ID: 1121285633

View in Genome Browser
Species Human (GRCh38)
Location 14:92733370-92733392
Sequence GAATATCCAGAAAGGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 142}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121285629_1121285633 1 Left 1121285629 14:92733346-92733368 CCAAGTCATGCATATAAAATAAA 0: 1
1: 0
2: 1
3: 48
4: 450
Right 1121285633 14:92733370-92733392 GAATATCCAGAAAGGGCTCTGGG 0: 1
1: 0
2: 2
3: 16
4: 142
1121285627_1121285633 20 Left 1121285627 14:92733327-92733349 CCCAATCTTCACTACAAGTCCAA 0: 1
1: 0
2: 0
3: 16
4: 548
Right 1121285633 14:92733370-92733392 GAATATCCAGAAAGGGCTCTGGG 0: 1
1: 0
2: 2
3: 16
4: 142
1121285626_1121285633 23 Left 1121285626 14:92733324-92733346 CCTCCCAATCTTCACTACAAGTC 0: 1
1: 0
2: 1
3: 44
4: 353
Right 1121285633 14:92733370-92733392 GAATATCCAGAAAGGGCTCTGGG 0: 1
1: 0
2: 2
3: 16
4: 142
1121285625_1121285633 28 Left 1121285625 14:92733319-92733341 CCATACCTCCCAATCTTCACTAC 0: 1
1: 0
2: 0
3: 9
4: 185
Right 1121285633 14:92733370-92733392 GAATATCCAGAAAGGGCTCTGGG 0: 1
1: 0
2: 2
3: 16
4: 142
1121285628_1121285633 19 Left 1121285628 14:92733328-92733350 CCAATCTTCACTACAAGTCCAAG 0: 1
1: 0
2: 0
3: 22
4: 555
Right 1121285633 14:92733370-92733392 GAATATCCAGAAAGGGCTCTGGG 0: 1
1: 0
2: 2
3: 16
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121285633 Original CRISPR GAATATCCAGAAAGGGCTCT GGG Intronic
902250314 1:15150737-15150759 GAGCATCCAGAAGGAGCTCTTGG - Intergenic
902937419 1:19774207-19774229 TTATATACAGAAAGGGCTCAGGG + Intronic
907868636 1:58423138-58423160 GGACAACCAGATAGGGCTCTGGG - Intronic
908565647 1:65353234-65353256 GAAGAAACAGAAAGGGTTCTGGG - Intronic
909332229 1:74427240-74427262 GAATATTCAGAAAGGTGGCTAGG + Intronic
910791379 1:91054642-91054664 GAATCTCCATAAAGGGGTCCTGG + Intergenic
911161112 1:94683960-94683982 GGATCTGCAGAAAGGGCTCTGGG + Intergenic
913117832 1:115713114-115713136 GGATATCCTCAAAGGGCACTGGG - Intronic
914395341 1:147261690-147261712 GAATAACAAGAAAAGGCTCTGGG - Intronic
914993495 1:152518441-152518463 GAATATTCAGAAGTGGCTGTTGG - Intronic
915332916 1:155124789-155124811 GAATTTCCAGAAAGGACTCATGG + Intergenic
915648283 1:157289440-157289462 GAACATCCAGAGTGGGCTTTGGG - Intergenic
915662394 1:157415061-157415083 GAACATCCAGAGTGGGCTTTGGG + Intergenic
916628737 1:166588795-166588817 ATATATCCAGGAAGGGCTCGAGG - Intergenic
917858533 1:179122547-179122569 GATTATCCAGAGAGAGATCTTGG - Intronic
924013008 1:239686536-239686558 AAATATGAAGGAAGGGCTCTGGG - Intronic
924266696 1:242289931-242289953 TTATAACCAGAATGGGCTCTGGG + Intronic
1065653642 10:27922300-27922322 GAATCTTCAAAAAGGGCTCAGGG - Intronic
1066718138 10:38308626-38308648 TTATAACCAGAATGGGCTCTGGG - Intergenic
1068310258 10:55265839-55265861 GAAGTTCCAGAAATGGCCCTGGG + Intronic
1068721621 10:60252184-60252206 GAATATACAGAAAGGGCAAAGGG - Intronic
1072645740 10:97251846-97251868 AAATATCCAGAAAGGGCACCAGG + Intronic
1073853155 10:107644610-107644632 TAATACCCAGCAAGGACTCTGGG - Intergenic
1074208502 10:111305526-111305548 TAATATCCAGAATGGGCAATGGG + Intergenic
1074324507 10:112435971-112435993 GAGTATCCAGGAAGGGTCCTTGG + Intronic
