ID: 1121279357

View in Genome Browser
Species Human (GRCh38)
Location 14:92688030-92688052
Sequence GTTCGCGGTGGAGCGGCCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121279349_1121279357 14 Left 1121279349 14:92687993-92688015 CCCAGGCCCAGGCGCTGTGCGCG 0: 1
1: 0
2: 1
3: 15
4: 169
Right 1121279357 14:92688030-92688052 GTTCGCGGTGGAGCGGCCGCAGG 0: 1
1: 0
2: 0
3: 10
4: 72
1121279351_1121279357 8 Left 1121279351 14:92687999-92688021 CCCAGGCGCTGTGCGCGCAGTGC 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1121279357 14:92688030-92688052 GTTCGCGGTGGAGCGGCCGCAGG 0: 1
1: 0
2: 0
3: 10
4: 72
1121279350_1121279357 13 Left 1121279350 14:92687994-92688016 CCAGGCCCAGGCGCTGTGCGCGC 0: 1
1: 0
2: 0
3: 18
4: 191
Right 1121279357 14:92688030-92688052 GTTCGCGGTGGAGCGGCCGCAGG 0: 1
1: 0
2: 0
3: 10
4: 72
1121279352_1121279357 7 Left 1121279352 14:92688000-92688022 CCAGGCGCTGTGCGCGCAGTGCG 0: 1
1: 0
2: 0
3: 8
4: 79
Right 1121279357 14:92688030-92688052 GTTCGCGGTGGAGCGGCCGCAGG 0: 1
1: 0
2: 0
3: 10
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121279357 Original CRISPR GTTCGCGGTGGAGCGGCCGC AGG Exonic
900480125 1:2894180-2894202 GCTCATGGTGGAGCAGCCGCTGG - Intergenic
902067465 1:13700206-13700228 GATGGCGGCGGCGCGGCCGCGGG + Intronic
906615354 1:47229735-47229757 CTTCGCGGTGTAGCGGCAGCCGG - Exonic
911073031 1:93847193-93847215 GGCCGGGCTGGAGCGGCCGCCGG + Intergenic
912305253 1:108560303-108560325 GTGCGCGGGGGCGCGGCCGGGGG - Exonic
914293584 1:146297985-146298007 GCCCGCGTCGGAGCGGCCGCCGG + Intergenic
914554628 1:148748768-148748790 GCCCGCGTCGGAGCGGCCGCCGG + Intergenic
915319992 1:155051320-155051342 GCGCGCGGAGGAGCGGCCGGCGG - Exonic
1069850010 10:71398178-71398200 GGTCGCAGTGGGGCGGCGGCTGG - Intronic
1076780664 10:132722672-132722694 CGTCGCGGTGGAGCAGCTGCTGG + Intronic
1081883707 11:46476559-46476581 GTTCTAGGTGGAGAGGCCACAGG - Intronic
1082000292 11:47390476-47390498 GTCCGCGGTGGAGAGGCCCAGGG - Intergenic
1084204405 11:67583671-67583693 GCCCGGGGTGCAGCGGCCGCCGG + Exonic
1088920628 11:114257846-114257868 GGTCGCGGCGGCGCGGGCGCTGG + Exonic
1091286568 11:134411766-134411788 GTGCGCGGCGGGGCGCCCGCGGG + Intronic
1095096745 12:38153184-38153206 GGGCGCGGTGGAGGGGCTGCTGG - Intergenic
1096191314 12:49622169-49622191 GGGAGCGGTGGAGAGGCCGCCGG + Intronic
1096618614 12:52848600-52848622 GTTCCAGGTGGTGCGGACGCAGG - Exonic
1100309133 12:93378138-93378160 GCCCGCGTCGGAGCGGCCGCCGG + Exonic
1103530074 12:121595084-121595106 GGTGGCGGTGGAGGGGACGCAGG - Intergenic
1104568346 12:129904080-129904102 GTGCGCGGAGGAGGGCCCGCCGG + Intergenic
1111652151 13:91104673-91104695 GTTTGTGGTGGAGTGGCGGCAGG + Intergenic
1113636180 13:111920531-111920553 GTTCCAGGAGGAGGGGCCGCAGG - Intergenic
1118359537 14:65044409-65044431 GTGCGCGGTGGAGCAGGGGCAGG - Exonic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1121279357 14:92688030-92688052 GTTCGCGGTGGAGCGGCCGCAGG + Exonic
1121641845 14:95489972-95489994 GTTGGCGGTGGAGCCCACGCTGG - Intergenic
1122429036 14:101628471-101628493 GTTCCCCGGGGAGGGGCCGCTGG + Intergenic
1129644741 15:77419843-77419865 GTTCTGGGTGGCGCCGCCGCCGG - Intronic
1132483888 16:180495-180517 GTCCGCGGAGGACCGGGCGCTGG + Exonic
1135495500 16:22948112-22948134 GGTCGGGGTGGAGGGTCCGCTGG - Intergenic
1142242327 16:88953225-88953247 GCTCCCGGTGGAGAGGCCGAGGG + Intronic
1143661427 17:8326901-8326923 GCTCGCGGTGGAGCTGTCGCTGG - Intergenic
