ID: 1121315379

View in Genome Browser
Species Human (GRCh38)
Location 14:92958232-92958254
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 2, 1: 0, 2: 0, 3: 7, 4: 115}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121315373_1121315379 9 Left 1121315373 14:92958200-92958222 CCTGATGTGCCTGCGGAGAAGTT 0: 1
1: 0
2: 0
3: 1
4: 74
Right 1121315379 14:92958232-92958254 GGGCCTCTGGACCACGGTGTAGG 0: 2
1: 0
2: 0
3: 7
4: 115
1121315374_1121315379 0 Left 1121315374 14:92958209-92958231 CCTGCGGAGAAGTTCTTGAGTGA 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1121315379 14:92958232-92958254 GGGCCTCTGGACCACGGTGTAGG 0: 2
1: 0
2: 0
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903294078 1:22332569-22332591 GGGCCTCTGGAGAATGTTGTTGG + Intergenic
904165742 1:28553571-28553593 GGGGCTCTGGAACCCGGAGTGGG + Intronic
906056881 1:42924606-42924628 GGCACTCTGGACCACGCTGAGGG + Intergenic
906713720 1:47951724-47951746 AAGCCTCTGGACCAAGGTGAGGG - Intronic
914347358 1:146811328-146811350 GGGTTTCAGGACCATGGTGTTGG - Intergenic
920272113 1:204773445-204773467 GGGGCTCTGGACCATGGGGCAGG + Intergenic
922580401 1:226693089-226693111 GGGCTTCTGGACCACCCTGGAGG - Intronic
1067663495 10:48254273-48254295 TGGCCTCAGGACTACAGTGTGGG + Intronic
1067792130 10:49296374-49296396 AGGCCTCTGGAACACTGTGAGGG - Intergenic
1069689091 10:70337831-70337853 GGGCCTCCGGACCTAGGTCTGGG + Intronic
1070005389 10:72419491-72419513 GGACCTCTGAACCAGGCTGTGGG - Intronic
1075312455 10:121426081-121426103 GGTGCTCTGGACCAAGGTTTTGG - Intergenic
1076242682 10:128921621-128921643 GGGCCACTGAGCCACGGGGTAGG - Intergenic
1077284763 11:1760748-1760770 GGGGCTCTGGCCCACTGTGGGGG - Intronic
1077338422 11:2015620-2015642 GGGCTCCGGGACCAAGGTGTGGG - Intergenic
1077484564 11:2832846-2832868 GGCCCTGTGGACCACGGCGGTGG - Intronic
1078437060 11:11334064-11334086 GAGCATATGGACCACAGTGTCGG - Intronic
1078549592 11:12270987-12271009 GGGCCTCTGGACCTGGCTGTTGG + Intergenic
1078951012 11:16134322-16134344 GGGGCCCTGGGCCACGTTGTAGG + Intronic
1081623464 11:44632866-44632888 ATGCCCCTGGCCCACGGTGTGGG + Intergenic
1083463603 11:62831531-62831553 GAGTCTCAGGACCACGGGGTTGG - Intronic
1085295893 11:75431450-75431472 GGGCCGCTGGACCCAGGTGGAGG + Intergenic
1086345054 11:85887472-85887494 GGGCCTCTGCACCACAGTGGTGG + Intronic
1089110972 11:116055761-116055783 GGGCCACGGGACCACTGTGGAGG + Intergenic
1202821406 11_KI270721v1_random:70802-70824 GGGCTCCGGGACCAAGGTGTGGG - Intergenic
1101621156 12:106389862-106389884 TGGCCTCTGCACCCCGGTCTGGG + Intronic
1102257581 12:111425139-111425161 GGGCCTGTGGAGCAGGGTGATGG + Intronic
1103879488 12:124155056-124155078 TGGCCTCTGGACCCCACTGTGGG - Intronic
1104902976 12:132199091-132199113 GTGCCTCTGCCCCAGGGTGTAGG + Intronic
1113606507 13:111611238-111611260 GGGCCTCTGGAAGGCAGTGTTGG + Intronic
1113869170 13:113547514-113547536 GGGCCACTGGACCCCGGGGGAGG + Intronic
1121315379 14:92958232-92958254 GGGCCTCTGGACCACGGTGTAGG + Exonic
1121586256 14:95064910-95064932 GGGCCTCTGGACCCCAGCATAGG - Intergenic
1122416917 14:101554444-101554466 GTGGCTCTGGCCCACGGTGCTGG + Intergenic
