ID: 1121283123

View in Genome Browser
Species Human (GRCh38)
Location 14:92713721-92713743
Sequence CAGCACCCACAGTTGGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 253}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121283118_1121283123 -6 Left 1121283118 14:92713704-92713726 CCCCTTTCTAGAAAACACAGCAC 0: 1
1: 0
2: 2
3: 15
4: 235
Right 1121283123 14:92713721-92713743 CAGCACCCACAGTTGGAGGACGG 0: 1
1: 0
2: 0
3: 17
4: 253
1121283113_1121283123 26 Left 1121283113 14:92713672-92713694 CCTCATCCTGGGAAACCAGGGAT 0: 1
1: 0
2: 3
3: 29
4: 240
Right 1121283123 14:92713721-92713743 CAGCACCCACAGTTGGAGGACGG 0: 1
1: 0
2: 0
3: 17
4: 253
1121283117_1121283123 11 Left 1121283117 14:92713687-92713709 CCAGGGATTGGAAGGATCCCCTT 0: 1
1: 0
2: 0
3: 12
4: 103
Right 1121283123 14:92713721-92713743 CAGCACCCACAGTTGGAGGACGG 0: 1
1: 0
2: 0
3: 17
4: 253
1121283115_1121283123 20 Left 1121283115 14:92713678-92713700 CCTGGGAAACCAGGGATTGGAAG 0: 1
1: 0
2: 0
3: 19
4: 223
Right 1121283123 14:92713721-92713743 CAGCACCCACAGTTGGAGGACGG 0: 1
1: 0
2: 0
3: 17
4: 253
1121283120_1121283123 -8 Left 1121283120 14:92713706-92713728 CCTTTCTAGAAAACACAGCACCC 0: 1
1: 0
2: 1
3: 18
4: 196
Right 1121283123 14:92713721-92713743 CAGCACCCACAGTTGGAGGACGG 0: 1
1: 0
2: 0
3: 17
4: 253
1121283119_1121283123 -7 Left 1121283119 14:92713705-92713727 CCCTTTCTAGAAAACACAGCACC 0: 1
1: 0
2: 2
3: 26
4: 260
Right 1121283123 14:92713721-92713743 CAGCACCCACAGTTGGAGGACGG 0: 1
1: 0
2: 0
3: 17
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121283123 Original CRISPR CAGCACCCACAGTTGGAGGA CGG Intronic
900352683 1:2243382-2243404 CTGCACCCACAGCTGCAGAAAGG - Intronic
900588087 1:3443226-3443248 CAGAGCCCAGAGTTGCAGGACGG - Intergenic
900588095 1:3443263-3443285 CAGAGCCCAGAGTTGCAGGACGG - Intergenic
900588103 1:3443300-3443322 CAGAGCCCAGAGTTGCAGGACGG - Intergenic
900991571 1:6100543-6100565 CCCCACCCACTGTTGGAAGAGGG + Exonic
902201681 1:14838151-14838173 CTGCACCCTCACGTGGAGGAAGG + Intronic
902530218 1:17086097-17086119 TATAACCCACAGTTGGGGGAGGG + Intronic
903646201 1:24897691-24897713 CAGCCCCCACAGCTTGAGGTTGG - Intergenic
904222861 1:28987480-28987502 CAGCACCAACAGAAGGAAGAGGG + Exonic
904318436 1:29681162-29681184 CTGCACGCACAGCTGCAGGAAGG + Intergenic
904439050 1:30517820-30517842 CTGCACGCACAGCTGCAGGAAGG - Intergenic
904917308 1:33979446-33979468 TGGTACCCACAGTAGGAGGAAGG - Intronic
905340217 1:37272906-37272928 CAGCCCCCTCAGTGGGAGCAGGG + Intergenic
905773451 1:40653282-40653304 TAGTACCCACAGTTAGAGGTAGG + Intronic
