ID: 1121312354

View in Genome Browser
Species Human (GRCh38)
Location 14:92941976-92941998
Sequence AGGCAGAACCGATGGGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121312345_1121312354 12 Left 1121312345 14:92941941-92941963 CCAGGGGCACGCATCATGCAGGG 0: 1
1: 0
2: 0
3: 12
4: 117
Right 1121312354 14:92941976-92941998 AGGCAGAACCGATGGGCTCCTGG 0: 1
1: 0
2: 1
3: 10
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121312354 Original CRISPR AGGCAGAACCGATGGGCTCC TGG Intronic
900371007 1:2332184-2332206 AGGCAGCCCCGCTGGGCACCTGG - Intronic
900997486 1:6130304-6130326 AAGCAGAACTGCTGGGCCCCGGG + Exonic
901784042 1:11612836-11612858 AGGCAGAACAGATGTGCGCAGGG - Intergenic
903197491 1:21702220-21702242 AAGCAGAACCCTTGGCCTCCAGG + Intronic
903827881 1:26158461-26158483 AGGCAGCTCCAGTGGGCTCCAGG + Intergenic
904003968 1:27353711-27353733 AGGCAGCAGCTATGGGCTGCAGG + Exonic
906719577 1:47995914-47995936 AGCCAGACCCTATGGTCTCCTGG + Intronic
907389771 1:54150688-54150710 AGCCAGAGCCTCTGGGCTCCAGG - Intronic
907907899 1:58800961-58800983 AGGCAGGACAGAGGGGCTCATGG - Intergenic
909214667 1:72871252-72871274 AGGTACTACCGATGGGCTCAAGG - Intergenic
912481048 1:109982512-109982534 AGGCAGAACCCATTGGAACCAGG - Intergenic
912793482 1:112675231-112675253 GGGCAGAACTGGCGGGCTCCGGG - Intronic
915367406 1:155323783-155323805 GGGCGGAGGCGATGGGCTCCTGG - Intronic
920301168 1:204989971-204989993 AGGCAGCACTGATGCTCTCCTGG - Intronic
920767853 1:208850675-208850697 AGGCAGACCCGATGTTCTCAGGG + Intergenic
921832757 1:219746472-219746494 AGGCAGAAAAGATGGGCTATAGG - Intronic
922153341 1:223023000-223023022 AGGCAGAACCAGTTGTCTCCAGG + Intergenic
1063980419 10:11447603-11447625 AGGCAGCACAGATGTTCTCCTGG + Intergenic
1072451738 10:95544310-95544332 AAGCAGAACAGGTGGGCTCTTGG + Intronic
1075654757 10:124153428-124153450 AGGCAGCACCGAGGGCCTGCGGG + Intergenic
1079368007 11:19826243-19826265 ATGAAGAATCAATGGGCTCCTGG + Intronic
1080961618 11:37167748-37167770 ATACAGAACAGCTGGGCTCCTGG + Intergenic
1082888596 11:58114189-58114211 AGGCAAAACAGCTGGGCACCTGG - Intronic
1083938547 11:65882957-65882979 AGGCAGACACGCTGGGCTACTGG + Intronic
1091194257 11:133718225-133718247 AGGCAGAACTGAGGGGCAGCTGG - Intergenic
1094415570 12:30211691-30211713 AGGCAGAACAGGTGTGTTCCTGG - Intergenic
1094583141 12:31752721-31752743 ATGCAGAACTGCTGGGCTCCAGG - Intergenic
1095188344 12:39227436-39227458 AGGCAGGACCGCTGGGCCACAGG + Intergenic
1101378075 12:104188138-104188160 ATACAGAACGGCTGGGCTCCTGG - Intergenic
1105329546 13:19402821-19402843 AGCCAGAAGCGCCGGGCTCCAGG - Intergenic
1106993182 13:35448806-35448828 TGGCAGAACTGCTGGGCACCAGG + Intronic
1108613812 13:52110956-52110978 AGGAAGAACCAATGGCTTCCAGG - Intronic
