ID: 1121308906

View in Genome Browser
Species Human (GRCh38)
Location 14:92924137-92924159
Sequence AGAAAGGACTGGCCTCCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121308902_1121308906 -8 Left 1121308902 14:92924122-92924144 CCAGTGAGCCCGGTCAGAAAGGA 0: 1
1: 0
2: 2
3: 8
4: 132
Right 1121308906 14:92924137-92924159 AGAAAGGACTGGCCTCCACTTGG 0: 1
1: 0
2: 1
3: 11
4: 136
1121308900_1121308906 -7 Left 1121308900 14:92924121-92924143 CCCAGTGAGCCCGGTCAGAAAGG 0: 1
1: 0
2: 0
3: 10
4: 66
Right 1121308906 14:92924137-92924159 AGAAAGGACTGGCCTCCACTTGG 0: 1
1: 0
2: 1
3: 11
4: 136
1121308899_1121308906 -6 Left 1121308899 14:92924120-92924142 CCCCAGTGAGCCCGGTCAGAAAG 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1121308906 14:92924137-92924159 AGAAAGGACTGGCCTCCACTTGG 0: 1
1: 0
2: 1
3: 11
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121308906 Original CRISPR AGAAAGGACTGGCCTCCACT TGG Intronic
905541052 1:38760707-38760729 ACAAAAGACTGACCTCCCCTGGG - Intergenic
914244845 1:145878012-145878034 AGGAAGCACTGCCCTACACTTGG - Exonic
914454221 1:147820618-147820640 AGAAAGGACTAGGCTCCTCCGGG + Intergenic
915274352 1:154777670-154777692 ACAAAGGACTATCCTCCCCTAGG + Intronic
915481553 1:156189465-156189487 ACACAGGACTGGTCTCTACTTGG - Intergenic
916056292 1:161070847-161070869 GGAAAGAATTGGCCTCCACAAGG - Intergenic
919751029 1:201038365-201038387 GGAGAGAACTGGCTTCCACTGGG + Intergenic
920312185 1:205054957-205054979 AGGAAGGGCTGGCCTCGCCTGGG + Intronic
921273123 1:213490420-213490442 AGAAAAGACTGGCCTCCAAGAGG - Intergenic
922192158 1:223328842-223328864 AGCCAGGACTTGCCTCCACTAGG - Intronic
1064459423 10:15519699-15519721 GGAAAGGAATGGCCTTCACTTGG + Intronic
1067726140 10:48772500-48772522 AAAAAGAACTGCCCTCCACTAGG - Intronic
1068663484 10:59647772-59647794 AGACATGACTGAACTCCACTGGG + Intergenic
1070833438 10:79433844-79433866 AGAAAGGACTGTCCCCAACCTGG - Intronic
1071973445 10:90931185-90931207 TGAAAGCACTGGCTTCCGCTGGG - Intergenic
1072210325 10:93240274-93240296 TTAAAGGAATGGCCTCCATTTGG + Intergenic
1074455621 10:113593104-113593126 ATAAAGAACAGCCCTCCACTGGG - Intronic
1074710934 10:116176959-116176981 AGAATGAACTGGCCTTCATTAGG + Intronic
1074731945 10:116388258-116388280 AGTAAGTAGTGGCCTTCACTTGG - Intergenic
1075780983 10:125016970-125016992 GGAATGGACTGGCCTGCGCTGGG + Intronic
1076698802 10:132259605-132259627 AGAACGTGCTGGCCTCCCCTTGG + Intronic
1080141977 11:28932692-28932714 AGAACTGACTAGCTTCCACTAGG - Intergenic
1084904964 11:72338507-72338529 TGGAAGGACTGGCCTATACTGGG + Intronic
1085159978 11:74331600-74331622 CTCAAGGACTTGCCTCCACTGGG + Exonic
1090625775 11:128607258-128607280 GGAAAGGCATGACCTCCACTGGG - Intergenic
1092487303 12:8914227-8914249 AGAAAGTGCTGGCCTCTAGTGGG - Intronic
1095641964 12:44495530-44495552 AGAAATGACTGTCCTCACCTAGG + Intergenic
