ID: 1121314852

View in Genome Browser
Species Human (GRCh38)
Location 14:92954878-92954900
Sequence CTGGGATACCACTGGGTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 1, 2: 1, 3: 10, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121314852_1121314862 14 Left 1121314852 14:92954878-92954900 CCCCTCACCCAGTGGTATCCCAG 0: 1
1: 1
2: 1
3: 10
4: 178
Right 1121314862 14:92954915-92954937 CCCTCAGAACCCCTTATCTCAGG 0: 1
1: 0
2: 0
3: 16
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121314852 Original CRISPR CTGGGATACCACTGGGTGAG GGG (reversed) Intronic
900203541 1:1421616-1421638 CTGGGACAGGAGTGGGTGAGGGG - Intronic
900464840 1:2820632-2820654 TTGGGGTACCACGGGCTGAGGGG + Intergenic
900603722 1:3514756-3514778 TGGGGAGAGCACTGGGTGAGGGG - Intronic
903215894 1:21843104-21843126 CTGGGGTCCCCCTGGTTGAGGGG + Intronic
904769134 1:32871094-32871116 CTGGGCTCCCGCTCGGTGAGAGG - Intronic
906216544 1:44044212-44044234 CAGGGACACCACTGGGTAATGGG + Intergenic
908796618 1:67836221-67836243 TTTGAATGCCACTGGGTGAGGGG - Intergenic
911086024 1:93978205-93978227 GTGGGCTACCACTGGGAGTGAGG + Intergenic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
915069679 1:153255834-153255856 CTGGGCTAACACTGGGCTAGTGG - Intergenic
915553283 1:156647238-156647260 CGGGGATCCCACAGTGTGAGAGG + Intronic
916628411 1:166584996-166585018 CTGAGACACCACTGGGAGTGAGG + Intergenic
917214648 1:172665483-172665505 CTGGTATAGAACTGGCTGAGGGG - Intronic
917297804 1:173540097-173540119 CTGGGTTCCAACAGGGTGAGAGG - Intronic
918322485 1:183377357-183377379 CTGGAATACAACTGGGAGGGTGG + Intronic
918350268 1:183648113-183648135 CTGGGAGAGCACTGGCTGACAGG - Exonic
920309176 1:205038530-205038552 CTGGGCTAGGACTGGGTGCGTGG - Intergenic
920535075 1:206731922-206731944 GAGGGGCACCACTGGGTGAGAGG + Intronic
921795599 1:219340462-219340484 ATGGGATACCAATGGATGTGTGG + Intergenic
1063808323 10:9674039-9674061 CAAGGATGCCACTGGGTTAGAGG - Intergenic
1064194543 10:13234394-13234416 CTGGGATACCACTGGGGGAGAGG + Intergenic
1064874483 10:19977439-19977461 CTAGGAGGCCACTGGGGGAGGGG + Intronic
1068572203 10:58642563-58642585 CTGGGAGACCACTGGCTGAGTGG - Intronic
1069555967 10:69398865-69398887 CTGGGATCCCTTTGGGTTAGGGG + Intronic
1070556146 10:77529249-77529271 CTGGGAAACCACAGGCAGAGTGG - Intronic
1070661239 10:78306816-78306838 CTGGGAGGCACCTGGGTGAGTGG + Intergenic
1070715176 10:78715171-78715193 CTGGGATACCTCTGCTTGTGGGG - Intergenic
1071989716 10:91089467-91089489 CTGGCACACCACATGGTGAGAGG - Intergenic
1072630044 10:97139579-97139601 CTGGGACACCACTGGTTGTTTGG + Intronic
1072918679 10:99557168-99557190 CTTGGATACCACTGAGTCATGGG - Intergenic
1074163881 10:110858011-110858033 CAGGGAGACAGCTGGGTGAGAGG + Intergenic
1074315775 10:112360442-112360464 CTGTGATCACACTGGGGGAGAGG + Intergenic