906564554 1:46789505-46789527 AAACACCCACAGTTTGTGGAGGG + Intronic
909100386 1:71341673-71341695 TAGCACCCCCTTTTGGAGGAGGG - Intergenic
911545015 1:99206135-99206157 CTGCATCCACATATGGAGGAAGG + Intergenic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
913316977 1:117561769-117561791 CAGAAGCCAAAGATGGAGGATGG + Intergenic
913509325 1:119547893-119547915 TGGCACCCACAGTTGTAAGAAGG - Intergenic
915089890 1:153416914-153416936 CTGCCCCCACAGAGGGAGGAGGG + Intronic
916291983 1:163176975-163176997 CAGCAGCCACCTTTGGAGCATGG - Intronic
918215172 1:182387082-182387104 CAGCATTCACAGATTGAGGAGGG + Intronic
919107164 1:193168105-193168127 CAGCACTCAGAGGTGGAGGCGGG - Intronic
919985713 1:202673157-202673179 CACCATCTACACTTGGAGGATGG - Intronic
920069055 1:203289533-203289555 CAGCACCCAGAGCTTGGGGATGG + Intergenic
920268988 1:204749062-204749084 CAGCACCCAGAGGTGGGGGAAGG - Intergenic
920279890 1:204834817-204834839 TGGCACCCAGAGTTGGAGGAAGG + Intronic
922730433 1:227946527-227946549 CCGTACCCACAGTTGGAGCCAGG + Intronic
923862801 1:237908483-237908505 CAGTACCAAGAGTTGAAGGAAGG + Intergenic
1062875672 10:941159-941181 CAGCACCCACAGGTGGGAGTGGG - Intergenic
1063953437 10:11244892-11244914 CACCAGACACAGATGGAGGAAGG - Intronic
1064553191 10:16522203-16522225 CAGCAGCCCCAGTTGGAGGGTGG + Intergenic
1067735995 10:48851294-48851316 AAGCATCCACATATGGAGGAGGG - Intronic
1067764043 10:49071809-49071831 CAGCTCCCACACATGCAGGAGGG + Intronic
1069378306 10:67816996-67817018 CAGCACCCACATCTGGAGAGGGG + Intronic
1070793478 10:79203443-79203465 CAGAACCCTGAGTGGGAGGAGGG - Intronic
1073344938 10:102775985-102776007 CAGAGCCCACTGTGGGAGGATGG - Intronic
1076684959 10:132194408-132194430 CAGCTCCCACTGTTCTAGGAAGG + Intronic
1076722605 10:132399234-132399256 CAGCACCCACACTTGGGGACTGG - Intronic
1076743989 10:132503717-132503739 CAGGACTCCCAGGTGGAGGAAGG + Intergenic
1076807434 10:132866103-132866125 CAGCATCCACAGGTGGGGAAAGG + Exonic
1076808471 10:132872729-132872751 CAGCACCCCCAACTGCAGGACGG + Exonic
1077382857 11:2253648-2253670 TAGCACAAACAGTGGGAGGAAGG + Intergenic
1079690898 11:23415660-23415682 CGGCACCCACAGTGGTAGGTTGG + Intergenic
1080096456 11:28414138-28414160 CAGCAACCACAGTTGTATGCTGG + Intergenic
1081386177 11:42476231-42476253 CTCTACCCACAGTGGGAGGAGGG - Intergenic
1081599138 11:44480375-44480397 CACCCCCCAGAGTTAGAGGATGG - Intergenic
1083291246 11:61691490-61691512 CTGCAGACACAGTTGGAGGCAGG - Intronic
1083406860 11:62463593-62463615 CAGCACGCACAGTGGGATGTAGG - Intronic
1083491855 11:63019563-63019585 CAGCAGCCACAGCAGGAGCAGGG - Intergenic