1096622882 12:52875331-52875353 AGCCAGGAGTGGCCTCCACCTGG + Intergenic
1097265458 12:57741884-57741906 AGAAAGGTCAGCCCTCAACTTGG - Intronic
1102131157 12:110529825-110529847 GGAAAGGACTGGCTTTAACTTGG + Intronic
1103893016 12:124254107-124254129 GGATGGGACTGGCCTCCACGTGG + Intronic
1106303457 13:28490126-28490148 AAACAGCACTGGCCTCCTCTGGG + Intronic
1108368153 13:49738987-49739009 AGAAAGGAATTGCCTCATCTTGG - Intronic
1113346054 13:109479699-109479721 AGAAGGGCCTGGCCTACCCTGGG - Intergenic
1114534778 14:23415971-23415993 AGAGGGGACTGGCCTCCACGTGG - Intronic
1118989236 14:70782905-70782927 GGAAAGGACTGGCTTTCACCTGG - Intronic
1118997406 14:70849084-70849106 AGTAAGGACTGGCTTCTCCTGGG + Intergenic
1119614693 14:76091394-76091416 AGAAAGTTCTGGCCTCCCCACGG - Intergenic
1121178413 14:91908505-91908527 AGAAAAGACTGGGCTCAAATAGG - Intronic
1121308906 14:92924137-92924159 AGAAAGGACTGGCCTCCACTTGG + Intronic
1121962621 14:98275260-98275282 AGAAAGGTGTGGCCGCCAGTGGG - Intergenic
1122401455 14:101469798-101469820 AGAAAGGACTGGTGGCCTCTGGG - Intergenic
1122887365 14:104716056-104716078 AGACAGGACCAGCCTGCACTGGG + Intronic
1126902141 15:53325498-53325520 AGCAAGGACTGGCCTCTCCTGGG + Intergenic
1128699570 15:69794391-69794413 AGAAATGACTGCACTGCACTGGG + Intergenic
1131853506 15:96567318-96567340 AGAAAGGCTTGGATTCCACTGGG + Intergenic
1132215811 15:100060900-100060922 AAAAAGGCCTTGTCTCCACTCGG - Intronic
1133609531 16:7419823-7419845 AAAAAGGACATGCCTCCATTAGG - Intronic
1135543995 16:23353787-23353809 AGAAACAACTGCCCTGCACTGGG + Intronic
1136128754 16:28205100-28205122 AGGAAGGAGTGGCCTGTACTTGG - Intronic
1137066970 16:35856950-35856972 ACACAGGACTGCTCTCCACTCGG + Intergenic
1137559764 16:49495091-49495113 AGGGAGGCCTGGCATCCACTCGG + Intronic
1137629910 16:49935751-49935773 ACACAGGAGTGGCCTCCACTGGG + Intergenic
1146650025 17:34600973-34600995 AAGAAGGGCTGGTCTCCACTGGG + Intronic
1151363918 17:73605020-73605042 AGAAAGGAGAGGCCACCACTGGG + Intronic
1151536401 17:74741266-74741288 AGAAAGCACAGCCCTGCACTGGG + Intronic
1155099388 18:22594206-22594228 AGAATGGAGTGGCTTCAACTAGG - Intergenic
1160971175 19:1768432-1768454 AGGAAGGACTGGCCTGCACCGGG + Intronic
1162529704 19:11228880-11228902 AAAAAGGAAGGGGCTCCACTGGG + Intronic
1163658652 19:18563152-18563174 TGAAAAGACTGGACACCACTGGG + Intronic
1163829637 19:19541483-19541505 AGGAAGGGCTGGTCTCCACCTGG - Intronic
1166268209 19:41697670-41697692 AGAGAGAACTGGCTTCCCCTGGG - Intronic
926046815 2:9716093-9716115 AGCATGGACTTGCTTCCACTGGG - Intergenic
929789160 2:45010969-45010991 AGAAGGAACTGGCCTAGACTCGG - Intergenic
931759962 2:65407788-65407810 AGAGAGAACTGTCCTCCAGTTGG - Intronic
935328571 2:101960108-101960130 AGAAAGGCCAAGCATCCACTGGG + Intergenic
936284822 2:111173749-111173771 AGGCAGGACTGGACTCCACAGGG + Intergenic
936886041 2:117310794-117310816 AGAAAGGACTGGCCTCTGGGTGG - Intergenic
