ID: 1121311937

View in Genome Browser
Species Human (GRCh38)
Location 14:92940088-92940110
Sequence CAGGATGCCCACTTTGAGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 217}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121311937_1121311948 22 Left 1121311937 14:92940088-92940110 CCCTCCTCAAAGTGGGCATCCTG 0: 1
1: 0
2: 1
3: 16
4: 217
Right 1121311948 14:92940133-92940155 AGGACCTCCATGCACTGGCTCGG 0: 1
1: 0
2: 0
3: 11
4: 131
1121311937_1121311946 17 Left 1121311937 14:92940088-92940110 CCCTCCTCAAAGTGGGCATCCTG 0: 1
1: 0
2: 1
3: 16
4: 217
Right 1121311946 14:92940128-92940150 GCCGAAGGACCTCCATGCACTGG 0: 1
1: 0
2: 0
3: 2
4: 42
1121311937_1121311942 2 Left 1121311937 14:92940088-92940110 CCCTCCTCAAAGTGGGCATCCTG 0: 1
1: 0
2: 1
3: 16
4: 217
Right 1121311942 14:92940113-92940135 GCCCAGCTGAGCCAGGCCGAAGG 0: 1
1: 0
2: 3
3: 24
4: 255
1121311937_1121311950 24 Left 1121311937 14:92940088-92940110 CCCTCCTCAAAGTGGGCATCCTG 0: 1
1: 0
2: 1
3: 16
4: 217
Right 1121311950 14:92940135-92940157 GACCTCCATGCACTGGCTCGGGG 0: 1
1: 0
2: 0
3: 7
4: 77
1121311937_1121311949 23 Left 1121311937 14:92940088-92940110 CCCTCCTCAAAGTGGGCATCCTG 0: 1
1: 0
2: 1
3: 16
4: 217
Right 1121311949 14:92940134-92940156 GGACCTCCATGCACTGGCTCGGG 0: 1
1: 0
2: 1
3: 19
4: 191
1121311937_1121311940 -5 Left 1121311937 14:92940088-92940110 CCCTCCTCAAAGTGGGCATCCTG 0: 1
1: 0
2: 1
3: 16
4: 217
Right 1121311940 14:92940106-92940128 TCCTGCAGCCCAGCTGAGCCAGG 0: 1
1: 0
2: 5
3: 63
4: 406
1121311937_1121311951 25 Left 1121311937 14:92940088-92940110 CCCTCCTCAAAGTGGGCATCCTG 0: 1
1: 0
2: 1
3: 16
4: 217
Right 1121311951 14:92940136-92940158 ACCTCCATGCACTGGCTCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121311937 Original CRISPR CAGGATGCCCACTTTGAGGA GGG (reversed) Exonic
902037492 1:13468236-13468258 CAGGGTGGACAGTTTGAGGAAGG + Intergenic
902681619 1:18047762-18047784 CAGGGTGCCCACATGGAGGCAGG - Intergenic
904463324 1:30693242-30693264 CAGGCTGCTCACTTGGAGGTGGG - Intergenic
905084861 1:35363877-35363899 CAGCATGCCCACATTGGGGCAGG - Intronic
906822009 1:48939753-48939775 CAGAATGCCCTCTTTGAAGAAGG - Intronic
907480273 1:54740931-54740953 CACGATTCCCTCTATGAGGAAGG - Intronic
908067749 1:60425857-60425879 CAGGATGACTACCTAGAGGATGG - Intergenic
908682798 1:66681671-66681693 TATGATGCTCACTTTGTGGAGGG + Intronic
912546846 1:110457201-110457223 CAGGTTGGTGACTTTGAGGAGGG + Exonic
912600352 1:110925264-110925286 CAGAATTCCCTCTTTGAGGAAGG - Intergenic
914244717 1:145876975-145876997 CAGGAGGTCCACTTTGGAGAAGG + Intronic
915914659 1:159933783-159933805 GATGGTGCCCACTTTAAGGATGG + Intronic
