ID: 1121308528

View in Genome Browser
Species Human (GRCh38)
Location 14:92922739-92922761
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121308525_1121308528 -6 Left 1121308525 14:92922722-92922744 CCATGAGTGATGGGCATGCCTCC No data
Right 1121308528 14:92922739-92922761 GCCTCCAGCCTGTGAGACCGGGG No data
1121308517_1121308528 26 Left 1121308517 14:92922690-92922712 CCCCTCTAGAGCCTCCTAGATAT No data
Right 1121308528 14:92922739-92922761 GCCTCCAGCCTGTGAGACCGGGG No data
1121308521_1121308528 15 Left 1121308521 14:92922701-92922723 CCTCCTAGATATTGGAGAGAGCC No data
Right 1121308528 14:92922739-92922761 GCCTCCAGCCTGTGAGACCGGGG No data
1121308518_1121308528 25 Left 1121308518 14:92922691-92922713 CCCTCTAGAGCCTCCTAGATATT No data
Right 1121308528 14:92922739-92922761 GCCTCCAGCCTGTGAGACCGGGG No data
1121308522_1121308528 12 Left 1121308522 14:92922704-92922726 CCTAGATATTGGAGAGAGCCATG No data
Right 1121308528 14:92922739-92922761 GCCTCCAGCCTGTGAGACCGGGG No data
1121308519_1121308528 24 Left 1121308519 14:92922692-92922714 CCTCTAGAGCCTCCTAGATATTG No data
Right 1121308528 14:92922739-92922761 GCCTCCAGCCTGTGAGACCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121308528 Original CRISPR GCCTCCAGCCTGTGAGACCG GGG Intergenic
No off target data available for this crispr