1083793299 11:64999789-64999811 CAGCAGCCCCAGTGGGTGGAGGG + Intergenic
1084465278 11:69319723-69319745 CAGCAGTCACACTTGGAGCAAGG - Intronic
1084564385 11:69920935-69920957 CAGCAGCCACAGGTGCAGGAGGG + Intergenic
1084800891 11:71543182-71543204 CAGCAGCTGCAGGTGGAGGAGGG + Intronic
1088844209 11:113651352-113651374 TAGTACCCAATGTTGGAGGAGGG - Intergenic
1090920222 11:131200392-131200414 CAGCACCCAAAGGTGGGGGCAGG - Intergenic
1092041496 12:5389156-5389178 CAGCACATTCAGTTGGAGGAAGG - Intergenic
1092913094 12:13165483-13165505 CAGCAGCCACAGTGTGGGGAAGG + Intergenic
1092961929 12:13604158-13604180 CAGCTCCCCCAGTGGGAGGAGGG - Intronic
1093044054 12:14421421-14421443 CAGCACCCTCAGAGGGAGAATGG - Intronic
1095599964 12:44002769-44002791 CTGAACCCACAGTGGTAGGAAGG + Intronic
1096919386 12:55067917-55067939 CAGCAGCAACAGTTTGAGGAAGG + Intergenic
1098079909 12:66772934-66772956 CAGCTGCCACATTTGGGGGAAGG - Intronic
1101974716 12:109347091-109347113 CAGCACCCCCTGTTGGATGGAGG - Intergenic
1102481030 12:113223362-113223384 CAGAGCCCACAGCTTGAGGAAGG + Intronic
1103159446 12:118716184-118716206 CACAACACACAGTTGGAAGACGG + Intergenic
1103797018 12:123510184-123510206 CAGGACCCACAGCCGGAGGCAGG - Intronic
1104734972 12:131131085-131131107 CAGCTCCCTCAGTAGGAGGCTGG - Intronic
1104955103 12:132460752-132460774 CAGCACCCCCTGTTGGAGAGAGG - Intergenic
1104993500 12:132640208-132640230 CAGGACCCAGGGATGGAGGATGG + Intronic
1106113943 13:26801203-26801225 CTGCACCCGCAGTCTGAGGAGGG - Intergenic
1107805373 13:44148850-44148872 CAGTACCCAGAGCTGGAGGATGG + Intronic
1110833123 13:80054249-80054271 CAGCCCCCAGAGGTGGAGGTTGG - Intergenic
1114574864 14:23703025-23703047 CAGCAAGGACAGTTGGAGGAAGG + Intergenic
1115191828 14:30754780-30754802 CAGAACCCACAGTGGCAGCATGG - Intergenic
1115972374 14:38960300-38960322 CAGCAGCCACCATAGGAGGAAGG + Intergenic
1116204676 14:41848583-41848605 CATGACCAACAGTTGGAGGTTGG - Intronic
1117263881 14:54065595-54065617 CAAAACCCACAGTAGGAAGATGG - Intergenic
1117384361 14:55195725-55195747 CAGCACCCACGCATGGAGGGAGG - Intergenic
1118246438 14:64115366-64115388 CACCACCCAGAGGGGGAGGAAGG + Intronic
1119678877 14:76576872-76576894 TAGCCCTCACAGCTGGAGGATGG + Intergenic
1120749560 14:88185602-88185624 CAGCACGCTGAGTTGGAGAACGG - Exonic
1121283123 14:92713721-92713743 CAGCACCCACAGTTGGAGGACGG + Intronic
1121795621 14:96732981-96733003 AAGGACCCACAGTTGGAGTTAGG + Intergenic
1122983846 14:105203316-105203338 CAGCCCCCACAGCTGGGTGATGG - Intergenic
1123107563 14:105849801-105849823 CGGAGCCCACGGTTGGAGGATGG + Intergenic
