364756-117364778 AGCAGGGCTGCATTCCTTTCTGG + Intergenic
1196583566 X:117403703-117403725 TTAAGAACTGCTTTACTTTCTGG + Intergenic
1196596429 X:117551100-117551122 GACAGGACTGCATTCCCTTCTGG - Intergenic
1198194647 X:134347877-134347899 TGAAGAACTCCATTCAGTTCAGG - Intergenic
1198651767 X:138870945-138870967 GGCAGGGCTGCATTCCTTTTTGG - Intronic
1198790447 X:140339786-140339808 GGAAGATCTGTTTTCCTCTCGGG - Intergenic
1198834129 X:140783605-140783627 GGAAGACCTGGATTTCTTTCTGG - Exonic
1198834133 X:140783644-140783666 GGAAGACCTGGATTTCTTTCTGG - Exonic
1199046197 X:143176602-143176624 TGAAAAACTGCATGCTTTTCTGG + Intergenic
1199339479 X:146660210-146660232 GGAGTAACTCCATTCCTCTCAGG + Intergenic
1201593089 Y:15637009-15637031 AGAAGAGCTGCATTCTTTTTTGG - Intergenic
1202051090 Y:20781519-20781541 GAAAGGACTGCATTCTTTTGTGG + Intergenic