ID: 1121316624

View in Genome Browser
Species Human (GRCh38)
Location 14:92964692-92964714
Sequence GGAGGCTGCTGGGGTCAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 288}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121316608_1121316624 18 Left 1121316608 14:92964651-92964673 CCTGGGCTCCACCCTTGGCCCCT 0: 1
1: 0
2: 5
3: 69
4: 570
Right 1121316624 14:92964692-92964714 GGAGGCTGCTGGGGTCAAACAGG 0: 1
1: 0
2: 2
3: 28
4: 288
1121316607_1121316624 22 Left 1121316607 14:92964647-92964669 CCAGCCTGGGCTCCACCCTTGGC 0: 1
1: 0
2: 17
3: 67
4: 639
Right 1121316624 14:92964692-92964714 GGAGGCTGCTGGGGTCAAACAGG 0: 1
1: 0
2: 2
3: 28
4: 288
1121316609_1121316624 10 Left 1121316609 14:92964659-92964681 CCACCCTTGGCCCCTCCTCCCAC 0: 1
1: 0
2: 8
3: 130
4: 1247
Right 1121316624 14:92964692-92964714 GGAGGCTGCTGGGGTCAAACAGG 0: 1
1: 0
2: 2
3: 28
4: 288
1121316615_1121316624 -2 Left 1121316615 14:92964671-92964693 CCTCCTCCCACAGGAAGATTTGG 0: 1
1: 0
2: 1
3: 21
4: 258
Right 1121316624 14:92964692-92964714 GGAGGCTGCTGGGGTCAAACAGG 0: 1
1: 0
2: 2
3: 28
4: 288
1121316614_1121316624 -1 Left 1121316614 14:92964670-92964692 CCCTCCTCCCACAGGAAGATTTG 0: 1
1: 0
2: 2
3: 20
4: 263
Right 1121316624 14:92964692-92964714 GGAGGCTGCTGGGGTCAAACAGG 0: 1
1: 0
2: 2
3: 28
4: 288
1121316619_1121316624 -8 Left 1121316619 14:92964677-92964699 CCCACAGGAAGATTTGGAGGCTG 0: 1
1: 0
2: 0
3: 19
4: 195
Right 1121316624 14:92964692-92964714 GGAGGCTGCTGGGGTCAAACAGG 0: 1
1: 0
2: 2
3: 28
4: 288
1121316617_1121316624 -5 Left 1121316617 14:92964674-92964696 CCTCCCACAGGAAGATTTGGAGG 0: 1
1: 0
2: 2
3: 19
4: 166
Right 1121316624 14:92964692-92964714 GGAGGCTGCTGGGGTCAAACAGG 0: 1
1: 0
2: 2
3: 28
4: 288
1121316613_1121316624 0 Left 1121316613 14:92964669-92964691 CCCCTCCTCCCACAGGAAGATTT 0: 1
1: 1
2: 2
3: 23
4: 315
Right 1121316624 14:92964692-92964714 GGAGGCTGCTGGGGTCAAACAGG 0: 1
1: 0
2: 2
3: 28
4: 288
1121316620_1121316624 -9 Left 1121316620 14:92964678-92964700 CCACAGGAAGATTTGGAGGCTGC 0: 1
1: 0
2: 2
3: 14
4: 208
Right 1121316624 14:92964692-92964714 GGAGGCTGCTGGGGTCAAACAGG 0: 1
1: 0
2: 2
3: 28
4: 288
1121316612_1121316624 6 Left 1121316612 14:92964663-92964685 CCTTGGCCCCTCCTCCCACAGGA 0: 1
1: 0
2: 6
3: 75
4: 604
Right 1121316624 14:92964692-92964714 GGAGGCTGCTGGGGTCAAACAGG 0: 1
1: 0
2: 2
3: 28
4: 288
1121316610_1121316624 7 Left 1121316610 14:92964662-92964684 CCCTTGGCCCCTCCTCCCACAGG 0: 1
1: 0
2: 3
3: 49
4: 541
Right 1121316624 14:92964692-92964714 GGAGGCTGCTGGGGTCAAACAGG 0: 1
1: 0
2: 2
3: 28
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121316624 Original CRISPR GGAGGCTGCTGGGGTCAAAC AGG Intronic
901050034 1:6421327-6421349 GGAGGCCTATGGAGTCAAACTGG - Intronic
901712441 1:11126298-11126320 GGAGGCAGCTGGGTGCAAGCAGG - Intronic
902877582 1:19350056-19350078 GGCGCCTGCTGGGGACACACGGG - Intronic
903459381 1:23509852-23509874 GCAGGCTGCTGGGGGCAGGCAGG + Exonic
903713934 1:25348947-25348969 GCAGGCTGCTGGGCTCAGGCAGG + Intronic
904436650 1:30502990-30503012 GGAGCCTGCTGGGCTCCACCTGG + Intergenic
904500645 1:30910803-30910825 GGAGGCTGATGGGGTGCAATAGG + Intergenic
905304858 1:37010582-37010604 GGAGACTGCTGGGGTAATCCTGG - Intronic
905897512 1:41558265-41558287 GGAGGTGGCTGGGCTCCAACAGG - Intronic
906297214 1:44656114-44656136 GGAGAGTGCTGGGGTCAGACAGG + Intronic