1075104842 10:119532264-119532286 GAGAGATGCCACTGGGTGAGTGG - Intronic
1075395420 10:122123500-122123522 TTGGCATTCCTCTGGGTGAGGGG - Intronic
1075661416 10:124199572-124199594 CTGGGTCACCCCTGGGTCAGTGG + Intergenic
1076789155 10:132767681-132767703 CTGGAATGCCACTGGGCGCGAGG - Intronic
1076789189 10:132767807-132767829 CTGGAATGCCACTGGGCGCGTGG - Intronic
1076789206 10:132767870-132767892 CTGGAATGCCATTGGGTGCGTGG - Intronic
1076789224 10:132767933-132767955 CTGGAATGCCACTGGGCGCGTGG - Intronic
1076789255 10:132768060-132768082 CTGGAATGCCATTGGGTGCGTGG - Intronic
1076789305 10:132768250-132768272 CTGGAATGCCACTGGGCGCGTGG - Intronic
1076820572 10:132936794-132936816 CTGGGAGACCTCAGGGTGTGGGG - Intronic
1080815129 11:35748169-35748191 CTGGGTCACTTCTGGGTGAGTGG - Intronic
1081293174 11:41351357-41351379 CTGGGATGCCAATGAGTGATAGG - Intronic
1082585752 11:54937507-54937529 CTGGGAAACCACTTTGTGATGGG - Intergenic
1083203171 11:61132189-61132211 CTGGGACACTACTGGGAAAGGGG + Exonic
1083651716 11:64208135-64208157 CTGGGCTGCCAGTGGGTGGGGGG + Intronic
1083925997 11:65806942-65806964 CTGGGATGGCAATGGGTGGGAGG + Intergenic
1083951752 11:65960349-65960371 CTGAGCAACCACTGGGTGAGGGG + Intergenic
1086406848 11:86505894-86505916 CTGCGGTACCACAGGGTGGGTGG + Intronic
1089384406 11:118058514-118058536 GTGCGAAACCACAGGGTGAGAGG + Intergenic
1090418104 11:126554880-126554902 CAGGGATACAAGTGGCTGAGTGG + Intronic
1090509401 11:127358065-127358087 CTAGGACACCCCTGGGGGAGGGG - Intergenic
1096080559 12:48829693-48829715 GAGGGACACCACTGGGTGCGGGG - Intergenic
1096808139 12:54152888-54152910 GTGGCAGGCCACTGGGTGAGGGG + Intergenic
1104210708 12:126685743-126685765 TTAGGATAGCACTGGGGGAGGGG - Intergenic
1109008795 13:56912439-56912461 CTGGGATATCACTTACTGAGAGG - Intergenic
1109232037 13:59769238-59769260 CTGGTATACCACTGAGTGACTGG - Intronic
1111179902 13:84650835-84650857 CTGGGATTCCCCTGGCTGAGGGG - Intergenic
1113837987 13:113341894-113341916 CTGGGAGGCCACAAGGTGAGAGG - Intronic
1115427935 14:33282486-33282508 CTGGGAGAATCCTGGGTGAGAGG + Intronic
1115614260 14:35078320-35078342 CTGGGATATCACTGGGCTGGAGG - Intronic
1117011375 14:51473874-51473896 CTGGGATAGCTCTAGGTCAGGGG - Intergenic
1121314852 14:92954878-92954900 CTGGGATACCACTGGGTGAGGGG - Intronic
1122263542 14:100536359-100536381 CTGGGATGGCACAGGGTGTGGGG + Intergenic
1122902109 14:104786259-104786281 CTGGGAACCCACTGGGTGGAGGG - Intronic
1123629887 15:22254266-22254288 ATTGGTTACCACTGGGTGTGAGG - Intergenic
1124823323 15:33068961-33068983 CTGGGACACCAAAGGGGGAGAGG - Intronic
1125744435 15:41989067-41989089 CAGGGAGACCACAGGGTAAGGGG - Intronic
1126981460 15:54248861-54248883 CTGGGAAAACACAGAGTGAGAGG + Intronic
1127671570 15:61199902-61199924 CTGGGATACACCTGGGTGAAGGG + Intronic