1110119776 13:71866580-71866602 CCGCCGAAGCGATGGGCTCCGGG + Exonic
1112302916 13:98246845-98246867 AGGCAGAATCCATGGGCTCAAGG - Intronic
1113464488 13:110504013-110504035 GGGCAGCCCCGAGGGGCTCCAGG - Intronic
1113558610 13:111258434-111258456 AGGCAGAACCCTGAGGCTCCCGG + Intronic
1114182294 14:20377283-20377305 AGGCAGAAGCCAAGAGCTCCTGG + Exonic
1120957199 14:90093206-90093228 AGGCAGATCCGCTTGGCTCCAGG + Intronic
1121312354 14:92941976-92941998 AGGCAGAACCGATGGGCTCCTGG + Intronic
1121562973 14:94887877-94887899 AGGCAGAGAAGATGTGCTCCAGG - Intergenic
1122229577 14:100299028-100299050 AGGCAGATCCCATGAGCCCCTGG + Intronic
1122656924 14:103268207-103268229 AGGCAGGGCAGGTGGGCTCCTGG + Intergenic
1122857891 14:104568643-104568665 AGGCAGCATCGCTGAGCTCCTGG - Intronic
1125527008 15:40383022-40383044 GGGCAGGACCGGCGGGCTCCTGG + Exonic
1126405164 15:48315723-48315745 ATACAGAACAGCTGGGCTCCTGG - Intergenic
1128867427 15:71125219-71125241 AGGCAGAGCTGCTGGACTCCAGG - Intronic
1131462600 15:92629137-92629159 ATGCAGAAGCCATGGGATCCGGG + Intronic
1136147294 16:28322773-28322795 AGGCAGCCCCGATGGGCTCCAGG - Exonic
1136716655 16:32287868-32287890 GGGCAGGACCGCTGGGCTCTGGG + Intergenic
1136835035 16:33494113-33494135 GGGCAGGACCGCTGGGCTCTGGG + Intergenic
1136994116 16:35176534-35176556 AGGCAGAGCAGCTGTGCTCCAGG - Intergenic
1141041492 16:80676359-80676381 AGGAAGAACAGCTGGGCTCAGGG + Intronic
1142356152 16:89603017-89603039 AGCCAGGACCTAGGGGCTCCAGG - Intergenic
1203009768 16_KI270728v1_random:229919-229941 GGGCAGGACCGCTGGGCTCTGGG - Intergenic
1145908821 17:28531113-28531135 AGGTAGCACCGATGGGCCTCAGG + Intronic
1146057343 17:29588122-29588144 AGGCTCAACCGGTGGGGTCCTGG + Intronic
1146400554 17:32497261-32497283 AGAGAGGAGCGATGGGCTCCTGG - Intronic
1147944747 17:44074620-44074642 AGGCAGAACCCCGGGGCCCCTGG - Intronic
1148330534 17:46811436-46811458 TGGCAGAACCGTTGTGCACCTGG + Intronic
1151945953 17:77319980-77320002 AGGCAGACCCGGTGGTCTGCCGG + Intronic
1152693993 17:81734733-81734755 TGGCTGGACAGATGGGCTCCCGG - Intergenic
1157930005 18:51811380-51811402 AGGTAGAGCAGATGGGATCCTGG + Intergenic
1159447421 18:68557806-68557828 ATACAGAACAGCTGGGCTCCTGG - Intergenic
1161778997 19:6279318-6279340 GGGCAGATCCGAGGGGCCCCGGG + Intronic
1164431607 19:28193812-28193834 AGGAAGCACCGAGGGGATCCAGG + Intergenic
1164644204 19:29845835-29845857 AGGAAGAACTGATGGGATTCTGG - Intergenic
1164925127 19:32124413-32124435 AGGCAGCACAGATGGGTTTCTGG + Intergenic
1165318863 19:35074047-35074069 AGGCAGACCGGATGGGAACCAGG + Intergenic
1165520715 19:36311873-36311895 AGGGAGAAGCGATGCGCTCCTGG + Intergenic
1165623356 19:37266711-37266733 AGGGAGAAGCGATGCGCTCCTGG - Intergenic
925764302 2:7215800-7215822 AGGCAGAACAGATGGGTTGGCGG - Intergenic