1075374402 10:121966525-121966547 GAACATACACAAATGGCTCTGGG + Intronic
1075541485 10:123317904-123317926 GAATTTGCAGACTGGGCTCTGGG - Intergenic
1079366813 11:19816959-19816981 GTAGATCCAGAGAGGGCTCCAGG - Intronic
1082178729 11:49092613-49092635 CAGTATACAGAAAGGCCTCTAGG + Intergenic
1084241818 11:67826458-67826480 GCATAGCCAGACAGGGCTGTGGG - Intergenic
1086138725 11:83470667-83470689 CAATTCCCAGCAAGGGCTCTGGG - Intronic
1086699949 11:89889850-89889872 CAGTATACAGAAAGGCCTCTAGG + Intergenic
1086706221 11:89954666-89954688 CAGTATACAGAAAGGCCTCTAGG - Intergenic
1087211922 11:95453692-95453714 GCATTCCAAGAAAGGGCTCTTGG - Intergenic
1087530753 11:99378621-99378643 GAAAATCAAGAAAGGGCTCTTGG - Intronic
1088533624 11:110837026-110837048 GGATGTCCAGAAAGCACTCTAGG + Intergenic
1088768110 11:113005022-113005044 GAACATCAAGAAAGAGCTCTTGG - Intronic
1089629045 11:119772361-119772383 TTAGAACCAGAAAGGGCTCTGGG + Intergenic
1092457171 12:8654364-8654386 CACTATCCAGAATGGGCTCTGGG + Intronic
1093222976 12:16446197-16446219 GAATATCCAGATATTGCTATTGG - Intronic
1093766650 12:22971165-22971187 GAAAATCCTGAGATGGCTCTTGG - Intergenic
1095329162 12:40936991-40937013 GACAATACAGAAAGGGCACTTGG + Intronic
1097975911 12:65685728-65685750 AAATTTCCAAAAAGGCCTCTAGG - Intergenic
1100450834 12:94705028-94705050 AAATGGCCAGAAAGGGCTTTTGG - Intergenic
1106090404 13:26587386-26587408 GAAACTACAGAAATGGCTCTTGG + Intronic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1107788589 13:43978392-43978414 TAATTTCCAGAAAGGGTCCTTGG - Intergenic
1112719016 13:102221093-102221115 GAAAAGCAAGCAAGGGCTCTTGG - Intronic
1114451469 14:22829211-22829233 CAATATCCTGATAGAGCTCTCGG - Intronic
1121285633 14:92733370-92733392 GAATATCCAGAAAGGGCTCTGGG + Intronic
1126107666 15:45157442-45157464 GACAAATCAGAAAGGGCTCTGGG - Intronic
1127988939 15:64096648-64096670 TAAGATCCAGAAAGGGCCTTTGG - Intronic
1128875463 15:71197809-71197831 GAATATCCTTACTGGGCTCTGGG + Intronic
1128882364 15:71255558-71255580 GCATTTCCAGAAAGATCTCTGGG + Intronic
1130443426 15:83977406-83977428 GAAGTTCCAGAAAGAGATCTAGG + Intronic
1131880246 15:96854525-96854547 CAAAATCCAGAAAGAGCTTTGGG - Intergenic
1134148482 16:11787033-11787055 CTATATCCTGATAGGGCTCTGGG - Intronic
1135206213 16:20486420-20486442 GAAGCTTCAGAAAGTGCTCTGGG - Intronic
1135482061 16:22828968-22828990 AAATAACCAGAAATGACTCTGGG + Intronic
1135487502 16:22878987-22879009 GAATATGTAGACAGGGCTTTCGG - Intronic
1135660352 16:24291318-24291340 CAATATCCAGCAAGGGTTGTGGG - Intronic
1135786155 16:25351090-25351112 GGATATGGAGAAAGGGCTCTGGG - Intergenic
1139559904 16:67735309-67735331 TGAGTTCCAGAAAGGGCTCTTGG - Intronic
1140123981 16:72105361-72105383 GAATGTCCAGGAGTGGCTCTTGG + Intronic
1149068048 17:52503806-52503828 GAAAAGCCAGAAAGAGCCCTGGG + Intergenic
1151469368 17:74308514-74308536 TAAAATAAAGAAAGGGCTCTGGG - Intronic
1154948217 18:21183317-21183339 GAATCTGCAGAAAAGGCTCTGGG - Intergenic
1156210940 18:34941806-34941828 GAACATCTTGAAAGGGCTCCTGG + Intergenic
1157605144 18:48921794-48921816 AGATATCCAGAGAGGGCTCCTGG + Exonic
1159500675 18:69265202-69265224 GAATTTCAAGAAAGATCTCTTGG - Intergenic