1128675474 15:69605330-69605352 CTGGTATTCAACTGGGAGAGAGG - Intergenic
1129613244 15:77078132-77078154 CTGAGTGACCAATGGGTGAGTGG + Intronic
1130332300 15:82932005-82932027 CTAGGAACACACTGGGTGAGGGG + Intronic
1132744092 16:1429579-1429601 GTTGGATGTCACTGGGTGAGAGG + Intergenic
1135913434 16:26581739-26581761 CTGGCATACCACATGGTGAGAGG + Intergenic
1138036265 16:53609721-53609743 CTGGGATAACCCTGGGGGACTGG + Intronic
1139280775 16:65768651-65768673 CTGGGGTCCCATTGGTTGAGAGG - Intergenic
1139595902 16:67958126-67958148 CTGGGGCCCCACTGGGGGAGGGG - Intronic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1140043401 16:71424422-71424444 CTGGGGTAGGACTGGGTAAGTGG + Intergenic
1141973255 16:87496489-87496511 ATTGGCTACCACTGGGTGTGAGG + Intergenic
1142630148 17:1220362-1220384 CTGAGATAACACTGTCTGAGGGG - Intronic
1143769278 17:9157702-9157724 CTGGGGTACCCCTGGATAAGAGG + Intronic
1146465118 17:33080138-33080160 CTGGAGTACCACTAGGTAAGGGG + Intronic
1146956656 17:36939978-36940000 CTGGGATAACGCTGGGAGTGAGG + Intronic
1147614401 17:41819740-41819762 CTGGAATCCCACTGTGGGAGGGG - Intronic
1148054586 17:44786629-44786651 CTGGGCCACCACTGGGTGCAGGG + Intergenic
1148215617 17:45832728-45832750 CTGGGTGCCCACTGGGTGACAGG + Intronic
1148328726 17:46799992-46800014 CTGGGAGATCACAGAGTGAGGGG + Intronic
1148786443 17:50148379-50148401 CTGGGATCCCCCTGGGTGCCTGG - Intronic
1149450459 17:56746098-56746120 CTGGGATCCCACTGGGCTAATGG - Intergenic
1151437294 17:74105752-74105774 CTGGGAAGCCACAGGGTGTGGGG - Intergenic
1153622109 18:6989218-6989240 CTGGGATCCCACATGGGGAGAGG + Intronic
1154358202 18:13638741-13638763 CTGGAATGCCAGTGGGTTAGAGG - Intronic
1155238456 18:23844108-23844130 CTGGAATACCACCTGGTGTGTGG + Intronic
1156450299 18:37262853-37262875 CTGGGCTACCACTGGTGAAGTGG - Intronic
1156462299 18:37327816-37327838 CAGAGACAGCACTGGGTGAGGGG - Intronic
1156961758 18:43040478-43040500 CTGAGAGACCACTTGATGAGAGG - Intronic
1157220614 18:45826267-45826289 CAGGAATCCCAGTGGGTGAGTGG + Intronic
1157567252 18:48687871-48687893 CTGGGCTACCACTGGGGGTGGGG - Intronic
1159517106 18:69471616-69471638 CTGTGTTACAACTGGGTGGGGGG + Intronic
1160902202 19:1434185-1434207 CAGTGACACCACTGGCTGAGGGG - Intronic
1163371447 19:16903480-16903502 CTGGGGTTCCACTGTGTGATTGG + Intronic
1166315173 19:41985536-41985558 CTGGGTGCCCAGTGGGTGAGTGG + Intronic
1166652730 19:44586613-44586635 CTGGAATTTCCCTGGGTGAGGGG - Intergenic
1167285068 19:48594550-48594572 CTGGGCTGCCCCTGGGTGTGAGG + Intronic
925572693 2:5328980-5329002 CTGGTATCCCACTGGTTGGGAGG + Intergenic
927703128 2:25280499-25280521 AAGGGAGTCCACTGGGTGAGGGG - Intronic
927990435 2:27443216-27443238 CTCTGGTACCACTGGATGAGGGG + Exonic
929874819 2:45787601-45787623 ATGGGATACCCCTGGTTGAAGGG - Intronic