916361525 1:163975540-163975562 CAGGATGCCTATTGTGATGAGGG - Intergenic
916563931 1:165956860-165956882 CAGGAAGGCCTCTTGGAGGAGGG + Intergenic
916721461 1:167487447-167487469 AGGGATGCCCACCTGGAGGAAGG - Intronic
916885562 1:169064341-169064363 CAGGCTCCCCACGTTGGGGAAGG - Intergenic
918655952 1:187027053-187027075 CAGGATGGCCACATAGAGAAGGG + Intergenic
920200038 1:204254174-204254196 CAGGATTCCAACTCTGAGCAGGG - Intronic
1062918193 10:1258007-1258029 CAGGGTCCCCACTGTGTGGATGG - Intronic
1063170268 10:3503519-3503541 CAAGCTGCCCACTTTGAAAATGG + Intergenic
1064980148 10:21158454-21158476 CAGAATGCCCATTTTGCAGATGG + Intronic
1067156584 10:43786080-43786102 CAGGAGCCTCACTCTGAGGACGG + Intergenic
1067714390 10:48678085-48678107 CAGAGTCTCCACTTTGAGGAAGG - Intergenic
1068082312 10:52334699-52334721 CAGGAAGCCCTCTTTGAAGAAGG - Intergenic
1070566159 10:77605244-77605266 CCGGATGCCCTCCTTGAAGAGGG + Intronic
1070587953 10:77780481-77780503 CTGGATGCCCGCTATGAGGTAGG + Intergenic
1070979663 10:80634093-80634115 CAAGATGCCCTCTCTGTGGAAGG + Intronic
1071226532 10:83536545-83536567 TAGGATGGCCACTCTTAGGAAGG - Intergenic
1072122739 10:92418889-92418911 CATGATTCCTACTTTGTGGATGG - Intergenic
1074853208 10:117455223-117455245 TGGGATGCCCAGCTTGAGGAAGG + Intergenic
1075996243 10:126878517-126878539 CAGCATGTCCAGTCTGAGGAAGG - Intergenic
1076825945 10:132968264-132968286 CATGATGCCCACACTGGGGAGGG - Intergenic
1076947232 10:133659693-133659715 GAGGATGCACACCTTGAGGCTGG - Intergenic
1077353415 11:2103548-2103570 CAGGAAGCCCACTGGGAGGGTGG - Intergenic
1078754436 11:14195685-14195707 CAGAAAGGCCAATTTGAGGATGG + Intronic
1079898335 11:26149753-26149775 CCGGATGGCCACTTTGATGCCGG + Intergenic
1081652186 11:44831849-44831871 CAGGAAGCCTTCTTGGAGGAGGG + Intronic
1082162684 11:48901463-48901485 CAGGGATCCCACGTTGAGGACGG - Intergenic
1082175077 11:49049458-49049480 CAGGGATCCCACGTTGAGGACGG - Intergenic
1082238738 11:49851271-49851293 CAGGGATCCCACGTTGAGGACGG + Intergenic
1082243406 11:49893056-49893078 CAGGGATCCCACGTTGAGGACGG - Intergenic
1082657901 11:55873882-55873904 CAGGGATCCCACGTTGAGGACGG - Intergenic
1084666908 11:70581271-70581293 GAAGATGCCATCTTTGAGGAAGG - Intronic
1085450709 11:76630397-76630419 GAGGATGCACACTCTGAAGAGGG - Intergenic
1086690691 11:89786626-89786648 CAGGGATCCCACGTTGAGGACGG + Intergenic
1086697831 11:89864880-89864902 CAGGGATCCCACGTTGAGGAAGG - Intergenic
1086708331 11:89979608-89979630 CAGGGATCCCACGTTGAGGAAGG + Intergenic
1086715110 11:90053034-90053056 CAGGGATCCCACGTTGAGGACGG - Intergenic
