ID: 1121282115

View in Genome Browser
Species Human (GRCh38)
Location 14:92706468-92706490
Sequence AGCCTGCTGGCTCACCGTGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121282105_1121282115 23 Left 1121282105 14:92706422-92706444 CCAGGGGACAATATGAATTCAGC 0: 1
1: 0
2: 1
3: 9
4: 106
Right 1121282115 14:92706468-92706490 AGCCTGCTGGCTCACCGTGGGGG 0: 1
1: 0
2: 2
3: 15
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121282115 Original CRISPR AGCCTGCTGGCTCACCGTGG GGG Exonic
901245638 1:7728351-7728373 AGCCTGCCTGCTGCCCGTGGAGG - Intronic
903846933 1:26284329-26284351 AGCCCCCTGGCTCAGCCTGGAGG + Intronic
904899524 1:33845883-33845905 TGCCTGCTGGCTCACCCTCAAGG - Intronic
908217075 1:61964822-61964844 ATCCTGCTGGCCGACCGTGGTGG + Intronic
909577857 1:77195326-77195348 CGCCCGCTGGCTCAACTTGGTGG - Intronic
913383486 1:118234048-118234070 AGCCTGCTAGCTCCACTTGGTGG + Intergenic
915067608 1:153239508-153239530 ACCCTGCAGTCTCACCCTGGGGG + Intergenic
915911917 1:159920632-159920654 ATCCTTGGGGCTCACCGTGGGGG - Intronic
918451211 1:184661050-184661072 AGGCTGCTCCCTCACTGTGGAGG + Intergenic
920200531 1:204257338-204257360 AGGCTGGTGGCTCACCTTGGGGG + Exonic
920399779 1:205669641-205669663 AGCCTGCGGGGTCAGGGTGGGGG - Intronic
920691887 1:208153637-208153659 AGCCTGCTGGCTCAGACAGGTGG + Intronic
922240842 1:223754794-223754816 GGCCTCCGGGCTCACCGAGGGGG + Intronic
922774892 1:228210150-228210172 AGTCTGCTGACTCACTGTGCAGG - Intronic
923063133 1:230495365-230495387 ACCCTGCTGGTTCATAGTGGAGG + Intergenic
1062820455 10:530881-530903 AGGCTGCTGTCTGACTGTGGAGG - Intronic
1064129286 10:12693714-12693736 AGCCTGCTGGCTTATCCTAGAGG + Intronic
1065742291 10:28807979-28808001 AGCCTGCCGGATCATCTTGGTGG - Intergenic
1069496166 10:68905202-68905224 AGCCTGGTGGCTAGCCGTGGTGG - Intronic
1071717804 10:88114649-88114671 AGCCATCTGGTGCACCGTGGCGG - Intergenic
1072640439 10:97207302-97207324 ACCCTGCTGGCTCCCCAGGGCGG + Intronic
1077475974 11:2790671-2790693 AGCCTCCTGGCCCCCAGTGGAGG + Intronic
1080038205 11:27731262-27731284 AGCCTTCTGGCAGACCGAGGAGG - Intergenic
1080649125 11:34209056-34209078 AGCATCCTGGCTGGCCGTGGTGG + Intronic
1083746703 11:64741114-64741136 AGCCTGCTGGGTGATGGTGGGGG - Intronic
1084420729 11:69059277-69059299 AGCCTGCCCGCTCACCCTGCTGG + Intronic
1086391739 11:86371900-86371922 GACCTGCTGGCTCACCGTGTAGG - Intergenic
1086818975 11:91411373-91411395 TCCCTGCTGGCCCACCATGGAGG - Intergenic
1089620756 11:119720904-119720926 TACCTGCTGGCTCTCCGTAGTGG + Intronic
1097671206 12:62541092-62541114 AGCTTGCAGGCTGAGCGTGGTGG + Intronic
1099443622 12:82727471-82727493 GGCGTGGTGGCTCACGGTGGAGG + Intronic
1099592449 12:84612223-84612245 AGCCTTCTGGCTGGGCGTGGTGG + Intergenic
1101418630 12:104530747-104530769 AGCCTCCTGACTCACCTTTGGGG + Intronic
1102188322 12:110966623-110966645 GGCCTGCTGGCTCACCCGTGAGG - Intergenic