1125256845 15:37774356-37774378 CAGCACCCACAGTGGTGGGCAGG + Intergenic
1125391354 15:39196163-39196185 CTACACCCAGAGTTGGAGAATGG - Intergenic
1127130920 15:55862421-55862443 CAGCACGCACAGATCAAGGACGG - Intronic
1127834461 15:62779439-62779461 TAGCACCCACAAAAGGAGGAAGG + Intronic
1128719136 15:69933202-69933224 CAGCATCCACAATTTGAGAAGGG - Intergenic
1130297382 15:82656813-82656835 CAGCACACACAGGTGGAAGCAGG - Intergenic
1132379341 15:101355762-101355784 CGGCACCCTCAGGTGCAGGAAGG - Intronic
1132512207 16:349150-349172 AAGCACCCATAGATGGAGGATGG + Intronic
1132757146 16:1491227-1491249 AAGCACCCACTGTTGGATGCGGG + Intergenic
1133395365 16:5442746-5442768 CAGCACCTGCTTTTGGAGGACGG - Intergenic
1134433708 16:14235674-14235696 CAGCCCCCACAAGTGAAGGATGG - Intronic
1135048654 16:19174431-19174453 CAGGACCCACAGCTGGAGCCTGG + Intronic
1136013346 16:27379143-27379165 CTGCACACACAGGCGGAGGATGG - Intergenic
1138528528 16:57622428-57622450 CAGGAGCCACACTCGGAGGAGGG + Intronic
1138969637 16:62129301-62129323 CAGAACCCGCAGTAGGGGGAGGG + Intergenic
1140858496 16:78998934-78998956 CAGCAACCAAACTTGCAGGATGG + Intronic
1142363246 16:89637059-89637081 CAGCACCCACCCTGGGGGGATGG - Intronic
1143730562 17:8880513-8880535 CAGGACCCACAGTGGGACTATGG + Exonic
1145070535 17:19801820-19801842 CAGCACAGACAGTTGGACGAAGG - Exonic
1146391620 17:32428472-32428494 CAGCAGCCCTGGTTGGAGGAGGG + Intergenic
1147529663 17:41263535-41263557 AAGCAACCACAGTTGGACAATGG - Intergenic
1148560977 17:48605949-48605971 CAGGACCAAAACTTGGAGGATGG - Intergenic
1148745109 17:49913802-49913824 CAGCACCCAGAAGAGGAGGATGG - Intergenic
1148863576 17:50617398-50617420 CAGCTCCCTGAGTTGGGGGAGGG - Intronic
1148949669 17:51299813-51299835 CTGCACCTCCAGTTTGAGGATGG + Intergenic
1149807700 17:59634564-59634586 AAGCAACCACAGTTGGAGAGAGG - Intronic
1150502462 17:65664301-65664323 GAGCACCCACACTTGGCTGAGGG + Intronic
1150647680 17:66989798-66989820 CAGTACCCACATTGGGAGGTTGG - Intronic
1152506999 17:80756065-80756087 CAGCACATACATTTGGGGGAAGG - Intronic
1152568514 17:81111087-81111109 CAGCACCCAGAGTGAGAGGCAGG - Intronic
1152667131 17:81577667-81577689 CAGCACGCAGAGTTTGAAGATGG - Intronic
1152875968 17:82786403-82786425 CAGCACCCACACTCGGGGCAGGG - Intronic
1153238577 18:3011829-3011851 CAGCATCCTCAGTTGTTGGAGGG - Exonic
1153285047 18:3449558-3449580 CAGCAGCGACAGTGGGAGGTCGG - Intronic
1153343964 18:4006529-4006551 TTGCAGTCACAGTTGGAGGAGGG + Intronic
1154036192 18:10804771-10804793 CAGCACTCACATTTGGTGGCCGG + Intronic
1155864678 18:30950623-30950645 CATGACACACAGTTGGAGGTAGG - Intergenic
