ID: 1121308523

View in Genome Browser
Species Human (GRCh38)
Location 14:92922712-92922734
Sequence TTGGAGAGAGCCATGAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121308515_1121308523 24 Left 1121308515 14:92922665-92922687 CCTCACTCAGACAGGGGATCAAA No data
Right 1121308523 14:92922712-92922734 TTGGAGAGAGCCATGAGTGATGG No data
1121308518_1121308523 -2 Left 1121308518 14:92922691-92922713 CCCTCTAGAGCCTCCTAGATATT No data
Right 1121308523 14:92922712-92922734 TTGGAGAGAGCCATGAGTGATGG No data
1121308519_1121308523 -3 Left 1121308519 14:92922692-92922714 CCTCTAGAGCCTCCTAGATATTG No data
Right 1121308523 14:92922712-92922734 TTGGAGAGAGCCATGAGTGATGG No data
1121308517_1121308523 -1 Left 1121308517 14:92922690-92922712 CCCCTCTAGAGCCTCCTAGATAT No data
Right 1121308523 14:92922712-92922734 TTGGAGAGAGCCATGAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121308523 Original CRISPR TTGGAGAGAGCCATGAGTGA TGG Intergenic
No off target data available for this crispr