ID: 1121308518

View in Genome Browser
Species Human (GRCh38)
Location 14:92922691-92922713
Sequence AATATCTAGGAGGCTCTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121308518_1121308530 26 Left 1121308518 14:92922691-92922713 CCCTCTAGAGCCTCCTAGATATT No data
Right 1121308530 14:92922740-92922762 CCTCCAGCCTGTGAGACCGGGGG No data
1121308518_1121308527 24 Left 1121308518 14:92922691-92922713 CCCTCTAGAGCCTCCTAGATATT No data
Right 1121308527 14:92922738-92922760 TGCCTCCAGCCTGTGAGACCGGG No data
1121308518_1121308528 25 Left 1121308518 14:92922691-92922713 CCCTCTAGAGCCTCCTAGATATT No data
Right 1121308528 14:92922739-92922761 GCCTCCAGCCTGTGAGACCGGGG No data
1121308518_1121308523 -2 Left 1121308518 14:92922691-92922713 CCCTCTAGAGCCTCCTAGATATT No data
Right 1121308523 14:92922712-92922734 TTGGAGAGAGCCATGAGTGATGG No data
1121308518_1121308524 -1 Left 1121308518 14:92922691-92922713 CCCTCTAGAGCCTCCTAGATATT No data
Right 1121308524 14:92922713-92922735 TGGAGAGAGCCATGAGTGATGGG No data
1121308518_1121308526 23 Left 1121308518 14:92922691-92922713 CCCTCTAGAGCCTCCTAGATATT No data
Right 1121308526 14:92922737-92922759 ATGCCTCCAGCCTGTGAGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121308518 Original CRISPR AATATCTAGGAGGCTCTAGA GGG (reversed) Intergenic
No off target data available for this crispr