1155909130 18:31488151-31488173 CAGCACCAACATTTGGAGTCAGG - Intergenic
1156008279 18:32469564-32469586 CAGAATAAACAGTTGGAGGAAGG + Intronic
1156228640 18:35132922-35132944 CAGCAGCCAGAGGTGGAGGTGGG + Intronic
1157494023 18:48142592-48142614 AGGCACCCACTGTGGGAGGAGGG + Intronic
1157759593 18:50251260-50251282 ACGCACCCACAGGTGGAGAATGG - Intronic
1159618422 18:70609106-70609128 CAGAATCCACAGTAGGAGCAAGG + Intergenic
1160187777 18:76688806-76688828 CAGCAGACACACTAGGAGGATGG - Intergenic
1160844403 19:1160095-1160117 CAGCACCCACAGCCAGAGGGCGG - Intronic
1161642859 19:5435301-5435323 CTGGACCCACAGTGGCAGGAGGG - Intergenic
1161667483 19:5586037-5586059 CAGAACCGGCAGTTGGAGGAGGG + Intergenic
1163648212 19:18502215-18502237 CAGCACCCAGAGGTGAATGAAGG + Intronic
1164335923 19:24321285-24321307 CAACATCGACAGTTGGGGGAAGG - Intergenic
1164541990 19:29128317-29128339 GAGGACTCACAGTGGGAGGATGG + Intergenic
1167073916 19:47237353-47237375 CATCACCCACAGGTGGCAGAGGG - Intergenic
1167360529 19:49028135-49028157 CAGGAGCCACAGCAGGAGGATGG - Intronic
1167363119 19:49040665-49040687 CAGGAGCCACAGCAGGAGGATGG + Intergenic
1167365448 19:49052921-49052943 CAGGAGCCACAGCAGGAGGATGG - Intergenic
1167429669 19:49447255-49447277 CATCACCCAGTGTGGGAGGATGG + Intronic
1167851051 19:52202271-52202293 CAGCTCCAACAGTTGGAAGCTGG + Intronic
925389151 2:3483698-3483720 GAGCACCCAGAGATGGAGGAAGG + Intronic
928131267 2:28652877-28652899 CTGCACATACAGTTGGAAGATGG - Intergenic
929094563 2:38251186-38251208 CAGAGCCTAGAGTTGGAGGATGG - Intergenic
929948411 2:46387991-46388013 CAGCACCCCCAGGAGCAGGAGGG - Intergenic
932574360 2:72954645-72954667 CAGCCCCCACAGCTGCAGGGAGG + Intronic
933774210 2:85761997-85762019 CAGCACCCCCAGAGGGTGGAGGG + Intronic
934128026 2:88917371-88917393 CTCCACCCAGAGTTGTAGGAGGG - Intergenic
936042509 2:109160717-109160739 CAGCTCCCAGAGTAGGAGCAGGG - Intronic
938185413 2:129227541-129227563 CAGGACCCAGAGTGGGAGGCAGG - Intergenic
940252397 2:151693430-151693452 CAACACACACTGTTGGAGGCTGG - Intronic
947618832 2:231575867-231575889 CAGCACCCAGAGCAGGAGGGAGG + Intergenic
948708296 2:239809471-239809493 CAGCGCCCACACAGGGAGGAGGG - Intergenic
948729901 2:239956200-239956222 CAGCGCCTACACTTGGAGGTGGG + Intronic
949064632 2:241982399-241982421 CGACTCCCACAGGTGGAGGAAGG + Intergenic
1169476004 20:5931786-5931808 CTGCACACAGATTTGGAGGATGG - Intergenic
1169518564 20:6345605-6345627 CAGTCCCCAAAGTTGGAGGTGGG - Intergenic
1169668154 20:8063037-8063059 CAGCACCCGTCATTGGAGGAGGG + Intergenic
