ID: 1121308704

View in Genome Browser
Species Human (GRCh38)
Location 14:92923399-92923421
Sequence GGGCAAGGTGAGCGAGCGCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 130}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121308690_1121308704 28 Left 1121308690 14:92923348-92923370 CCCGGGTCCGCCATGCGCTCCGC 0: 1
1: 0
2: 2
3: 6
4: 90
Right 1121308704 14:92923399-92923421 GGGCAAGGTGAGCGAGCGCGGGG 0: 1
1: 0
2: 0
3: 16
4: 130
1121308692_1121308704 21 Left 1121308692 14:92923355-92923377 CCGCCATGCGCTCCGCCGCTGTC 0: 1
1: 0
2: 0
3: 10
4: 93
Right 1121308704 14:92923399-92923421 GGGCAAGGTGAGCGAGCGCGGGG 0: 1
1: 0
2: 0
3: 16
4: 130
1121308696_1121308704 6 Left 1121308696 14:92923370-92923392 CCGCTGTCCTGGCTCTTCTGCTC 0: 1
1: 0
2: 3
3: 46
4: 557
Right 1121308704 14:92923399-92923421 GGGCAAGGTGAGCGAGCGCGGGG 0: 1
1: 0
2: 0
3: 16
4: 130
1121308693_1121308704 18 Left 1121308693 14:92923358-92923380 CCATGCGCTCCGCCGCTGTCCTG 0: 1
1: 0
2: 0
3: 20
4: 120
Right 1121308704 14:92923399-92923421 GGGCAAGGTGAGCGAGCGCGGGG 0: 1
1: 0
2: 0
3: 16
4: 130
1121308691_1121308704 27 Left 1121308691 14:92923349-92923371 CCGGGTCCGCCATGCGCTCCGCC 0: 1
1: 0
2: 0
3: 5
4: 129
Right 1121308704 14:92923399-92923421 GGGCAAGGTGAGCGAGCGCGGGG 0: 1
1: 0
2: 0
3: 16
4: 130
1121308695_1121308704 9 Left 1121308695 14:92923367-92923389 CCGCCGCTGTCCTGGCTCTTCTG 0: 1
1: 0
2: 0
3: 20
4: 335
Right 1121308704 14:92923399-92923421 GGGCAAGGTGAGCGAGCGCGGGG 0: 1
1: 0
2: 0
3: 16
4: 130
1121308697_1121308704 -1 Left 1121308697 14:92923377-92923399 CCTGGCTCTTCTGCTCTGCGCCG 0: 1
1: 0
2: 2
3: 24
4: 185
Right 1121308704 14:92923399-92923421 GGGCAAGGTGAGCGAGCGCGGGG 0: 1
1: 0
2: 0
3: 16
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121308704 Original CRISPR GGGCAAGGTGAGCGAGCGCG GGG Exonic