1088175360 11:107047530-107047552 CAGGATGCCAACTCTGGGCATGG + Intergenic
1088815804 11:113419995-113420017 CTGGATGCCCATTTTGCGGGTGG + Intronic
1089491788 11:118888480-118888502 AAGGATGACCACTTTGTTGAGGG - Intronic
1092027913 12:5258506-5258528 GAGGATGCCTACATTGGGGAGGG - Intergenic
1093495923 12:19757603-19757625 CAGGTTGCTAACTTAGAGGAAGG - Intergenic
1098164715 12:67682523-67682545 CAGGATGACAACCTTGAGGCAGG + Intergenic
1099775457 12:87122183-87122205 CAGGAAGGCCAGTTTGGGGAAGG + Intergenic
1100312599 12:93411181-93411203 CAGGATTCCCCCTTTGAGGGAGG - Exonic
1101570415 12:105948441-105948463 CAGGATGACAGCTTGGAGGAAGG - Intergenic
1102654600 12:114471194-114471216 CAGGATGTCCACCTTGATGGAGG - Intergenic
1103123364 12:118399561-118399583 CAGGAAGATCACTTTGAGGGAGG + Intronic
1104677930 12:130727743-130727765 CAGGATGCCCACCATGGGAATGG + Intergenic
1107355173 13:39558772-39558794 CAGGATACCCTATTTTAGGAAGG + Intronic
1107864839 13:44693625-44693647 CAGGATGGCCTCTTTCAAGATGG + Intergenic
1108709151 13:53016103-53016125 CAGGATGCCCTGTGAGAGGAGGG - Intergenic
1112569230 13:100579106-100579128 CTGGGTGCCCACTATGTGGAAGG + Intronic
1113842824 13:113370021-113370043 CGGGAGGCCCACCTTAAGGATGG + Intergenic
1115303888 14:31914351-31914373 CAGGATGGCCACATAGAGAAGGG - Intergenic
1115761771 14:36583088-36583110 CAGGATGACAAGTTTCAGGAGGG + Intergenic
1119312912 14:73665209-73665231 CTGAATGCCAACTTTGAGTAAGG - Intronic
1121274478 14:92658155-92658177 TCTGATGCCCACTCTGAGGATGG - Intronic
1121311937 14:92940088-92940110 CAGGATGCCCACTTTGAGGAGGG - Exonic
1125917094 15:43497443-43497465 CAGGATGAGAATTTTGAGGAGGG - Intronic
1126857023 15:52848469-52848491 CAGGAAAACCACTATGAGGAAGG - Intergenic
1128413364 15:67421330-67421352 CAGCATGTCCACTGTGAGGTTGG - Exonic
1129223203 15:74146860-74146882 CAAATTGCCCACTTTGATGAGGG - Intergenic
1129882979 15:79019179-79019201 CAGGAGGCCCAGTCTGAGGAGGG + Intronic
1132533204 16:463945-463967 CAGGCAGCCCTCTCTGAGGAGGG + Intronic
1135429050 16:22366678-22366700 CAAGATGGCCAGTTTGCGGAGGG + Intronic
1139003504 16:62542636-62542658 AAGGTTGCCCACTAAGAGGAAGG + Intergenic
1142715590 17:1745373-1745395 CTGGTTGCCCAACTTGAGGAGGG - Exonic
1142918539 17:3163750-3163772 CTGGATCCCCACTCTGGGGAAGG - Intergenic
1143583520 17:7839739-7839761 TTGGATGACCACTTTGGGGATGG + Intergenic
1143932295 17:10441793-10441815 TAGGATTCCCACATTGGGGAAGG + Intergenic
1144209589 17:13003119-13003141 CTGAATGCCCACTTTGTGGGAGG - Intronic
1145998401 17:29117438-29117460 CAGGATGCCCACCGTGGGGTGGG - Intronic
1147768488 17:42852172-42852194 CTGGAGGCCCAGTTTGAGGCCGG + Exonic
1147771076 17:42868104-42868126 CTGGAGGCCCAGTTTGAGGCCGG + Intergenic