1122422020 14:101583720-101583742 GGGCATCTGGATGAGGGTGTTGG + Intergenic
1202903556 14_GL000194v1_random:56233-56255 GGGCCTCTGGGCCAGGCTGGGGG + Intergenic
1123574328 15:21651748-21651770 TGGCTTCAGGACCAGGGTGTTGG + Intergenic
1123610943 15:22094335-22094357 TGGCTTCAGGACCAGGGTGTTGG + Intergenic
1131524095 15:93139008-93139030 TAGCCACTGGACCACTGTGTGGG - Intergenic
1202983192 15_KI270727v1_random:386091-386113 TGGCTTCAGGACCAGGGTGTTGG + Intergenic
1133025475 16:2987331-2987353 GGCCTTCTGGACCAGGGTGCAGG + Intergenic
1139464529 16:67147190-67147212 GGGCCTCTGTACCACCCTGTGGG + Exonic
1139986629 16:70903917-70903939 GGGTTTCAGGACCATGGTGTTGG + Exonic
1142414149 16:89932303-89932325 GGGCCTGGGGACCTGGGTGTGGG + Intronic
1143125337 17:4638295-4638317 GCGCCTCAGCACCACGGGGTTGG + Exonic
1143403167 17:6658814-6658836 GCGCCTCAGCACCACGGGGTTGG - Intergenic
1146290660 17:31604646-31604668 GGGCCTCTGGGCCCAGGTGTTGG + Intergenic
1148556362 17:48581195-48581217 GGGTCTCTGGACCTAGTTGTGGG - Intronic
1149480117 17:56996560-56996582 GGGCCACTGCACTACAGTGTGGG - Intronic
1150648138 17:66992626-66992648 GGGGCTCTGAACCACGCTCTGGG - Intronic
1152386930 17:79980327-79980349 GGGCTTCTTGACCACCATGTAGG + Intronic
1152756333 17:82088593-82088615 GAGCCCCTGGACCCCGGTGACGG - Intronic
1153764937 18:8366306-8366328 TGGTCTCTGGACCACACTGTGGG - Intronic
1157914505 18:51651655-51651677 GGGCGTCTGGCCCCCGGTGGAGG + Intergenic
1160832664 19:1110988-1111010 GCGCCTCTGGGCCTGGGTGTGGG + Intronic
1161915604 19:7225755-7225777 GGACCCCTGGACCAGGGTGCTGG - Intronic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1167716035 19:51143417-51143439 CGGCCTCTGGACCATCGTGGAGG - Intronic
1167768706 19:51500676-51500698 CGGCCTCTGGACCATCGTGGAGG + Intronic
925050099 2:806840-806862 GGGCCTCTGAGCCATGGTGAAGG + Intergenic
927267194 2:21163452-21163474 GGGGCTCTGGACCTGGGGGTGGG + Intergenic
927583540 2:24277935-24277957 TGGCCTGTGGACCACGGGTTGGG + Intronic
929565335 2:42980241-42980263 GGGGCACTGGAGCACAGTGTGGG + Intergenic
944540384 2:200748636-200748658 GGGCCTCTGGCACAGGGTTTGGG - Intergenic
946584506 2:221169810-221169832 CGGTCTATGGACCAGGGTGTGGG - Intergenic
1174289468 20:49497492-49497514 GGAGCTCTGAACCACTGTGTAGG + Intergenic
1176180424 20:63747147-63747169 GGGCCCCTGGACCATGGCGGCGG - Exonic
1176622923 21:9071001-9071023 GGGCCTCTGGGCCAGGCTGGGGG + Intergenic
1179486257 21:41712527-41712549 GGGCCTCTGGCCCCAGGTCTGGG + Intergenic
1179912347 21:44456835-44456857 GAGCTTCAGGAGCACGGTGTTGG - Exonic
1179923160 21:44518420-44518442 GGGCTTTAGGATCACGGTGTTGG + Intronic
1183924640 22:41197287-41197309 GAGCCTCTGGACCACTGAGCTGG - Intergenic
1185095749 22:48805092-48805114 GGCCTCCTGGACCACGGTGCTGG + Intronic
1185219473 22:49622309-49622331 GGGCCTTTGGTCCCCGGCGTGGG - Intronic
950964428 3:17136499-17136521 GGGACTGTGGCCCACTGTGTGGG + Intergenic
954701912 3:52455059-52455081 GGGCTTCTGGACAACTGAGTGGG - Intergenic
956921821 3:73937946-73937968 GTGTCTCTGGACCATGATGTGGG + Intergenic
959068905 3:101684655-101684677 GTGCCTGTGGACCACGGGGTAGG + Intronic
961547346 3:127644528-127644550 TGGCCTCAGGACCACAGTGGAGG + Intronic