936896575 2:117434537-117434559 AGAAAGAACTGGCATCCTCAGGG + Intergenic
938711462 2:133979241-133979263 GCACAGGACTGGCCTACACTAGG + Intergenic
946071321 2:217036521-217036543 ACAAAGGCAGGGCCTCCACTTGG + Intergenic
946763459 2:223018654-223018676 AGAGTTGACTGGGCTCCACTAGG - Intergenic
1171343278 20:24446911-24446933 AGGAAGGGCTGGCCTCCTCAAGG - Intergenic
1175318669 20:58070214-58070236 AGAAAGGGCTGGGCACCACATGG + Intergenic
1175705553 20:61174001-61174023 AGAACTGTCTGGCCTGCACTCGG + Intergenic
1178487456 21:33027887-33027909 AGCGAGGACTGGCCTGCGCTGGG + Exonic
1179171922 21:38979905-38979927 CCAGAAGACTGGCCTCCACTGGG + Intergenic
1181433541 22:22897135-22897157 GGCAAGTCCTGGCCTCCACTAGG + Intergenic
1182278299 22:29204167-29204189 AGACAGGCCTGGCATCCTCTTGG + Intergenic
1183858833 22:40654284-40654306 GGAAGGGACTGACCACCACTGGG + Intergenic
950350905 3:12351404-12351426 AGAAAGGACTGGGCTTGAATTGG - Intronic
952585568 3:34887969-34887991 AGCTAGGACTGGTCTCCACATGG - Intergenic
953372381 3:42400186-42400208 AGAAAGGACAGGCCTGCAGGTGG - Intronic
955596376 3:60594910-60594932 TGGAAGGACTGGCCTCAAATAGG - Intronic
956354741 3:68378504-68378526 AGAAGGGACTTGCCTTCTCTCGG + Intronic
956400410 3:68873565-68873587 AGAAATCACTGTCCTCCACGGGG + Intronic
957858245 3:85907538-85907560 AAAAAGAACTGGCCTACTCTAGG + Intronic
959911014 3:111763752-111763774 AGAAGGGGCTGGCCTGCTCTGGG - Intronic
962308153 3:134307080-134307102 AGAAAGGAGAAGCCTCAACTGGG + Intergenic
962922823 3:139966104-139966126 AGAAAGACCTGGGCTCCACAGGG + Intronic
963380397 3:144522703-144522725 TGAAAGGAATGGCCTTGACTAGG + Intergenic
970670040 4:18386187-18386209 ACAAAGGCCTGGTCTCCACTGGG - Intergenic
977119537 4:93080939-93080961 AGACAGGTTTGGCCTCCCCTTGG - Intronic
977395669 4:96468207-96468229 AGAAAGGACTTGCCTTGTCTCGG - Intergenic
981069045 4:140515738-140515760 AGAGAAGTCTGCCCTCCACTTGG - Intergenic
983431701 4:167659311-167659333 AGAAAGGACTTGCCTTGTCTTGG - Intergenic
987192252 5:15490264-15490286 AGAAAGGACTGGTCTTGATTAGG - Intergenic
989449731 5:41572638-41572660 CTGAAGGACTGCCCTCCACTAGG - Intergenic
992613360 5:78526701-78526723 AAAAATCACTCGCCTCCACTGGG - Intronic
993031539 5:82712333-82712355 AGAAAACACTGGTCTACACTTGG - Intergenic
997047038 5:130330875-130330897 AGAAGGTACTGGTCTCCGCTGGG + Intergenic
997628599 5:135348988-135349010 AGGAAGGACTGGGCTCTTCTGGG + Intronic
998432522 5:142078455-142078477 AAGAAGGGCTGGCCTCCAGTTGG - Intergenic
999266367 5:150269422-150269444 AGAAGGGAGTGGACTCCCCTGGG + Intronic
999309888 5:150545159-150545181 AACAAGGACTTGCCTCCAGTGGG - Intronic
1000356258 5:160399023-160399045 AGAAATGACTGGCCTTAAGTTGG + Intronic
1001934930 5:175697029-175697051 AGAGGGGACTGGCCTTCCCTGGG - Intergenic
1002961985 6:1923861-1923883 AGAAAGGACTGGGCAGCAGTGGG + Intronic