1172304532 20:33871678-33871700 CAGCCCACACAGTTGGCAGAGGG - Intergenic
1173541337 20:43854034-43854056 CAGCAGCCGCAGATGCAGGACGG - Intergenic
1174132701 20:48357326-48357348 CTCCTCCCACAGGTGGAGGAGGG - Intergenic
1174354680 20:49989954-49989976 CAGCACCTACTGTGGGTGGATGG - Intergenic
1178883084 21:36464033-36464055 CAGTCCCCAGTGTTGGAGGAAGG + Intronic
1179171578 21:38976986-38977008 CTGCTCCCACACTTGGGGGAGGG + Intergenic
1179874258 21:44259651-44259673 CAGCACCCTCTGTTTGAGGGAGG - Exonic
1180708394 22:17823348-17823370 TAGGAACCTCAGTTGGAGGAGGG + Intronic
1182657523 22:31902594-31902616 CACCACCCACTGTTAGTGGAAGG - Intronic
1182753545 22:32660470-32660492 CAGCACCCTGTGTTGGTGGAGGG + Intronic
1182883793 22:33756204-33756226 CAGTACTCAAAGTCGGAGGAGGG + Intronic
1183333549 22:37234167-37234189 CTGCCCCCACAGCTGGCGGAAGG + Intronic
1183337814 22:37260646-37260668 GACCACCCAGAGCTGGAGGATGG - Intergenic
1184782514 22:46656282-46656304 CAGCACCCCCAGTGGGAGTGGGG + Intronic
1184832151 22:46995743-46995765 CAGAATCCGCAGGTGGAGGAAGG - Intronic
1184920614 22:47603267-47603289 CAGCCCCCAGTGTTGGAGGTGGG + Intergenic
1184920636 22:47603345-47603367 CAGCCCCCAGTGTTGGAGGTGGG + Intergenic
1184920658 22:47603423-47603445 CAGCCCCCAGTGTTGGAGGTGGG + Intergenic
1184920680 22:47603501-47603523 CAGCCCCCAGTGTTGGAGGTGGG + Intergenic
1185045435 22:48526225-48526247 CACCACACACAGACGGAGGAGGG - Intronic
1185228762 22:49668249-49668271 CAGCACACGCAGGTGGAAGAAGG + Intergenic
949492163 3:4599704-4599726 CAGCAGCCACTGTCGGAGTAGGG - Intronic
949962052 3:9320329-9320351 CAGTACCCAATGTTGGAGGTGGG + Intronic
950025197 3:9815479-9815501 CACCTCCCAGAGTTGTAGGAAGG + Intronic
950401749 3:12774333-12774355 CAGAACCAAAAGGTGGAGGAAGG - Intergenic
953914428 3:46909387-46909409 ACGCACCCACAGTTCAAGGAGGG + Intergenic
958472715 3:94541772-94541794 GAACACCCACAGGTTGAGGAAGG + Intergenic
961562400 3:127739832-127739854 CTGCATGCACACTTGGAGGATGG - Intronic
962365369 3:134775542-134775564 CAATACTCACAGCTGGAGGATGG + Intronic
965751060 3:171975461-171975483 GAGCAGCCAGAGATGGAGGAGGG + Intergenic
966847980 3:184145184-184145206 CAGGCCCGGCAGTTGGAGGAAGG + Exonic
968057799 3:195705914-195705936 CACTCCCCACAGTTAGAGGAAGG - Intergenic
969598414 4:8161696-8161718 CCACACCCACACTTGGAGCACGG + Intergenic
970491865 4:16583083-16583105 CAGCTCTCACCGTTGGAGGGAGG - Intronic
970575675 4:17424617-17424639 CAGCACCAAGACTTGCAGGATGG - Intergenic
971466419 4:26967825-26967847 TAACCCCCACTGTTGGAGGAGGG - Intronic
974877646 4:67717643-67717665 CAGAAACCACACTCGGAGGAGGG - Intergenic