933991860 2:87639685-87639707 CTGAGAGGCCACTGGGTGAGGGG - Intergenic
935653060 2:105398793-105398815 CGGGAAGACCACTGGGAGAGGGG - Intronic
936301984 2:111311133-111311155 CTGAGAGGCCACTGGGTGAGGGG + Intergenic
942365312 2:175219992-175220014 ATGGGATTTCACTGGGAGAGGGG + Intergenic
945829025 2:214760566-214760588 CTCGGATGTCACTGGGAGAGAGG - Intronic
1168836924 20:883730-883752 CTGGGTTACCAGTGGGTTAGTGG + Intronic
1169580047 20:7011436-7011458 CTGGGAGAGGACTGGCTGAGTGG + Intergenic
1171019311 20:21570849-21570871 CTGGGGTGGCACTGAGTGAGAGG + Intergenic
1173182074 20:40813216-40813238 CTGGGACCCCACTGGGGGAAAGG + Intergenic
1174841589 20:53906221-53906243 CTGAGAAACCACTGGGGGTGTGG + Intergenic
1175106136 20:56616416-56616438 CTGAGAAACCACGGGGAGAGAGG - Intergenic
1175255238 20:57640845-57640867 CTTGCATACCACTGGGTCATGGG - Intergenic
1175996555 20:62814606-62814628 CTGGGGCACCCCTGGGTGGGAGG + Intergenic
1179175820 21:39007165-39007187 CTGGGATCCCCCTCTGTGAGGGG - Intergenic
1180673318 22:17570147-17570169 CTGGGATACCCCATGGTCAGGGG - Intronic
1181106910 22:20581119-20581141 CTGGGAGACCAGGGGGTGGGGGG - Intronic
1181762957 22:25070402-25070424 TTGCGCTACCTCTGGGTGAGTGG + Intronic
1184843403 22:47065899-47065921 CTGGGAATACACTGAGTGAGTGG + Intronic
952407237 3:33015506-33015528 CTGGGATTCCACTGGGAATGGGG - Intronic
954129012 3:48550293-48550315 CTGAGAGACCACAGGCTGAGAGG - Intronic
958697816 3:97548935-97548957 CTAGGATGTCACTGGGTGATAGG - Intronic
959967171 3:112369356-112369378 CTATGACACCACTAGGTGAGAGG - Intergenic
961735158 3:128996855-128996877 CTGGTGTACCACTGGGGGCGGGG - Intronic
965365129 3:167788647-167788669 CTGGGTTACCAACTGGTGAGCGG - Intronic
968487143 4:868141-868163 CTGGGAGCCCACTGGGGGTGTGG + Intronic
968540588 4:1166368-1166390 CTGGGGTTCCACCAGGTGAGTGG + Intergenic
968969361 4:3785517-3785539 CTGGGTTACTGCTGGGGGAGTGG - Intergenic
969103900 4:4790646-4790668 TTGGGAGAGCCCTGGGTGAGTGG - Intergenic
970518088 4:16853968-16853990 CAGGGATAGCAGGGGGTGAGCGG + Intronic
976981942 4:91243044-91243066 CATGGCTACCACTGGGAGAGGGG - Intronic
981073114 4:140565910-140565932 CTGGGATGTCACTAGGTGATAGG - Intronic
982076041 4:151738035-151738057 CTGGGGTACCACGCTGTGAGAGG + Intronic
986969507 5:13315635-13315657 CTGGGATGCAGCAGGGTGAGAGG - Intergenic
987542303 5:19271243-19271265 TTGGAATACCAATGGCTGAGAGG + Intergenic
989168561 5:38453616-38453638 CTGGGCTAGCAATGGGTGGGAGG - Intronic
989701617 5:44272838-44272860 CTGGTGTAACACTGGATGAGTGG + Intergenic
990190285 5:53251971-53251993 CTAGGACATCACTGGGTGATAGG + Intergenic
990675941 5:58184763-58184785 CTGGGTTACAACTGGGTTATCGG + Intergenic
993102864 5:83562832-83562854 CTGTGAGACCACTGTGAGAGAGG - Intronic
997047447 5:130335344-130335366 CCATGATATCACTGGGTGAGAGG + Intergenic