1147958033 17:44148450-44148472 CATGATACCCGCTTTGTGGATGG - Exonic
1148317335 17:46713854-46713876 CAGTCTTCCCACTGTGAGGAGGG - Exonic
1149620466 17:58041039-58041061 CAGGCTGGGCACTTAGAGGAGGG + Intergenic
1151858067 17:76737098-76737120 CAGGTTGTCCACCTTGAGGGAGG + Exonic
1156945335 18:42822651-42822673 CAGGATGCACAGTTTTAGGAAGG - Intronic
1157160877 18:45313238-45313260 CTAGATGCCCACTTCTAGGATGG + Intronic
1157475656 18:48021878-48021900 CAGGAACCCCATTTTGGGGAGGG + Intergenic
1161572960 19:5040319-5040341 CAGGGAGCCCTCTCTGAGGAGGG - Intronic
1161775747 19:6261169-6261191 CAGGAGGCCCACTTGCAGGCAGG + Intronic
1164911614 19:32016988-32017010 CTGGATGCCCACTTTATGGAGGG + Intergenic
1167467452 19:49657879-49657901 CCGGGTGCCCACCTTGTGGACGG - Exonic
1167582751 19:50356062-50356084 CAGGATGCTGGCTTTGAAGAAGG - Intronic
1168336052 19:55598353-55598375 CAGGATGACCACTTAGCGAATGG + Intronic
926434548 2:12824697-12824719 CAGGAGAGACACTTTGAGGAGGG - Intergenic
927312633 2:21648259-21648281 CAGGATGCTGACCTAGAGGAGGG - Intergenic
928205644 2:29281333-29281355 CAGGCTGCCCACAGAGAGGAAGG - Intronic
928406604 2:31019780-31019802 CATGATGCCCACTTTACAGAGGG - Intronic
928724619 2:34157573-34157595 CAGGGTGCCCACTTGGAATATGG - Intergenic
929868806 2:45740562-45740584 GAGGATGCTCTGTTTGAGGAGGG - Intronic
933348745 2:81125909-81125931 AAGGATGCCCACTTTCACCATGG - Intergenic
933943645 2:87266123-87266145 CAGGAAGCCCACTCTGCAGAGGG + Intergenic
934563824 2:95327573-95327595 GGGGATGTCCACTGTGAGGAGGG + Intronic
936336575 2:111595456-111595478 CAGGAAGCCCACTCTGCGGAGGG - Intergenic
938343796 2:130552358-130552380 CAGGAGGCCCAGGTGGAGGAGGG - Intergenic
938346037 2:130568364-130568386 CAGGAGGCCCAGGTGGAGGAGGG + Intergenic
940014213 2:149086525-149086547 CAGGGTGTCAACTTTGAGCAAGG + Intronic
940070776 2:149685052-149685074 ATTGATGTCCACTTTGAGGAAGG + Intergenic
940486000 2:154296055-154296077 AAGGAGGCACACTTTGAGAAAGG - Intronic
940583216 2:155607963-155607985 AAGGCTGCCCACATTAAGGAAGG + Intergenic
941060991 2:160846822-160846844 AAGGATGCCCACTTTCACCACGG + Intergenic
942386509 2:175449011-175449033 CAGGAGGCCCTCTTTGTGGGTGG - Intergenic
943369706 2:187002024-187002046 CTGGATGCCCGCTATGAGGTAGG + Intergenic
944581699 2:201137666-201137688 CTGGATGCCCACTATGAGGTAGG + Intronic
947864697 2:233388258-233388280 CAGCATCCCCTCTTTGATGATGG - Exonic
948255956 2:236568090-236568112 CAGGATGCTAACGTAGAGGAAGG - Intronic
948315572 2:237026067-237026089 CGGGCTGCCCAATCTGAGGAAGG + Intergenic
948456141 2:238105538-238105560 GAGGAGGCCCTCTTTGAGGAGGG + Intronic