928206617 2:29289212-29289234 AGGCACAGGCCATGGGCTCCAGG + Intronic
932128777 2:69168880-69168902 AGGCAGAAGTGAAGGCCTCCAGG - Intronic
932409760 2:71538760-71538782 AGGAAGAACTGAGAGGCTCCAGG - Intronic
937878311 2:126843549-126843571 AGGTATCACTGATGGGCTCCTGG + Intergenic
938070476 2:128305697-128305719 AGGCAGAGCAGATGGTCTCCCGG - Intronic
939550195 2:143605676-143605698 AGACAGAACTGATGGGCCACAGG + Intronic
947401054 2:229732057-229732079 ATACAGAACGGCTGGGCTCCTGG + Intergenic
947401069 2:229732136-229732158 ATACAGAACGGCTGGGCTCCTGG + Intergenic
948907935 2:240988700-240988722 AGGCAGAACCTGTGGCCTCCTGG - Intronic
1168768408 20:397699-397721 AGGAAGACCCACTGGGCTCCAGG - Intergenic
1171501969 20:25600765-25600787 AGGCAATACCGCGGGGCTCCTGG - Intergenic
1172388843 20:34552567-34552589 AGGCAGATCCCACGGCCTCCTGG + Intronic
1172780049 20:37431260-37431282 AGGAAGAACAGATGGGCTGTGGG - Intergenic
1173375320 20:42477665-42477687 AGGCAGAAACCATAGGCTCTAGG - Intronic
1174806524 20:53608490-53608512 AGGTGAAACCGACGGGCTCCAGG + Intronic
1178536059 21:33411333-33411355 AGGAAGCACCAAGGGGCTCCGGG - Intronic
1179009092 21:37540077-37540099 AAGAAGAACCTATGTGCTCCAGG + Intergenic
1180199093 21:46214100-46214122 AGGGAGAAGCGAGGGGTTCCAGG + Intronic
1181585368 22:23849943-23849965 TGGAAGAGCCGGTGGGCTCCCGG + Intergenic
1182713267 22:32335672-32335694 AGGCAGGAACAATGGGCTCTGGG - Intergenic
949365656 3:3277828-3277850 GGGCTGAAGGGATGGGCTCCCGG - Intergenic
950773915 3:15333422-15333444 ACTCAGAGCCGATGGGCTACAGG - Intronic
952328171 3:32339593-32339615 AAGCACAACCGAAGGGCTTCAGG - Intronic
953418141 3:42734611-42734633 AGGCAGGGCCGAGGGGCTCTTGG + Intronic
955063313 3:55513251-55513273 ATGCAGGACTGATGGACTCCTGG + Intronic
962266621 3:133948727-133948749 TGGCAGAACCCCTGGGCTGCAGG + Intronic
963068525 3:141282794-141282816 AGGCAGGCCCGATGGGGCCCAGG + Intronic
966690512 3:182736954-182736976 GGGCAGAGCCTACGGGCTCCTGG - Intergenic
968641230 4:1716178-1716200 AGGCAGAGGTGATGGACTCCGGG - Exonic
968974579 4:3814559-3814581 ATGCAGACCTGTTGGGCTCCAGG - Intergenic
969402257 4:6963232-6963254 AGACAGAACAGAGGGGCTGCTGG - Intronic
969489939 4:7493418-7493440 AGGCAGATCCGGTAGGATCCAGG - Intronic
969664479 4:8549262-8549284 AGGCAGAACCCATGACCTACTGG + Intergenic
975529609 4:75386539-75386561 AGCCAAAACCTATGGGCTCAGGG + Intergenic
976270151 4:83222353-83222375 AGGCAGATCAGTTGAGCTCCAGG - Intergenic
976596097 4:86896631-86896653 AGGCAGAACAAATGGACTACGGG - Intronic
976939945 4:90687636-90687658 TGGCAGAGACGAAGGGCTCCAGG - Intronic
1001235282 5:170024051-170024073 AGGCAGAAGGTTTGGGCTCCTGG + Intronic
1002429433 5:179194485-179194507 AGGCAGAGCGGATGGCCTGCGGG + Intronic
1003539302 6:7004079-7004101 AGGGAGAAACGCAGGGCTCCTGG - Intergenic