997922930 5:137999802-137999824 CTGTGTTACCACTGAGTGAAAGG + Intronic
999429364 5:151512563-151512585 CTGGAATACCACTGTCTGGGTGG - Exonic
1001596178 5:172900341-172900363 CCGGGATGCCGCTGGGAGAGAGG - Intronic
1003192886 6:3889774-3889796 CTGGGATACCCCTGGCCAAGAGG - Intergenic
1004456973 6:15800426-15800448 CTGGGAAACCACTGGCTTAGTGG - Intergenic
1005439388 6:25849456-25849478 CTGGAATACCTGTGGGTGACAGG + Exonic
1007814523 6:44511453-44511475 CCGAGATATCACTGGATGAGGGG + Intergenic
1007913994 6:45543506-45543528 CAGGCATATCACTGGGGGAGTGG + Intronic
1009261787 6:61499982-61500004 CTGAGAAACCACTTGGTGATAGG - Intergenic
1013532185 6:111030167-111030189 CTGGGTTCCAGCTGGGTGAGAGG - Intergenic
1017782346 6:157725661-157725683 CAGGGATACAAGTGGCTGAGTGG + Intronic
1017791676 6:157805228-157805250 CTGGGACACCAATGAGTCAGAGG - Intronic
1022241384 7:28515962-28515984 CTGGGAGGCCTCGGGGTGAGAGG + Intronic
1023181883 7:37492739-37492761 CTGGGAACCCACTGGGAGGGAGG + Intergenic
1023281236 7:38572735-38572757 CTGGGAGACCAGAGGGTCAGAGG - Intronic
1023771997 7:43566337-43566359 CTGGGATGACACTGGGTGTTAGG - Intergenic
1023791037 7:43753990-43754012 CTGAGATACCACCAGGGGAGGGG - Intergenic
1025528850 7:61850650-61850672 CTGGGAAACCACTTTGTGATGGG - Intergenic
1026457631 7:70586577-70586599 CTGGGATAGCACTGGTAGACAGG + Intronic
1033784055 7:144708525-144708547 CTGTGACATCACTGGGTGATAGG - Intronic
1037632948 8:20674819-20674841 TTGATAAACCACTGGGTGAGGGG + Intergenic
1038606720 8:29014087-29014109 CAGGGTTAGCTCTGGGTGAGGGG - Intronic
1039368189 8:36955375-36955397 CTGGGATGCCACCTGCTGAGGGG + Intergenic
1040332638 8:46397708-46397730 CTGTGATACCACTTTGTGGGGGG - Intergenic
1042103184 8:65296548-65296570 CTGGGAGAAGACTGGGAGAGGGG - Intergenic
1044257997 8:90088521-90088543 ATGGGAAACCACTGGATGAAAGG - Intronic
1044430500 8:92102208-92102230 CTGGGAAGCTCCTGGGTGAGCGG - Intronic
1049076092 8:140397207-140397229 CTGGGTTACCACTGTGTCAAAGG + Intronic
1050410580 9:5360918-5360940 CTAGGACACCACTGTGTGAAAGG + Intronic
1050770615 9:9194498-9194520 CTGTGATGTCACTGGGTGACAGG + Intronic
1053593304 9:39534309-39534331 CTTGGAGACCCCTGGGGGAGGGG - Intergenic
1053851037 9:42289017-42289039 CTTGGAGACCCCTGGGGGAGGGG - Intergenic
1054573002 9:66830968-66830990 CTTGGAGACCCCTGGGGGAGGGG + Intergenic
1055925655 9:81507649-81507671 GTGGGAGCCCACTGGGGGAGGGG - Intergenic
1056769227 9:89464810-89464832 CTGAGTTACCACGGGGTGTGGGG + Intronic
1057197028 9:93120992-93121014 CCAGGTTTCCACTGGGTGAGGGG + Intergenic
1187716177 X:22104631-22104653 CTAGCACATCACTGGGTGAGGGG + Intronic
1188972596 X:36636115-36636137 GTGGGTTGCCATTGGGTGAGAGG - Intergenic
1192945590 X:75963224-75963246 CTGGTAGACCACTGGGTCAAGGG - Intergenic
1197377841 X:125704317-125704339 CTGGGATACCAGTGCGTTATAGG + Intergenic