1171345715 20:24464711-24464733 CAGTATGCCCACTTTCTAGATGG + Intergenic
1177243121 21:18487531-18487553 CAGAATGCCCACTTTCATAAGGG + Intergenic
1178671638 21:34596138-34596160 CAGTTTGCCCACTTGTAGGATGG - Intronic
1181610706 22:24009662-24009684 CAGGTTGCCCATTATGAGGCTGG - Intergenic
1181772922 22:25139752-25139774 AGGGAAGCCCTCTTTGAGGAGGG + Intronic
1182203181 22:28594709-28594731 TAGGATCCTCTCTTTGAGGAAGG + Intronic
1183063620 22:35349666-35349688 CAGGAGGCTCTCTGTGAGGACGG + Intergenic
1183159451 22:36102127-36102149 CGGAATACCCACTTTTAGGATGG - Intergenic
1184335660 22:43851680-43851702 CAGGCTGCACACTTGGAGGGTGG - Intronic
949117447 3:344661-344683 CAAGATTTCCCCTTTGAGGATGG - Exonic
950831448 3:15879402-15879424 CTGGATGTCCACTATGAGGTAGG - Intergenic
951344923 3:21536463-21536485 GAGGAAGCCCAGTTTGGGGAGGG + Intronic
953347605 3:42189210-42189232 CAGACTGCCAGCTTTGAGGAGGG - Intronic
954877091 3:53809256-53809278 CAGTTTGCCCACGTTGAGGGCGG + Intronic
955087957 3:55721227-55721249 CATTATGCCCACTTTGCAGATGG - Intronic
957080224 3:75630723-75630745 GAGGATGCACACCTTGAGGCTGG + Intergenic
958900830 3:99884615-99884637 CAGAATGCTCACTTTGTGCAGGG - Intronic
960883054 3:122365594-122365616 CAGGATGACCACTGCAAGGAGGG - Intronic
961562400 3:127739832-127739854 CTGCATGCACACTTGGAGGATGG - Intronic
962211750 3:133485619-133485641 CTGGATGCCCACTTTTAGTATGG - Intergenic
962448355 3:135490108-135490130 CAGGATTTCCACATTCAGGATGG + Intergenic
962482377 3:135808895-135808917 GATGATGCCCACTGTGAAGATGG + Intergenic
967981575 3:195069116-195069138 CAGGATCGCCTCTTTGAGGAAGG - Exonic
975040827 4:69743296-69743318 CAGGGTGCCCTCTTTGCTGAGGG - Intronic
975223168 4:71838015-71838037 CAGGAAGCCCACTGGCAGGAAGG - Intergenic
980161879 4:129174254-129174276 CAGGAAGCACACTGTGATGATGG + Intergenic
981593124 4:146387531-146387553 AAGGATGCCCACTTTTACCAGGG + Intronic
981658290 4:147137192-147137214 CAGGATGGCCACAGTGGGGATGG - Intergenic
985183041 4:187286380-187286402 CAGGCTGCTCTCTTTGAAGAGGG + Intergenic
985450690 4:190060493-190060515 GAGGATGCACACCTTGAGGCTGG - Intergenic
985937656 5:3109074-3109096 CAGAATGCACACATCGAGGATGG - Intergenic
986729538 5:10624951-10624973 CAGGGACCCCACATTGAGGATGG + Intronic
987140920 5:14945465-14945487 TACAATGCCTACTTTGAGGATGG - Intergenic
992613729 5:78530510-78530532 CATGATGGACGCTTTGAGGAAGG - Intronic
993288840 5:86038655-86038677 TAGGAAGCTCATTTTGAGGAAGG + Intergenic
996430388 5:123369684-123369706 AAGGAAGGCCTCTTTGAGGAGGG - Intronic
997248440 5:132370599-132370621 CCTGATGGCCACTTTGAAGAGGG + Intronic
999893192 5:156000917-156000939 CAGGGACCACACTTTGAGGATGG + Intronic