976278734 4:83305677-83305699 CACCAGATACAGTTGGAGGAAGG + Intronic
977680904 4:99797854-99797876 CAGGACCCACAGCTGCAGGTCGG + Intergenic
977932015 4:102759979-102760001 CAGCAAAAGCAGTTGGAGGATGG + Intronic
983813138 4:172089326-172089348 AAGCATCTTCAGTTGGAGGAGGG + Intronic
985657957 5:1141957-1141979 CAACAGCCACAGTTGGTGGCTGG - Intergenic
985750346 5:1670011-1670033 CAGCACTCTCAGCTTGAGGAAGG + Intergenic
986905032 5:12485771-12485793 TAATACCCATAGTTGGAGGAGGG + Intergenic
987374148 5:17218256-17218278 CAGCAGCCAAAGATGGAGGGTGG + Intronic
988544722 5:32144731-32144753 CAGCATCCACAGTGGAAGAACGG + Intronic
992041454 5:72837323-72837345 CAGCATCCTCACATGGAGGAAGG + Intronic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
992139234 5:73779642-73779664 AAGCACCCAAGGATGGAGGAGGG - Intronic
992144764 5:73835081-73835103 CAGCATCCACGGAAGGAGGAGGG + Intronic
993877939 5:93329882-93329904 CAGAAGCCAGAGTTGGGGGATGG - Intergenic
995182812 5:109244818-109244840 CAGAACCCAGAATTGCAGGAAGG - Intergenic
995891887 5:116963217-116963239 CAGCAGTCACAGCTGGAGAAGGG - Intergenic
996330022 5:122318109-122318131 CTGCACCCACAGGAGGAGGCAGG - Intronic
997539432 5:134649161-134649183 CAGCACTCACCGTTGGTGTAGGG - Exonic
998354354 5:141522383-141522405 CAGAACTCACAGGTGGAGGAAGG - Intronic
999240438 5:150124487-150124509 GAGCACCCACACTCTGAGGAGGG + Intronic
1000046210 5:157523986-157524008 CAGGAACAGCAGTTGGAGGAAGG - Intronic
1000319088 5:160119405-160119427 CTGCAGCCGGAGTTGGAGGAGGG - Exonic
1001092175 5:168749663-168749685 CCGCTCCCACAGTAGAAGGATGG - Intronic
1002322304 5:178383148-178383170 CTGCACCCAGAGCTGGAGGAGGG - Intronic
1003806474 6:9730643-9730665 CAGCCTCTATAGTTGGAGGAGGG - Intronic
1004506392 6:16250209-16250231 CACCACCTCCAGATGGAGGAGGG + Intronic
1004854326 6:19734064-19734086 CAGCACCCACGGTGGGACAAAGG + Intergenic
1004950716 6:20668107-20668129 CAGGATACACAATTGGAGGAAGG - Intronic
1006088900 6:31616245-31616267 CACCTACCACAGTGGGAGGAAGG + Intronic
1006521168 6:34572081-34572103 CAGCCCCCACAGCGGGAGGGAGG + Intergenic
1007112390 6:39320394-39320416 CAGCACCCTCAGCAGGATGAGGG - Intronic
1007224789 6:40305399-40305421 CTGCACCCAGCATTGGAGGAAGG + Intergenic
1010138881 6:72589110-72589132 CACCACACACAGGTTGAGGAAGG + Intergenic
1010620306 6:78065208-78065230 CAGCACGGAAAGTTGGAGGCAGG - Intergenic
1012472889 6:99590785-99590807 AAGCTCGCACAGTGGGAGGAAGG - Intergenic
1018942095 6:168315250-168315272 CAGCGCCCACTGGTGAAGGATGG + Intronic
1021680840 7:23129595-23129617 CAATACCCACAGTTTGGGGACGG - Intronic