1104393554 12:128411904-128411926 AGCCTGGTGTCTCACCGTAAGGG - Intronic
1104530835 12:129569686-129569708 AGCCTGCAGGGTCAGCGTTGAGG - Intronic
1109157129 13:58925074-58925096 AGCCTACTGGATCAACTTGGAGG - Intergenic
1112193188 13:97198390-97198412 AGCTTGCTGACTCACCCTGCAGG + Intergenic
1113635968 13:111919344-111919366 ACCCTGCTGGGCCACTGTGGGGG - Intergenic
1114673863 14:24428796-24428818 CCCCTGCTGGCTCATGGTGGTGG + Exonic
1117642018 14:57810147-57810169 AGGCTGCTGGCTCAGGATGGAGG - Intronic
1119787973 14:77327031-77327053 AGGCTGCTGGCTCTCCCTTGTGG + Intronic
1121282115 14:92706468-92706490 AGCCTGCTGGCTCACCGTGGGGG + Exonic
1122229709 14:100299679-100299701 AGGCTGCTTACTCACAGTGGTGG - Intronic
1122858421 14:104571229-104571251 AGCTTGCTGGGGCCCCGTGGGGG + Intronic
1124468778 15:29964718-29964740 AGCCTGCTGGCTTCCTTTGGGGG - Intronic
1125162039 15:36655610-36655632 AGCCTGCTGGCCGGGCGTGGTGG - Intronic
1128462539 15:67882013-67882035 AGCCTGCTGGCTTCCTTTGGTGG - Intergenic
1129676728 15:77635629-77635651 TGCCTGCTGGACCACCCTGGTGG + Intronic
1132873549 16:2125940-2125962 ACCCTGCTGGCTGCCCGGGGAGG - Intronic
1134552637 16:15145116-15145138 ACCCTGCTGGCTGCCCGGGGAGG - Intergenic
1135378738 16:21974878-21974900 AGCCTCCTGTCTCACTGAGGAGG - Intronic
1136128482 16:28202986-28203008 AGTCTGCTGGCTGGGCGTGGTGG + Intronic
1137428592 16:48400225-48400247 TGCCTGCTGGCTGTCCATGGAGG + Intronic
1138418425 16:56884500-56884522 AGCCTGCTGGCCCCTCTTGGGGG - Intronic
1138862125 16:60771265-60771287 AGCTTGCTTGCTCACCCTGCAGG - Intergenic
1139594633 16:67950547-67950569 AGCCTGCTGGCTGCCTTTGGTGG - Intronic
1139664110 16:68444266-68444288 AGCCAGCTGGATCACTGTGGAGG - Intronic
1141718632 16:85742083-85742105 AGCCTGGTGGCTGGGCGTGGTGG + Intronic
1143107496 17:4536893-4536915 CGCCAGCTGGTTCACCCTGGGGG - Exonic
1147214806 17:38892863-38892885 AGCCTGCTGGGTTCCCGGGGGGG + Intronic
1147626038 17:41900777-41900799 TGCCTGCTGTCTCACAGTGATGG + Intronic
1149507942 17:57211412-57211434 TGCCTGATGGCTCACCCTTGAGG - Intergenic
1149833312 17:59890527-59890549 ACCCTGCTGGCTGGGCGTGGTGG - Intronic
1151939868 17:77285841-77285863 AGTGTGCTGGCTCGCCGTGGTGG + Intronic
1152725177 17:81941608-81941630 AGCCTGGTGGCCCACCGGGGTGG - Exonic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1161610915 19:5242119-5242141 AAACTGCTGGCTCAGCGTGGTGG - Intronic
1162783594 19:13020493-13020515 GGGCTGCTGGCTCCCAGTGGAGG - Intronic
1163651171 19:18518878-18518900 AGCCAGCTGGAGCAGCGTGGTGG - Intronic
1164457405 19:28420370-28420392 TGCCTGCTGGCTGGGCGTGGCGG - Intergenic
1165952175 19:39480671-39480693 AGTCTCCTGGCTGACCCTGGGGG - Exonic
1167285540 19:48596880-48596902 AGCCTGCTGGACCACCGTCGCGG + Exonic
1167749600 19:51371805-51371827 AGCCTGGGTGCTCACTGTGGCGG - Exonic
1168267599 19:55231021-55231043 ACGCAGCTGGCTCAGCGTGGAGG + Intronic