999903764 5:156116737-156116759 TAGGATTCCCACTTTGTAGATGG - Intronic
1001136021 5:169103608-169103630 CAGCATGCCCACCCTGGGGAAGG - Intronic
1002417685 5:179129323-179129345 CAGCATGCCCACCTTAGGGAGGG + Intronic
1002528505 5:179829202-179829224 CGGGATGCCCAGTTTCAGGCTGG - Intronic
1002971626 6:2028622-2028644 AAGGATGCCCACTTTAAATAAGG + Intronic
1004665104 6:17742031-17742053 CAGGATGACCACATAGAGAATGG - Intergenic
1004731923 6:18366884-18366906 CTGGATGCCCGCTATGAGGTAGG + Intergenic
1004950716 6:20668107-20668129 CAGGATACACAATTGGAGGAAGG - Intronic
1007251640 6:40499291-40499313 CAGGTTCCCCACTGTCAGGACGG + Intronic
1011239076 6:85251537-85251559 AAGGATCCTCACTTTGAGGAAGG + Intergenic
1011616130 6:89199925-89199947 CAGGATGCCTGTTTTAAGGATGG + Intronic
1012350110 6:98240034-98240056 CAGGAAGTCCTCTTAGAGGAGGG - Intergenic
1016612338 6:146005051-146005073 AAGGATGCCCACTTTCACCACGG + Intergenic
1016668852 6:146676821-146676843 CTGGAGGCCCACTGTGAGCAAGG - Intronic
1017074175 6:150601855-150601877 CAGGGTGCCCATTTAGAGTAGGG - Intronic
1017979277 6:159385391-159385413 CACAATGGCCACTTTCAGGAGGG - Intergenic
1018048432 6:159985984-159986006 CAGGCTGCCTCCCTTGAGGATGG + Intronic
1021788806 7:24179083-24179105 CTGCAGGCCCACTTTGAAGATGG - Intergenic
1022331259 7:29381542-29381564 CTGGAAGCCCACTGTGAGAATGG + Intronic
1023234269 7:38067282-38067304 CATGATACCTACTTTGAAGAGGG - Intergenic
1024038196 7:45526487-45526509 CAGGAAGCCAACTCTGAGGCAGG - Intergenic
1026903869 7:74051672-74051694 CAGGATGGCCACTTAGACGCCGG - Intronic
1029449774 7:100634283-100634305 CATGAGGCCCACGTGGAGGATGG - Intronic
1030175812 7:106651883-106651905 CAGGATGGCAACTGTGGGGAAGG + Intergenic
1032467016 7:132152403-132152425 CAGGAGGCCCTCTGTGAGGGCGG + Intronic
1032848029 7:135768458-135768480 CAGTTTGCCCACTTTGAAGAAGG - Intergenic
1033097202 7:138442072-138442094 CTGGATGCCCGCTATGAGGTAGG - Intergenic
1033115506 7:138621102-138621124 CACGATGCGCGCTTTGGGGATGG - Exonic
1034044922 7:147917667-147917689 CAGAATGCTCATTTTTAGGAAGG - Intronic
1034737327 7:153441103-153441125 CAGGATACCATCTTTAAGGAAGG - Intergenic
1034921257 7:155084261-155084283 GAGGATGCCCACCATGAGGGCGG - Exonic
1035846937 8:2875257-2875279 GAGGAAGCCCATTGTGAGGATGG - Intergenic
1039132937 8:34288125-34288147 CAACATGCCCACTTAAAGGATGG - Intergenic
1039897065 8:41724222-41724244 CAGGTTTCCCATTTTTAGGATGG + Intronic
1040897861 8:52388005-52388027 CAGGGTGTCCGCTTTGAGGGGGG + Intronic
1041096064 8:54351413-54351435 CAGCGTGCCCACTTTGAGCTTGG + Intergenic
1041579564 8:59442584-59442606 AAGGATGCCCACTTTTACCATGG - Intergenic
