ID: 1121284962

View in Genome Browser
Species Human (GRCh38)
Location 14:92727874-92727896
Sequence CATGGTTTGCAAGGGGTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121284962 Original CRISPR CATGGTTTGCAAGGGGTGTA GGG (reversed) Intronic
900579370 1:3400960-3400982 CTTGGTTGGCAAGGGGTGGGTGG + Intronic
902232678 1:15037546-15037568 CATGGAAAGCAAGGGGGGTAGGG + Intronic
906805157 1:48773631-48773653 CATGATTTGGAAGGAGTGAAAGG - Intronic
913070738 1:115296194-115296216 CATGCATTGCAAGAGGAGTAGGG + Intronic
916552832 1:165865396-165865418 CATGCTTTGCAGGGGGTGGAGGG - Intronic
916755411 1:167764961-167764983 CAGTGTTTGCCAGGGGTGTGGGG + Intronic
922772726 1:228196363-228196385 CAGGGTCTGCAGGGGGAGTAGGG - Intergenic
923047255 1:230364433-230364455 CATGTTTTCTAAGGGCTGTACGG - Intronic
923920484 1:238558868-238558890 CATGGTGTGGTAGGGGTGCATGG + Intergenic
1064928460 10:20596445-20596467 TATTGTTTTCAAGGGGTTTATGG - Intergenic
1067792934 10:49301411-49301433 CTTGGTTTCCAAGGGTTGCATGG + Intronic
1069222690 10:65903925-65903947 CAGGGTGTGCAATGGGTGTGTGG - Intergenic
1069954506 10:72041760-72041782 CCTGGCTTGCAAGGGGTGCCTGG + Intergenic
1073266293 10:102230400-102230422 CAGGGTCTGAAAGGGGTGTTTGG - Exonic
1076386744 10:130062567-130062589 AGTGGTTTGCAAGGGCTGTTGGG + Intergenic
1079929659 11:26542261-26542283 CAGGCTTTGCAAGGTGTCTAAGG + Intronic
1081677993 11:44982116-44982138 TATTGTTTGCAGGGGGTGTCTGG - Intergenic
1082248303 11:49951090-49951112 CATGCTTTGCAAGGGGATCAAGG + Intergenic
1086221297 11:84446860-84446882 TATGGTATCCCAGGGGTGTATGG - Intronic
1089215941 11:116834817-116834839 CATGGATGGCCAGGGGTGCAGGG + Intergenic
1089809990 11:121123891-121123913 CCAGGATTACAAGGGGTGTAGGG - Intronic
1091116196 11:133015932-133015954 CTTGGTATGCTAGGGGTGAAGGG - Intronic
1092044718 12:5422841-5422863 CATGGTTAGCAAGGAGTCTGTGG - Intergenic
1095309059 12:40674483-40674505 GATGGTTTGGAAGAGGTGGAGGG - Intergenic
1098787473 12:74778291-74778313 CATCTTTTGTAAGGGGTGCAAGG - Intergenic
1102681437 12:114693078-114693100 TTTGGCTTGCAAGGGGTGAATGG - Intergenic
1104973770 12:132542975-132542997 CAGGGTCTGGAAGGGGTGCAGGG + Intronic
1105612225 13:21978304-21978326 CACATTCTGCAAGGGGTGTAGGG + Intergenic
1108712234 13:53044879-53044901 GAGGATTTGCAAGGGGTGTTGGG - Intronic
1109204617 13:59467337-59467359 CATCCTCTGCAAGGGGGGTAAGG + Intergenic
1115862561 14:37704421-37704443 CATAGTTTGACAAGGGTGTAAGG - Intronic
1117756528 14:58980010-58980032 CATGGTTAGCAAGAGGAGGAAGG - Intergenic
1119225765 14:72943578-72943600 CATCATTTGCAGGGGGTGAAAGG + Intronic
1119716311 14:76862029-76862051 CCTGTTTTGCAAGGGGAGCAGGG + Intronic
1121284962 14:92727874-92727896 CATGGTTTGCAAGGGGTGTAGGG - Intronic
1202840766 14_GL000009v2_random:119089-119111 TAAGGGTTCCAAGGGGTGTATGG - Intergenic
1202910149 14_GL000194v1_random:109283-109305 TAAGGGTTCCAAGGGGTGTATGG - Intergenic
1123991083 15:25683803-25683825 CAAGGTTTCACAGGGGTGTAGGG + Intronic
1128027390 15:64449829-64449851 CATGGTTTGCAAAAGATATAAGG - Intronic
1128066382 15:64767314-64767336 CATGGTTTGCCAGAGGCGTGTGG + Intronic
1128833269 15:70788592-70788614 CATAGTTTACAAGAGGTCTAGGG - Intergenic
1130610060 15:85353015-85353037 CTAGATTTGCAAGGGGTCTATGG + Intergenic
1132354190 15:101159252-101159274 CATGCTTTGTGGGGGGTGTAGGG - Intergenic
1132657744 16:1048443-1048465 CATGGTTTTTAAGGGGGGCAGGG - Intergenic