1004217001 6:13711999-13712021 GGGCAGGATCGCTGGGCTCCCGG + Intergenic
1004905601 6:20234538-20234560 AGGCAGAATTGATGGGTTCTTGG - Intergenic
1004917356 6:20344418-20344440 AGGAAGAAGCGATGGACTCTTGG - Intergenic
1008381079 6:50840439-50840461 AGGCAGAGTTGATGGGCTACAGG + Intronic
1009562952 6:65272479-65272501 ATGCAGAATGGCTGGGCTCCTGG - Intronic
1016501064 6:144721302-144721324 AGGCAGGACTGCTTGGCTCCAGG - Intronic
1019309951 7:355094-355116 AGGCAGAGCCCATGGGCCTCGGG + Intergenic
1023663092 7:42490852-42490874 AGGAGGAACAGATTGGCTCCAGG - Intergenic
1025851534 7:65248585-65248607 TGGAAGAATCGATGGGCTCACGG + Intergenic
1026236557 7:68532205-68532227 AGGAAGAAGGGAGGGGCTCCTGG + Intergenic
1026892078 7:73988218-73988240 AGGCAGAAGTCATGGCCTCCTGG - Intergenic
1029272827 7:99387011-99387033 AGGCAGAAAAGATGGGTTCTTGG - Intronic
1032369111 7:131328250-131328272 GCGCAGAACCGCTGGGCTTCCGG - Intronic
1034487117 7:151372978-151373000 AGGCAGAACAGAGTGGCTGCTGG - Intronic
1034947607 7:155273438-155273460 AGGCAGAGCGGATAGGCCCCCGG - Intergenic
1038385012 8:27135477-27135499 AGGCAGACCAGCTGGGCTCTTGG - Intergenic
1038684828 8:29706997-29707019 AGGCAGAAGCAATGGAATCCAGG + Intergenic
1041022470 8:53652141-53652163 ACACAGAACAGATGGGCTCATGG - Intergenic
1044590659 8:93911291-93911313 TGCCAGAAACGATGGGCTCTGGG - Intronic
1045221877 8:100207349-100207371 AGCCTGCACCGATGGCCTCCTGG + Intronic
1048232651 8:132659092-132659114 AATCAGAACCTGTGGGCTCCTGG - Intronic
1049268803 8:141683445-141683467 AGGCACAACCTCTGGGCTCCAGG - Intergenic
1049510216 8:143023446-143023468 AGGCTGCTCTGATGGGCTCCGGG - Intronic
1049592174 8:143467738-143467760 AGGGAGAACAGCTGGACTCCTGG - Intronic
1053348505 9:37395653-37395675 AGGCTGAACCGGTGGGCTGGAGG + Intergenic
1057185473 9:93055253-93055275 AGGAGGAACGGATGGGCTGCTGG - Intergenic
1058827884 9:108791327-108791349 ATGCAGGACCGAGGGACTCCAGG - Intergenic
1059413396 9:114148527-114148549 AGGCAGAAAGAATGGGATCCTGG - Intergenic
1060211115 9:121710942-121710964 AGGCAGGCTGGATGGGCTCCGGG - Intronic
1061445333 9:130634224-130634246 AGGCAGCACCAGTGGGCTCCTGG - Intronic
1186497621 X:10024495-10024517 AGGGAGAACCGAATGGCTCGGGG - Intronic
1187007593 X:15247772-15247794 AGGCAGAAAAGATTGACTCCAGG - Intronic
1187156521 X:16724971-16724993 AGGCAGAAGAGATGGGCTACTGG + Intronic
1187168588 X:16828649-16828671 AGGGAGAACTGCTGAGCTCCTGG + Intronic
1190127389 X:47718974-47718996 TGGCAGAACCGGTGGACACCGGG - Intergenic
1196164830 X:112527257-112527279 AGTCAGATCCTATGGGATCCTGG + Intergenic
1197925479 X:131642754-131642776 AGGAAGGAGTGATGGGCTCCAGG + Intergenic
1200210644 X:154345358-154345380 AGGCAGGACCCAGGGGCTTCCGG + Intergenic
1200220208 X:154386734-154386756 AGGCAGGACCCAGGGGCTTCCGG - Intergenic