1160656574 19:275088-275110 GAGTGTCCAGAAAGAGATCTTGG - Intergenic
1161351858 19:3797605-3797627 AAAGAACCAGAAAGAGCTCTTGG - Intronic
1161370262 19:3907513-3907535 GAATGTCCAGAAAGGCTTCCTGG + Intronic
1161463622 19:4414507-4414529 GTATATCCAGAGAGATCTCTAGG + Intronic
1163487115 19:17594554-17594576 GAAAAGCCAGAAAGGGGTCAGGG - Intergenic
1164710668 19:30354925-30354947 GAAAGTCCAGAAAAGGCTCTGGG - Intronic
1165043025 19:33082293-33082315 GAGTGTCCAGTAAGGGCTGTTGG + Intronic
1166225399 19:41392033-41392055 AAATTCCCAGAAAGGGCTCACGG + Intronic
927436639 2:23072126-23072148 GTATTTCCAGGAAGGCCTCTGGG - Intergenic
927490012 2:23515119-23515141 AAATATCCAGAAAGTGATTTGGG - Intronic
928125683 2:28614223-28614245 GAATGTACAGAAAAGGCTCCCGG + Intronic
930241330 2:48938385-48938407 GAGTATGCACACAGGGCTCTGGG + Intergenic
930966148 2:57329835-57329857 GATTAGCCAGAAATGGCACTTGG - Intergenic
931468002 2:62508654-62508676 GAATCTCCAAAAAGGCTTCTAGG + Intronic
934581181 2:95440766-95440788 CAGTATACAGAAAGGCCTCTAGG - Intergenic
934598269 2:95635948-95635970 CAGTATACAGAAAGGCCTCTAGG + Intergenic
942931496 2:181499510-181499532 GAAATCCCAGAAAGGGCTCCTGG - Intronic
944464163 2:199983586-199983608 GCATATCCAGTGAGGGCTGTGGG + Intronic
946963755 2:225013833-225013855 GAAAATCCATCATGGGCTCTGGG + Intronic
1171267395 20:23782851-23782873 AAATATCCAGCAAGGGCCCTGGG - Intergenic
1172540066 20:35705806-35705828 AAAGATACAGATAGGGCTCTGGG + Intronic
1175087775 20:56474718-56474740 AAATCTGCAGAAAAGGCTCTTGG + Exonic
1175837341 20:62004620-62004642 GAAAATTCAGAAAGGGAGCTGGG - Intronic
1177303199 21:19277312-19277334 GAAAATCCAGCAAGGTCTGTCGG + Intergenic
1177484800 21:21743481-21743503 GAAGATGCAGGAAGGGCTCATGG + Intergenic
1177969069 21:27765863-27765885 AAAGATCAAGAAAGGTCTCTGGG + Intergenic
1179107272 21:38413350-38413372 AAGTATGCAGAGAGGGCTCTTGG - Intronic
1179538765 21:42070487-42070509 AAAACTCCAGAAAGGGCCCTGGG - Intronic
1180954345 22:19734974-19734996 GAAGATTCAGGGAGGGCTCTGGG - Intergenic
951987141 3:28633162-28633184 GAATGGCCAGAGAGGCCTCTTGG + Intergenic
952298420 3:32082361-32082383 GAATAATGAGAAAGAGCTCTTGG + Intergenic
954872466 3:53778114-53778136 GAAAATCCAGAAAGCCTTCTAGG + Intronic
957511758 3:81198271-81198293 AAATATCCACAAAGGGAGCTTGG + Intergenic
958822570 3:98992331-98992353 GAATATCAAGAAAGAGCTATGGG - Intergenic
960517415 3:118617597-118617619 GCCTATACAGAAAGGGCCCTGGG - Intergenic
961358940 3:126355843-126355865 GACAACCCAGAAAGGGCTCTGGG + Intronic
964034983 3:152184622-152184644 AAATCTGCAGGAAGGGCTCTTGG - Intergenic
964326618 3:155553471-155553493 AAATATCCAGAAAGTGATCTAGG + Intronic
965552929 3:169987819-169987841 GAATCTCCAGAGAGGGGTCTTGG + Intronic
970438884 4:16062384-16062406 TAATATACAGAAAGGGGCCTGGG - Intronic
972158152 4:36190679-36190701 GAAAATCAAGAAAAGGCTCATGG + Intronic
974710472 4:65587582-65587604 GAATATCCAGATGGGGGTCGGGG - Intronic
975888824 4:78999567-78999589 TAATATCCTGAAATGGGTCTTGG + Intergenic
976889000 4:90021809-90021831 GAATATCCAGGAAGTGCTCTGGG - Intergenic
979433275 4:120658609-120658631 GAAGAGCCAGAACAGGCTCTGGG + Intergenic
980560554 4:134467992-134468014 GAATAACCAGTAATGCCTCTGGG - Intergenic