1022526754 7:31043030-31043052 CTGAGCCCACAATTGGAGGAGGG + Intergenic
1024598876 7:50962420-50962442 CAGCACCCAGAGGGTGAGGAGGG + Intergenic
1026111926 7:67465314-67465336 CAGCAGCAACAGCTGGAGCATGG + Intergenic
1026889984 7:73976175-73976197 CAGCAACCATAGCTGAAGGAGGG - Intergenic
1033171241 7:139086404-139086426 CAGTACCCACAATTAGAGGGTGG - Intronic
1034453140 7:151148602-151148624 CAGCACCAACAAATGGAGCAGGG - Exonic
1035033638 7:155881209-155881231 CAGCACCTACAATTTCAGGATGG + Intergenic
1035113666 7:156505415-156505437 AAGCACCCACAGCGTGAGGAAGG - Intergenic
1035251795 7:157602721-157602743 CAGCAGCCACTGATGGTGGAGGG - Intronic
1035700609 8:1637002-1637024 CAGCACCCCAGGTTGGAGGGAGG + Intronic
1035737985 8:1902675-1902697 CAGCGGCCACAGTCGCAGGAGGG + Intronic
1036796864 8:11762476-11762498 CAGCAGCCACAGCGGTAGGACGG - Exonic
1037465826 8:19159180-19159202 CAGCAGCCAAAGCTGGATGATGG + Intergenic
1037768820 8:21787407-21787429 CGGCCCCCAGAGGTGGAGGAGGG + Intronic
1038439004 8:27558757-27558779 CAGCACCCTGGGCTGGAGGAGGG - Intergenic
1039625853 8:39051584-39051606 CAGCACTGCCTGTTGGAGGAAGG + Intronic
1040616568 8:49043505-49043527 CAGCACCTACAGAAGGAGAAGGG + Intergenic
1042343424 8:67703967-67703989 TAGCACCCACTTTGGGAGGAAGG + Intronic
1042613137 8:70619576-70619598 CAGCAATCACAGATAGAGGAAGG + Intronic
1047756972 8:127926440-127926462 AAGCAGCTCCAGTTGGAGGAAGG - Intergenic
1049541822 8:143212133-143212155 CAGAACCCACAGCCGGGGGAAGG + Intergenic
1049635924 8:143689413-143689435 CAGGACCCACTGTGGCAGGAGGG + Intronic
1054764957 9:69035736-69035758 CAGCACCCAGCGCTGGAGGGCGG + Exonic
1055014034 9:71596423-71596445 CAGGACCCTCAGTTGCAGGTTGG - Intergenic
1056906050 9:90648756-90648778 CAGCAGCCCCAGTAGGAGGAGGG - Intergenic
1059523024 9:114961741-114961763 CACCAGGCACAGTTGGAAGAAGG + Intergenic
1060192682 9:121603091-121603113 CAGAGGCCACAGTAGGAGGATGG - Intronic
1060785884 9:126451386-126451408 CTGCACCTCCAGGTGGAGGAGGG + Intronic
1062391282 9:136334921-136334943 CAGCAGTTACAGTTTGAGGAGGG + Intronic
1062532035 9:137006288-137006310 CAGCCCCTACAGTTGCAGGACGG + Intergenic
1187849883 X:23581462-23581484 CATCACCCACTGTTGGGTGAAGG + Intergenic
1189175796 X:38955997-38956019 CAGCACACACTGTTGGTGGCTGG + Intergenic
1190180171 X:48185157-48185179 CAGCAGCCCCAGGTGGAGGCAGG - Intergenic
1192247263 X:69384114-69384136 CAGCACTCACAGCTGGGAGATGG - Intergenic
1193092172 X:77505974-77505996 CAGCAGCCAAAGCTGGATGATGG + Exonic
1194014726 X:88605112-88605134 CAGCCTGCACACTTGGAGGAAGG + Intergenic
1200142882 X:153910496-153910518 CAGCACTCACTGGTTGAGGAAGG + Exonic