1007041914 6:38730203-38730225 AGAAATCACTGGCCTCTGCTGGG + Intronic
1007919253 6:45591390-45591412 AGAAAGCACTGGCCTGCCTTAGG + Intronic
1011372655 6:86654333-86654355 AGAAAGGTCTGGCCTTTCCTGGG - Intergenic
1011742017 6:90371449-90371471 AGAAAGGACTGTCCTACAACAGG + Intergenic
1013092052 6:106908814-106908836 ATAAGGGAGTGTCCTCCACTAGG + Intergenic
1014773435 6:125482566-125482588 ATAAAGGAATGGCCTCCACTTGG + Intergenic
1015888623 6:137946474-137946496 AGAAACGTCTGGGCTCCACAGGG + Intergenic
1018083150 6:160276221-160276243 AGGTAGGGCTTGCCTCCACTGGG - Intronic
1019010054 6:168837723-168837745 GGGAAGGACTGACCTCCGCTGGG - Intergenic
1020063269 7:5168500-5168522 AGCAAGGACTGACCTTCACAGGG + Intergenic
1022494467 7:30844365-30844387 AGCAAGGACTCGCCTCCTCCTGG + Intronic
1023547424 7:41333208-41333230 AGAAAGGACTGTATTCCCCTTGG - Intergenic
1029364234 7:100106925-100106947 AGAAACGACTGTCCTCCCGTGGG - Exonic
1030758888 7:113325613-113325635 AGAAAGGCCTGGGCTCAACCTGG + Intergenic
1038025946 8:23590877-23590899 AGAGTGGTCTGGCCTGCACTGGG + Intergenic
1038721552 8:30041271-30041293 GGCAGGGACTGGGCTCCACTGGG + Intergenic
1040520823 8:48174558-48174580 CGAGAGCACTGGCCTCCAGTAGG - Intergenic
1041535828 8:58924579-58924601 ACACAGGACTGCCCTCCACAGGG - Intronic
1045223552 8:100222172-100222194 GGAGAGGACTTGCCTCCTCTAGG + Intronic
1046138290 8:110059939-110059961 AGAAATGACTGTCCTCACCTAGG - Intergenic
1046138862 8:110063752-110063774 AGAAATGACTGTCCTCACCTAGG - Intergenic
1048735038 8:137489817-137489839 AGGAAGGAATGGCACCCACTGGG + Intergenic
1048756711 8:137747400-137747422 AGAAAGGACTGGCCTCTTCCAGG + Intergenic
1049389664 8:142361215-142361237 AGACAGGCCTGGCCTGCTCTCGG + Intronic
1051985516 9:23081659-23081681 CGAAAGGACTGTGCTCCATTGGG + Intergenic
1055797550 9:79991820-79991842 ATAAAGGACTGAGCTCTACTAGG + Intergenic
1056368087 9:85926105-85926127 AGGAATAACTGGTCTCCACTAGG - Intergenic
1057263629 9:93599892-93599914 ACAAAGGGCTGGTCTCCACCTGG - Intronic
1057413502 9:94840152-94840174 AGAAGGGACTGTCCTCAACCTGG - Intronic
1059281379 9:113136871-113136893 AGGAGGGACTGGCCTCCATAGGG - Intergenic
1060662586 9:125413188-125413210 AGCAGGGCCTGGTCTCCACTGGG + Intergenic
1186345302 X:8685835-8685857 AGAAAGGACTTCTCTCAACTGGG - Intronic
1187115702 X:16348158-16348180 ACAAAGGAAAGTCCTCCACTGGG + Intergenic
1187555281 X:20345225-20345247 AGAAAGGACTTGCCTTGTCTTGG + Intergenic
1189239207 X:39512675-39512697 ATAAAGGAGTTGCCTCCCCTGGG - Intergenic
1192606835 X:72527333-72527355 AGAAAGGCCTGGTCTGAACTCGG + Intronic
1193086771 X:77454046-77454068 ACACAGGGCTGGCCTCCAGTTGG + Intronic
1200860622 Y:7988141-7988163 TGAATGGACTGGCCTCTTCTTGG - Intergenic
1201210003 Y:11671335-11671357 AGAATGGAATGGCATCTACTGGG + Intergenic
1201859821 Y:18584616-18584638 AGGAAGGACTGCCGTCCATTTGG - Intronic
1201873500 Y:18735765-18735787 AGGAAGGACTGCCGTCCATTTGG + Intronic