986450293 5:7856702-7856724 GCAAATCCAGAGAGGGGTCTTGG - Intronic
993101818 5:83550049-83550071 CAAAATCTAGAAAGGGCTATTGG + Intronic
993937656 5:94023728-94023750 GAATTTCCAGAAACTGCTCCTGG + Intronic
995409277 5:111836341-111836363 GAATATACAGAGAGGGGTGTGGG + Intronic
995642412 5:114272745-114272767 GAATATTCAGTAAGGGAACTGGG - Intergenic
1001564352 5:172689924-172689946 GAATAACAAGAGAGGGCCCTTGG - Exonic
1003501648 6:6708150-6708172 GAATAGCCTGAAAGGGGTCCTGG + Intergenic
1003515606 6:6816021-6816043 GAATATTCAGGAAGGGATCCTGG + Intergenic
1004306874 6:14509154-14509176 GAATATTCACAAACGTCTCTTGG - Intergenic
1004484965 6:16057758-16057780 AAATATCCAGAATGTGCTGTAGG - Intergenic
1005312018 6:24567862-24567884 GCTTGTCCAGAAGGGGCTCTGGG + Intronic
1006354603 6:33547613-33547635 GAAAATGCAGGAAGGCCTCTGGG - Intergenic
1009899466 6:69794090-69794112 GAATCTCCAGAAAGGATTCTGGG - Intronic
1013362596 6:109408078-109408100 GATTCTGCAGAAAGGGCTCATGG + Intronic
1013835836 6:114334193-114334215 AAACATCCAGAAAAGGCTCAAGG - Intronic
1021546928 7:21823963-21823985 GCATATCCTGAACAGGCTCTAGG - Intronic
1021577750 7:22119841-22119863 GAATATCCAGAGAGGGTGCATGG + Exonic
1021754212 7:23835191-23835213 GAATATCCAGTGACAGCTCTGGG + Intergenic
1024173732 7:46816418-46816440 TAGTATCCAGAAAGGGCCTTTGG + Intergenic
1029189834 7:98763880-98763902 GAAAATGTAGGAAGGGCTCTTGG + Intergenic
1031115481 7:117663259-117663281 GAATATGAATAAAGGGCACTGGG - Intronic
1031144617 7:117984161-117984183 GACTATCCAGGAAGGCTTCTTGG + Intergenic
1031341960 7:120613750-120613772 GAAAATACAGAAAGGACTGTAGG - Intronic
1031619241 7:123916241-123916263 GAATATCCAGAAAGAGTTGAGGG + Intergenic
1031829064 7:126603626-126603648 GAATATAGAGAAAGGGCCCAGGG + Intronic
1033277503 7:139983779-139983801 GAGTCACAAGAAAGGGCTCTGGG - Intronic
1033309819 7:140252985-140253007 GAATAAACAGGAAGGTCTCTTGG + Intergenic
1033648136 7:143320818-143320840 GAAACTCCAGAAACGGCTGTGGG - Intronic
1037591007 8:20312064-20312086 GTCCATCCAGAAAGGGCTCTTGG + Intergenic
1042653578 8:71069955-71069977 GAATTTCCAGAAAAGTCTCCAGG - Intergenic
1045547859 8:103143844-103143866 GAAGAGGCAGAAGGGGCTCTAGG - Intronic
1046445837 8:114317950-114317972 AAATATCCAGCAAGGGTTTTTGG + Intergenic
1048294501 8:133204548-133204570 GAATATTCAAAGAGGGATCTAGG + Intronic
1048436419 8:134422862-134422884 TACTTTCCACAAAGGGCTCTGGG + Intergenic
1048972700 8:139654202-139654224 GTATATCCAGCGAAGGCTCTGGG + Intronic
1050608419 9:7325890-7325912 GAACATCCAAGAAGGACTCTGGG + Intergenic
1051616353 9:19010570-19010592 GACTAACAAGAAAGGGCTTTGGG - Intronic
1055123113 9:72685744-72685766 GAATATAGAGAAAATGCTCTTGG - Intronic
1055259505 9:74416474-74416496 GAAAATCCAGCCAGGACTCTAGG + Intergenic
1059393724 9:114017465-114017487 AAATATCCAGAAAAGGAGCTGGG - Intronic
1060797690 9:126523664-126523686 GCATTTCCAGAAACGGGTCTTGG + Intergenic
1186711838 X:12205948-12205970 GAAGTCCCAGAAAGGGCTATAGG + Intronic
1191732523 X:64352487-64352509 GGATCTCAAGAAAGAGCTCTGGG - Intronic
1192798413 X:74443582-74443604 CAGTATCCAGAAGGTGCTCTGGG + Intronic
1198216816 X:134562981-134563003 GAAGATCCAGGAAGGTTTCTTGG - Intergenic