1148603012 17:48908418-48908440 GTTCTCGGTGGTGCGGGAGCGGG + Exonic
1151881850 17:76900539-76900561 GGTCGGGGTGGAGCAGCCACGGG + Intronic
1152097037 17:78278408-78278430 GTGAGGGGTGGAGGGGCCGCTGG + Intergenic
1155519851 18:26656923-26656945 AGCCGCGGCGGAGCGGCCGCGGG + Intronic
1158954178 18:62523635-62523657 GTTGCTGGTGGAGCGGCGGCGGG + Exonic
1160454696 18:78992436-78992458 GTTGGGGGTGCAGGGGCCGCAGG - Exonic
1160847835 19:1174129-1174151 GGTCGCGGTGGAGCCGGGGCGGG + Intronic
1160909399 19:1467856-1467878 GTTGGCGTGGGCGCGGCCGCCGG - Exonic
1162909720 19:13842457-13842479 GGTCGGGGTGGAGGGGCCACTGG + Intergenic
1163019658 19:14475404-14475426 GCGCGGGGTGGAGCGGCCCCTGG - Intergenic
1163464065 19:17455922-17455944 GTTCTCAGTGGAGCGCCTGCCGG - Exonic
1163557578 19:18001338-18001360 CTTCGCGCTGGAGCTGGCGCGGG + Intronic
1163666720 19:18606944-18606966 GTTCTCGGTGGGGCGGAGGCGGG - Intronic
1168154451 19:54465131-54465153 GTCCGCGTTGGGGCGGCAGCGGG + Exonic
928143709 2:28752340-28752362 GGGCGCGGGGGAGCGGCCTCTGG + Intronic
940682661 2:156806055-156806077 GTTGGCGGTGGGGGGGCCTCAGG + Intergenic
943185177 2:184598352-184598374 GCTCGGGCTGGCGCGGCCGCGGG + Exonic
943669960 2:190649413-190649435 TTTCGCGGCTGAGCGGCCACGGG + Intronic
1169914684 20:10673574-10673596 GTTCGCGCTGGTGCTGCCGCCGG + Exonic
1172523119 20:35582137-35582159 GCTCGAGGTGGAGCAGCCCCAGG - Intergenic
1175978957 20:62727539-62727561 GTCCGCTGTGGTACGGCCGCTGG + Intronic
1178263178 21:31118349-31118371 GTTGGCGGGAGAGCGGCCGTGGG - Intergenic
1180042655 21:45288109-45288131 GTTCGCGGCGGTGCTGTCGCGGG + Intergenic
1180535048 22:16388785-16388807 GATGGTGGTGGAGCAGCCGCTGG + Intergenic
1180791769 22:18578566-18578588 GTTCGCGGGGGTGCGCCCGCGGG - Intergenic
1181229967 22:21416743-21416765 GTTCGCGGGGGTGCGCCCGCGGG + Intergenic
1181248682 22:21518123-21518145 GTTCGCGGGGGTGCGCCCGCGGG - Intergenic
1184274134 22:43400537-43400559 GGTGGCTGTGGAGCGGCCGGAGG + Intergenic
951217845 3:20040894-20040916 TTCCGCGGTGCAGCGGCCCCAGG - Intronic
968225299 3:196969049-196969071 GTTCGCCGAGGAGGGGCCGCCGG - Intronic
981617359 4:146655457-146655479 GGCCGCGGCGGAGCGGCCGGCGG - Intergenic
985068320 4:186144644-186144666 GTGCGCGGAGGAGTGGCCGCTGG + Intronic
989638117 5:43557188-43557210 GTTCGCGGCTGGCCGGCCGCCGG + Intronic
990211344 5:53483383-53483405 GTTTGCGCTGGAGGGGCCCCAGG - Intronic
990825417 5:59893329-59893351 GCTCGAGGCGTAGCGGCCGCGGG + Exonic
997292381 5:132747343-132747365 GCTCGCGGTGGAGCTACCTCTGG - Intergenic
1002029390 5:176416619-176416641 GGTCGCCGAGCAGCGGCCGCAGG + Intergenic
1006834024 6:36986070-36986092 GCTCGCGGCGGAGCGGCGGCGGG - Exonic
1015749984 6:136550088-136550110 AGTCGCGGTGGAGCGCCCGAGGG + Intronic
1029281603 7:99439130-99439152 GATCGCGGTGGAGCAGCAGCTGG + Exonic
1033768971 7:144527096-144527118 GCTGGCGCTGGAGCGGCCGGGGG + Intronic
1034483592 7:151341937-151341959 GCCAGGGGTGGAGCGGCCGCGGG + Intronic
1049854472 8:144852838-144852860 TTCCGCGGAGGAGCGCCCGCCGG - Intronic
1059095727 9:111411719-111411741 GTTCACGGTGGTACGGCTGCAGG + Intronic
1061043690 9:128153318-128153340 GTTCGGGCTGGTGCGGCAGCTGG - Intronic
1061578170 9:131520698-131520720 GCTCGGGGTGGGGCGGCCTCTGG - Intronic
1062430819 9:136526194-136526216 CCCCGAGGTGGAGCGGCCGCTGG + Intronic
1062587440 9:137255605-137255627 GTTCCAGGTGGGGCGGCCCCCGG + Exonic
1192436328 X:71145672-71145694 GTTCACGGGGGAGGGGCTGCAGG + Intronic
1195702621 X:107716472-107716494 TTTCACGGCGCAGCGGCCGCAGG + Intronic