1133072659 16:3256827-3256849 CAGGGTTTGGGAGGGGTGTGGGG - Intergenic
1137681770 16:50353504-50353526 CATTATTTGCAAAGGGTTTATGG - Intronic
1138021354 16:53484661-53484683 CATGGTTGCCAAGGGTTGTGGGG + Intronic
1144281765 17:13733781-13733803 CCTAGATTGCAAAGGGTGTATGG + Intergenic
1148103213 17:45105278-45105300 CACGGTTTGCCAGGAGGGTAGGG + Intronic
1153118802 18:1694676-1694698 CATTGTTTCCAATGGATGTATGG - Intergenic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1153613170 18:6908483-6908505 CAAGCTTTGCAAGGTGTCTAAGG - Intronic
1155778075 18:29793845-29793867 CATGCCCTGCAAGGGGTATAAGG - Intergenic
1155925745 18:31653036-31653058 CATGATTTTCAAAGGGTCTAGGG - Intronic
1157100654 18:44725905-44725927 TATGGTTAGAAAAGGGTGTAGGG + Intronic
1157245828 18:46054328-46054350 CATTGGTTGCCAGGGGTTTAAGG + Intronic
1157682613 18:49618820-49618842 ACTGGCTTGCAAGGGGTGTGGGG + Intergenic
926962828 2:18377655-18377677 CATAGTTTGCAAGTGAAGTAAGG + Intergenic
931141414 2:59462511-59462533 CATGGTGAGCAAGGGGTGGTGGG - Intergenic
933354387 2:81195453-81195475 CATGGGGGGCAAGGGGTGTCGGG + Intergenic
934553860 2:95277376-95277398 CAAGGTTTGCAGGTGGTGCACGG - Exonic
937686590 2:124704786-124704808 CATGGTTTAACTGGGGTGTAGGG - Intronic
937854402 2:126661911-126661933 CAGGGTGTGCCAGGGGTGCAGGG - Intronic
939899241 2:147829674-147829696 AATGGTTGTCAAGGGATGTAGGG + Intergenic
940205298 2:151195554-151195576 CATGGTGTGTAGGGGGTGTGTGG + Intergenic
941116562 2:161479561-161479583 CAGGGTTTGCGAGGACTGTAAGG - Intronic
948692029 2:239712102-239712124 CATGGTTGGCAGTGGGGGTAGGG + Intergenic
948755073 2:240154874-240154896 CATAGTGTGGAAGGGGAGTAGGG + Intergenic
1169721462 20:8681997-8682019 CCTGGGTTTCAAGGGGTGAATGG + Intronic
1171779989 20:29409839-29409861 CCCGGTTTGCAAGGGGTCTCGGG + Intergenic
1173180960 20:40805999-40806021 TAGTGTTTGCAAGTGGTGTATGG - Intergenic
1174368968 20:50073504-50073526 CATGGCTGGCAATGGGTGTAAGG + Intergenic
1175172215 20:57088761-57088783 CATGGGTGGGAAGGGGTGGACGG + Intergenic
1175897506 20:62345928-62345950 CAAGGGTGGCAGGGGGTGTAGGG - Intronic
1176629500 21:9123983-9124005 TAAGGGTTCCAAGGGGTGTATGG - Intergenic
1177000945 21:15612461-15612483 CATTTTTTGTGAGGGGTGTAAGG - Intergenic
1181017874 22:20081424-20081446 CAGGGTTTGCATGCGGTGTTTGG + Intronic
1182920889 22:34077778-34077800 CAGGGTTTGTTAGGGGTGTGGGG - Intergenic
1183332102 22:37227401-37227423 TATGGTGTGGGAGGGGTGTATGG - Intronic
950521626 3:13501095-13501117 CATGGCTGGCAAAGGGAGTAGGG + Intronic
954847812 3:53575081-53575103 CATGGTTGGCCTGGGGTGTTTGG + Intronic
957288944 3:78251899-78251921 AATGTTTTTCAAGGGGTGAAAGG + Intergenic
960441667 3:117696448-117696470 CATTGTTTACAAGGGGTCAAAGG - Intergenic
960808208 3:121604408-121604430 CATGTTTTGCATGGAATGTAGGG - Intronic
962095003 3:132284490-132284512 CATGCTTGGCAAGGGGGGGAGGG + Intronic
964307972 3:155361342-155361364 CATGGTGTGCGATGGGTGTGTGG + Intergenic
967868606 3:194211132-194211154 ACTGGTTTGCAAGGAGTGCATGG + Intergenic
969274510 4:6125869-6125891 CATGGTGTGTATGGAGTGTATGG - Intronic
971851921 4:31995164-31995186 CATGCTTTGAAGGGGGTGGAGGG + Intergenic
975397809 4:73897527-73897549 CTTGGTTTGTATGGGGTGTAAGG + Intergenic
976000341 4:80367027-80367049 CATGGTTTCCAAGGACTGGATGG + Intronic
980557453 4:134428087-134428109 CATGTTTTGAAAAGGGAGTAGGG + Intergenic