925329243 2:3045337-3045359 AGCCTGCTGTCTCACTGTGGCGG - Intergenic
926613528 2:14971728-14971750 AGCATGGTGAGTCACCGTGGTGG - Intergenic
928115103 2:28540463-28540485 AAGCTGCTGGCTCACCGGGGTGG + Intronic
928637329 2:33261221-33261243 AGTCTGCTGCCTCACGGTGATGG + Intronic
929874572 2:45786040-45786062 GCCCTGCTGGGTCATCGTGGGGG + Intronic
931851222 2:66252223-66252245 AGCCTCCTGGCTCTCCGGGAGGG - Intergenic
946412854 2:219523611-219523633 AGCCACCTGGCTCACCCAGGAGG - Intronic
947054686 2:226087195-226087217 AGCCTGCTGGCTCAAATGGGTGG - Intergenic
947103735 2:226647924-226647946 AGCCTGCTGCTGCACTGTGGGGG + Intergenic
948183066 2:235998401-235998423 AGCCTGCTGGCTCACCTCCAAGG - Intronic
948927654 2:241109620-241109642 ACCCTGCTGACTCAGCCTGGGGG - Intronic
1170775379 20:19370889-19370911 AGCCTGGTGGGTCCCGGTGGTGG + Intronic
1172033051 20:31995228-31995250 AGCCTGCTGGTGCACCGCGGTGG + Exonic
1175282812 20:57815407-57815429 AGCCTGCTAGCTCACCCTGCAGG - Intergenic
1175599676 20:60263123-60263145 AGCCTGCTCGCTGGCCATGGAGG + Intergenic
1178405533 21:32320199-32320221 AGGCTGCTGGGACACCGGGGAGG + Intronic
1178974224 21:37208181-37208203 AGGCTGCTGGCTCACCCCGCGGG - Intergenic
1179023325 21:37658701-37658723 AGAGTGCTGGCTCACTGGGGTGG + Intronic
1179537984 21:42064460-42064482 AGCTTGCTGACTCACCTTGCAGG + Intronic
1183075443 22:35423689-35423711 AGCTTTCTGGCTCACTGAGGAGG + Intronic
1185371152 22:50461508-50461530 AGTCTGCAGGCTCACCCAGGGGG + Exonic
1185397840 22:50601525-50601547 AGGCTGCTGGCTCTCCAGGGAGG + Intronic
952042111 3:29273513-29273535 AGCCTGCTGGCTCACCCTGAAGG - Intergenic
954191107 3:48962087-48962109 AGGCTGCTGGCTGTACGTGGTGG + Intronic
957192475 3:77027676-77027698 AGCCAGCTGTCGGACCGTGGAGG + Intronic
962264647 3:133936213-133936235 AGCCTCCTGCCACACAGTGGAGG - Intronic
962591124 3:136890394-136890416 AGCCTGCTCCCTCAGCTTGGGGG - Intronic
963405651 3:144860859-144860881 AGCCTGCTGGCTGGGCGCGGTGG + Intergenic
965711832 3:171563454-171563476 AGCCTGGAGGCTCCCCCTGGGGG + Intergenic
966841810 3:184095609-184095631 AGCATGGTGGCTCACAGTTGAGG + Intergenic
978360931 4:107931000-107931022 ATCCTGCTGTCTCTGCGTGGAGG + Intergenic
980127511 4:128787927-128787949 AGCCTGCTGGCTACCCTGGGTGG - Intergenic
982291817 4:153789325-153789347 GCCCTGCTCGCTCACTGTGGGGG - Intergenic
984865004 4:184273722-184273744 AGCTTGCTGGCTTGGCGTGGTGG - Intergenic
987491102 5:18581227-18581249 AACCTTCTCGCTCACCCTGGGGG - Intergenic
988663367 5:33298008-33298030 ACCCTGCTGGCGCACCCTGCTGG + Intergenic
988663370 5:33298021-33298043 ACCCTGCTGGCGCACCCTGCTGG + Intergenic
988663373 5:33298034-33298056 ACCCTGCTGGCGCACCCTGCTGG + Intergenic
988663376 5:33298047-33298069 ACCCTGCTGGCGCACCCTGCTGG + Intergenic
988663379 5:33298060-33298082 ACCCTGCTGGCGCACCCTGCTGG + Intergenic