962242252 3:133759582-133759604 GGGAGGCTGGACCATGGTGTGGG + Intronic
964110584 3:153083237-153083259 AAGCCTCTGGACCACATTGTGGG + Intergenic
966860905 3:184230444-184230466 TGGCCTCTGGAGCGCGGGGTGGG + Exonic
968577499 4:1374707-1374729 GGGCCACTGGACCAAGGTCTTGG - Intronic
969074273 4:4565065-4565087 GGGACTCTGGCCCAGGATGTGGG + Intergenic
969653168 4:8479633-8479655 GGGCCTGTGGACAAGGCTGTGGG + Intronic
969704234 4:8783318-8783340 GGGCCTCTGCGACACGGTGAGGG - Intergenic
978112962 4:104985074-104985096 GGGCAACTGGAACACGGTATTGG - Intergenic
980827870 4:138093739-138093761 GGGTCTCTGCACCATGGAGTAGG - Intergenic
984882825 4:184425482-184425504 GGGCCTCGGGGCCACAGTGCAGG + Intronic
985867744 5:2528597-2528619 GGGACCCTGGATCACGGGGTTGG - Intergenic
986030446 5:3888523-3888545 GAGCCTCAGGAACACGATGTAGG + Intergenic
986143204 5:5050860-5050882 GGGCCTCTGGATGGGGGTGTGGG + Intergenic
995991670 5:118247389-118247411 GGGCCTATGGGTCACAGTGTGGG - Intergenic
996535143 5:124570046-124570068 GGACGCCTGGACCACGGTGGAGG + Intergenic
997673331 5:135694276-135694298 GGGCCTCTGGAAGCCTGTGTGGG - Intergenic
999239415 5:150118875-150118897 GGGCCTCTGGCCCAGGGTTCAGG + Intronic
1001426485 5:171625919-171625941 GGTCCTCAGGACCACACTGTTGG - Intergenic
1004285571 6:14317802-14317824 ATGCATCAGGACCACGGTGTTGG + Intergenic
1005957221 6:30672628-30672650 GAGACTCTGGAACAAGGTGTCGG - Exonic
1007530541 6:42538011-42538033 GGGCCACTGGAACAAGGTCTGGG - Intergenic
1007549862 6:42720903-42720925 GAGACTCTCGACCACTGTGTCGG - Intronic
1014103059 6:117533034-117533056 GGACGTCTGGACCACAGGGTAGG - Intronic
1019008173 6:168821040-168821062 GGGCATCTGGAACACCGTGAGGG - Intergenic
1019551007 7:1602552-1602574 GGGCCTCTGGTCCTCGGCGCTGG - Intergenic
1019835476 7:3378830-3378852 GGGCTTCTGCTCCACGGAGTTGG + Intronic
1030961364 7:115927551-115927573 TGGCCTCTGGACCAGGAAGTGGG + Intergenic
1037630269 8:20649441-20649463 GGTCCTCTGGACCAGGGCGGTGG + Intergenic
1041222483 8:55665497-55665519 GGGTCTCTTTACCAGGGTGTGGG + Intergenic
1047927201 8:129693395-129693417 GTGCCTCTGGGCCAGGGTGGAGG + Intergenic
1049657601 8:143805627-143805649 GGTCCTCTGAAACCCGGTGTGGG + Intronic
1050187506 9:2990388-2990410 GGCCCTCAGGAACACGATGTTGG + Intergenic
1053050825 9:34958979-34959001 CCACCTCTGGGCCACGGTGTGGG - Intronic
1057193437 9:93100038-93100060 GGGGCTGGGGACCACGGTGATGG - Intronic
1060228219 9:121809004-121809026 GGGCCCCAGGACCCTGGTGTGGG - Intergenic
1060482699 9:124026514-124026536 GGGCATGTGGAGCAAGGTGTGGG + Intronic
1061115509 9:128608280-128608302 AGGCCTCTGGACCATGGAGTTGG + Intronic
1061321655 9:129834881-129834903 CGTCCTCTGGACCACTGTGCTGG - Intronic
1061681577 9:132245096-132245118 TGCCCTCTGCACCACCGTGTGGG - Intergenic
1062316959 9:135972041-135972063 GTGCCTCTGGACCTGGGTGCAGG - Intergenic
1062544113 9:137054069-137054091 GGGCCGCGGGACCGCGGGGTAGG + Intergenic
1203746110 Un_GL000218v1:41428-41450 GGGCCTCTGGGCCAGGCTGGGGG + Intergenic
1190051979 X:47157253-47157275 GGGCCTCTGGACCACGGTGTAGG + Intronic
1191720569 X:64225155-64225177 TGGCCTCTGCACCATGGTCTAGG + Exonic
1201159436 Y:11156441-11156463 GGGCCTCTGGGCCAGGCTGGGGG + Intergenic