980840693 4:138256909-138256931 TATGGTCTGCAAGTGGTGAAAGG - Intergenic
983741148 4:171136033-171136055 CATAGTGTGCAATGGGTCTACGG + Intergenic
985445824 4:190020900-190020922 CCTGGTTTGCACGGGGTCTCGGG + Intergenic
986519295 5:8596589-8596611 GGTGGTTTGCAAGGGATGGAGGG - Intergenic
989156306 5:38347894-38347916 CTTGGTCTTCAAGGGCTGTAAGG + Intronic
989406258 5:41064518-41064540 CATGGTTTGCATGGTGAGCAGGG + Exonic
990295526 5:54397969-54397991 AATGGTTTTCAAGGTGTGTGGGG - Intergenic
992906137 5:81347838-81347860 GATGGTTTGCATGGGGTGGGAGG + Exonic
998607553 5:143650374-143650396 AATGGTTTGCAAGAGCTATAAGG + Intergenic
999785095 5:154883599-154883621 CTGGGTTTGGAAGGGGTGGATGG - Intergenic
1003435960 6:6088294-6088316 AAAGGTTTGCAAGAGGTGCAAGG + Intergenic
1007076999 6:39074454-39074476 CATGTTTTCCCAGGGGTGAAGGG - Intronic
1010514729 6:76759487-76759509 CTTGGTGTGCTAGGGGTCTAGGG + Intergenic
1013478146 6:110528871-110528893 CATGGTTTGCATGTGATGTTGGG - Intergenic
1014320140 6:119917669-119917691 CATGGTTTCCATGGTGTGAAAGG - Intergenic
1014924039 6:127249461-127249483 CATGCTTTCCAATGGATGTATGG + Intergenic
1016050765 6:139527799-139527821 CATTGTTTGCCAGGGGTGACAGG + Intergenic
1023623717 7:42096490-42096512 CATGGTTTAAAAGGGGAGCAGGG + Intronic
1029320721 7:99757038-99757060 GATGGAATGCAAGAGGTGTAGGG + Intronic
1036177479 8:6552933-6552955 CAGGGTTTGCCAGGGGTTAAGGG + Intronic
1036258488 8:7222829-7222851 CATGGTGGGCAAGGGGAGGAAGG + Intergenic
1036308132 8:7616679-7616701 CATGGTGGGCAAGGGGAGGAAGG - Intergenic
1036310543 8:7681425-7681447 CATGGTGGGCAAGGGGAGGAAGG + Intergenic
1036358988 8:8064680-8064702 CATGGTGGGCAAGGGGAGGAAGG - Intergenic
1037224116 8:16563439-16563461 CATGTTTTTAAAGGGCTGTAAGG - Intronic
1037552960 8:19992821-19992843 TCTGGTTTGGGAGGGGTGTAGGG + Intergenic
1040288233 8:46111245-46111267 CATGGCTTGTGAGGGGTGTGGGG - Intergenic
1042204696 8:66317427-66317449 CATGGTTGCCAAGGGTTGTGGGG + Intergenic
1042334323 8:67614307-67614329 CATGGTCTGCAAGGGGGATCAGG + Intronic
1043238402 8:77899351-77899373 CAGGGTGTGCAATGGGGGTATGG + Intergenic
1047282868 8:123461001-123461023 CAGTGTTTGCAGGTGGTGTATGG + Intronic
1049230474 8:141478970-141478992 CATGGTTTGGGTGGGGTGTTAGG + Intergenic
1049643044 8:143723976-143723998 CATGGTTTAGAAGAGGTGGAGGG + Exonic
1053465046 9:38300317-38300339 AATTGATTGCAAAGGGTGTAAGG + Intergenic
1053478465 9:38398890-38398912 TATGGTTTGGAAGGGGTGGGGGG - Intergenic
1056318895 9:85418254-85418276 CAGGGTCTGCAATGGGTGTTCGG - Intergenic
1058543220 9:106033788-106033810 CATGGGTTCCCAGGGCTGTATGG + Intergenic
1062307702 9:135919030-135919052 CAGGGTCTCCAAGGGGTGTTTGG + Intergenic
1203752337 Un_GL000218v1:91662-91684 TAAGGGTTCCAAGGGGTGTATGG - Intergenic
1187115810 X:16349212-16349234 CATGGTTTGCAAGGTCTACATGG + Intergenic
1187292735 X:17970635-17970657 CATGGTTTGCAGAGAGAGTAGGG - Intergenic
1193283917 X:79689257-79689279 CATGGTTGGAAATGGGGGTAGGG - Intergenic
1195029103 X:100909123-100909145 CACGGTTTGAAAGGTGTGTAAGG + Intergenic
1200043978 X:153390364-153390386 CATGGTGTGCATGGTGTGTGTGG - Intergenic
1200044054 X:153391235-153391257 CATGGTGTGCATGGTGTGTGTGG - Intergenic
1200044066 X:153391369-153391391 CATGGTGTGCATGGTGTGTGTGG - Intergenic
1200044079 X:153391492-153391514 CATGGTGTGCATGGTGTGTGTGG - Intergenic
1200044082 X:153391523-153391545 CATGGTGTGCATGGTGTGTGTGG - Intergenic