988663382 5:33298073-33298095 ACCCTGCTGGCGCACCCTGCTGG + Intergenic
988663385 5:33298086-33298108 ACCCTGCTGGCGCACCCTGCTGG + Intergenic
991081820 5:62609073-62609095 TGTCTGCTGGCTCACCATGTTGG + Intronic
993380039 5:87196255-87196277 AGCCTCCTGGCCCACCCTGAAGG - Intergenic
999145651 5:149391554-149391576 AGCCTGCTGTTTCACAGTGCTGG + Intronic
1001787445 5:174425893-174425915 AGCCTCCTGCCTCACCCTGCAGG - Intergenic
1001866423 5:175109676-175109698 AGCCTTCTGCCTCTCCCTGGAGG + Intergenic
1002103106 5:176867043-176867065 AGCCTGCCGGCTCAGCTGGGCGG + Intronic
1004066967 6:12256470-12256492 AGGTTGATGGCTCACTGTGGAGG - Intergenic
1005028631 6:21488631-21488653 GGCCTGGTGGCTCACTTTGGAGG - Intergenic
1006094187 6:31645422-31645444 TGCCTGCTGGAGCACCATGGGGG + Exonic
1008535242 6:52502444-52502466 AGCCTGCTGTCGCTCTGTGGGGG - Exonic
1010076453 6:71803850-71803872 AGCTTGCTGGGTCTCCGAGGGGG - Intergenic
1010355297 6:74925655-74925677 AGCCTCCTGGGTCACACTGGAGG - Intergenic
1015574123 6:134652850-134652872 AGCCTTCTGGCTGGGCGTGGTGG + Intergenic
1018029413 6:159830340-159830362 TGGGTGCTGGGTCACCGTGGTGG - Intergenic
1019634991 7:2070750-2070772 AGCCTCCTGGCTCTCCCTGATGG - Intronic
1023454998 7:40328972-40328994 AGCCTGGTGGCTCTGTGTGGAGG + Intronic
1024659290 7:51477822-51477844 AGCCTGCAGGCTCTCTGAGGAGG + Intergenic
1026237055 7:68535543-68535565 AGCCTGCTGCTGCACTGTGGGGG - Intergenic
1037725984 8:21482926-21482948 AGCCCCCTGGCTCAGTGTGGAGG - Intergenic
1037747860 8:21661172-21661194 AGCCTGCTGCAGCACAGTGGTGG + Intergenic
1037986172 8:23291940-23291962 AGCCTGCTGGGGCAGAGTGGAGG + Intronic
1039922805 8:41905163-41905185 GGCCTGCAGACTCACCCTGGTGG - Intergenic
1043331158 8:79120386-79120408 ATCCTGCTGCCTCACTGTGGTGG + Intergenic
1047042341 8:121009843-121009865 AGGCTGCTGGCTCACCTAGTAGG + Intergenic
1053338140 9:37296744-37296766 AGGCTGCTGGCACGCAGTGGCGG + Intronic
1055822505 9:80284132-80284154 AGCCTGCTGGGTCAAGGTGCTGG + Intergenic
1056281108 9:85041894-85041916 AGCCTTCTGGCTCAGGCTGGAGG + Intergenic
1056752375 9:89362042-89362064 AGCCTGCTGCCTGACCGTAGAGG + Intronic
1056795419 9:89655592-89655614 TGCCTGGTGCCTCACAGTGGTGG + Intergenic
1059644300 9:116249322-116249344 AGACTGCTTGCTCAGGGTGGTGG + Intronic
1062685602 9:137811405-137811427 TTCCTGCTGGCTCACAGTGCTGG - Intronic
1187217632 X:17292232-17292254 AGCCTGCTGACTCACACTCGGGG - Intergenic
1187258975 X:17667833-17667855 AGCCTGCTGCCTTCCCCTGGAGG + Intronic
1187687686 X:21832080-21832102 AGCCTGGTGGCTGGGCGTGGTGG + Intergenic
1187915736 X:24150402-24150424 GGCGTGCTCGCTCCCCGTGGCGG + Intronic
1190745336 X:53319105-53319127 AGCCTGCTGCCTCACCACGGGGG + Intronic
1194185071 X:90765583-90765605 AGCCTGCTGCTGCACTGTGGGGG + Intergenic
1200059269 X:153477050-153477072 AGCCTGGTGGCTGACCTGGGTGG - Intronic
1201910350 Y:19127550-19127572 ATGCTGCTGCCTCACTGTGGTGG + Intergenic