ID: 1121291485

View in Genome Browser
Species Human (GRCh38)
Location 14:92779510-92779532
Sequence GACCAGCCAAGCAAGCACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121291485_1121291489 -5 Left 1121291485 14:92779510-92779532 CCCTGGTGCTTGCTTGGCTGGTC No data
Right 1121291489 14:92779528-92779550 TGGTCCCACTTGGGTTTTCAAGG No data
1121291485_1121291493 7 Left 1121291485 14:92779510-92779532 CCCTGGTGCTTGCTTGGCTGGTC No data
Right 1121291493 14:92779540-92779562 GGTTTTCAAGGTGCTGAACTGGG No data
1121291485_1121291494 19 Left 1121291485 14:92779510-92779532 CCCTGGTGCTTGCTTGGCTGGTC No data
Right 1121291494 14:92779552-92779574 GCTGAACTGGGACTTGCTGCTGG No data
1121291485_1121291492 6 Left 1121291485 14:92779510-92779532 CCCTGGTGCTTGCTTGGCTGGTC No data
Right 1121291492 14:92779539-92779561 GGGTTTTCAAGGTGCTGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121291485 Original CRISPR GACCAGCCAAGCAAGCACCA GGG (reversed) Intergenic