1042538186 8:69880423-69880445 GATGATGCCCACTTTGCTGAGGG - Intergenic
1044365935 8:91345658-91345680 CAAGATGCCCACTGTGCGGCAGG + Intronic
1047275458 8:123401937-123401959 CTGGATGCCCACTATGAGGTAGG - Intronic
1052941237 9:34133307-34133329 CTGGATGCCCACTATGAGGTAGG + Intergenic
1053144626 9:35704162-35704184 CAGGATGCCCTCCCTGAGGGAGG + Exonic
1055338022 9:75252477-75252499 CAGAATGCCTTCTCTGAGGAAGG + Intergenic
1056201621 9:84282522-84282544 TAGGATGCCCAGTTGGAGGTAGG + Intronic
1056789088 9:89613978-89614000 CAAGAGACCCACTTTGAGGGGGG - Intergenic
1058289852 9:103225944-103225966 CAGGCTTCCCACGTTGTGGATGG - Intergenic
1061400454 9:130365504-130365526 CAAGCTGCCCACTTGGAGCACGG - Intronic
1061745134 9:132733966-132733988 CAGGGTGCCCACCTGGAGCAGGG - Intronic
1061913978 9:133739544-133739566 CAGGAGGACCTCTTAGAGGAGGG + Intronic
1203783370 EBV:113762-113784 GAGGATGCCCCCTTTGTGGTGGG - Intergenic
1187863114 X:23700226-23700248 CGGGTTGCCCACTATGAGGTTGG - Intergenic
1189361869 X:40359333-40359355 CTGGATGCCCGCTATGAGGTAGG + Intergenic
1189659072 X:43278269-43278291 CTGGATGCCCGCTATGAGGTAGG + Intergenic
1190357396 X:49618446-49618468 CATGGTGCCCACTTTGAGGATGG + Intergenic
1190961024 X:55247756-55247778 AAGGATGCCCACTTTCAACAAGG + Intronic
1190976557 X:55408660-55408682 CAGGAGGCCCACATTCTGGAGGG - Intergenic
1191600708 X:63002068-63002090 CAGGATGACCACTTAGAGTGGGG - Intergenic
1191996142 X:67097145-67097167 CAAAATGCCCACTTTGAAGGAGG - Intergenic
1192135489 X:68595209-68595231 AAGGATGCCCACTTTCACCACGG + Intergenic
1192509314 X:71712589-71712611 CAGGATGCCCACAGAGAGGGTGG - Intergenic
1192517383 X:71768964-71768986 CAGGATGCCCACAGAGAGGGTGG + Intergenic
1194014726 X:88605112-88605134 CAGCCTGCACACTTGGAGGAAGG + Intergenic
1194994258 X:100575501-100575523 CTAGATGCCCACTATGTGGAAGG + Intergenic
1195676250 X:107509238-107509260 CATTATGCCCACATTGAAGAGGG - Intergenic
1196568996 X:117243819-117243841 GAGGATGCTCTCTTTGAAGAGGG + Intergenic
1196821413 X:119704032-119704054 GATGATGCCCACATTGGGGAAGG + Intergenic
1197679975 X:129372269-129372291 TAGAATGCCCTCATTGAGGAAGG + Intergenic
1197749167 X:129953142-129953164 CAGCCAGCCCACTTTGGGGAGGG + Intergenic
1199107223 X:143884230-143884252 AAGGATTCCCCCTTTGAGGGAGG + Intergenic
1200213247 X:154356213-154356235 TAGGAGGCATACTTTGAGGATGG - Intronic
1200731471 Y:6747304-6747326 CACGATTTCCAGTTTGAGGAAGG + Intergenic
1201389228 Y:13479432-13479454 CAGCTTGCCCACGTTGATGACGG - Intronic
1201856775 Y:18553167-18553189 CAGATTGCCCTCTTGGAGGAAGG + Intronic
1201876546 Y:18767213-18767235 CAGATTGCCCTCTTGGAGGAAGG - Intronic