906956258 1:50377417-50377439 GGAGGCTGCTGTGATCTAAAGGG + Intergenic
907364308 1:53946391-53946413 GGAGGGGGCTGGGGGCAACCAGG - Exonic
910927315 1:92410410-92410432 GTTGGCTGCTGGGGACAAGCAGG - Intergenic
911206366 1:95095209-95095231 GAAGACTGCTGGGGTCACACAGG + Intergenic
912960081 1:114188439-114188461 GGAGGCTGCTGAGGACAGAAGGG + Intergenic
913172269 1:116243704-116243726 GCAGGGTGCTGGGGGCACACTGG - Intergenic
914492799 1:148162629-148162651 GGAGGCTCCCGGGGTGAGACCGG + Intergenic
915097901 1:153476685-153476707 AGAGTCTGCTGGGGTCTGACAGG + Intergenic
915894713 1:159802825-159802847 GGAGGCTGCTGGGGGCAACAGGG + Intronic
915931900 1:160065907-160065929 GGAGGCTGCTGTGGGCATCCAGG + Intronic
919745224 1:201004544-201004566 GAGGGCTGCTGGGGCCAAAGAGG - Intronic
919768477 1:201142191-201142213 GCAGGAGGCTGGGGGCAAACTGG + Intronic
920244872 1:204579921-204579943 GGAAGCTGCGGAAGTCAAACTGG - Intergenic
1063547525 10:6996842-6996864 GGAGGCTTCTGAGGTCAAAAGGG + Intergenic
1064163998 10:12971540-12971562 AGAGGCTGCTGGGGACAATAGGG - Intronic
1067048060 10:42996945-42996967 AGAGGCTGCTGGGATGAAAAAGG - Intergenic
1069996214 10:72343603-72343625 GCAGGCTGCGGGGGACCAACAGG + Intronic
1070257298 10:74824349-74824371 TGAGGCTGCAGGAGTCAACCAGG + Intergenic
1071524305 10:86349242-86349264 GGAGGCTGCTGGGGGAAGAGGGG + Intronic
1072924951 10:99609025-99609047 GGAGGCTGCTGTGGTAATCCAGG - Intergenic
1073054158 10:100688438-100688460 GCAGGCTGCTGGGGTCAGCAGGG + Intergenic
1073060893 10:100732921-100732943 GGAGGCTGCTCAGGTCAGGCTGG - Intergenic
1073184818 10:101609531-101609553 GGAGGCTGCCGTGGTCAAGAAGG - Exonic
1074740197 10:116479105-116479127 GGAGGCAACTGTGGTCAAAGAGG - Intergenic
1074813887 10:117130605-117130627 GGAGGCTTCTGGCTTCCAACTGG - Intronic
1074973559 10:118563551-118563573 TGAGGCTGCTGGGGGCCATCAGG - Intergenic
1075709945 10:124525604-124525626 GGAGGCTGGTGGGGTCCACATGG + Intronic
1076155954 10:128206153-128206175 GGAGGGTGTTGGTCTCAAACAGG + Intergenic
1076522528 10:131089996-131090018 GCAGGCTGCTGGGCTCAGGCGGG + Intergenic
1077042367 11:530397-530419 GGAGGCTGCTGGGGAGAAGGGGG + Intergenic
1077168424 11:1153950-1153972 GGCCGCTGCTGGGGTCCAGCTGG - Intergenic
1077572941 11:3355026-3355048 GGAGGGTGTTGGGGTCAGTCTGG + Intronic
1078765136 11:14289145-14289167 GGAGGCTGTAGGGGGCACACTGG + Intronic
1079279273 11:19073142-19073164 GGAGCCTTCTGGGGCCTAACAGG - Intergenic
1079669991 11:23156972-23156994 GAAGTCTGCTGGGGTCTACCTGG + Intergenic
1083185623 11:61016220-61016242 TGGGGCTGATGGGGTCAGACAGG - Intronic
1083771109 11:64868063-64868085 GGAGGCTGCTGGGGTAGGGCGGG - Intronic
1084954792 11:72685472-72685494 GGAGGCAGCAGGGGTCAGCCTGG - Exonic
1086746990 11:90441317-90441339 AGTGGCAGCTGGGGACAAACAGG - Intergenic
1088717882 11:112564844-112564866 TGAGGCTGCAGGGGTGGAACTGG + Intergenic
1089160728 11:116435089-116435111 GGAGGCTGCTGGAGGGAAAGTGG - Intergenic
1089214839 11:116829273-116829295 GGAGGCAGCGGGGGGCACACAGG + Intergenic
1089262152 11:117230830-117230852 GGAGGCGGCGGGGGCGAAACGGG + Intronic
1091140059 11:133227215-133227237 GGGTGCGGCTGGGGTGAAACAGG - Intronic
1091699936 12:2652657-2652679 GGAGGCTGCTGGGGGCAGAGCGG - Intronic
1091822195 12:3483978-3484000 TGAGGCTGCTGGAGCCAAATGGG + Intronic
1096636139 12:52960769-52960791 GGAGGCTGCTGGACTTAGACTGG - Intergenic
1097019036 12:56007366-56007388 GGAGACTGCTGGGGGAAAATGGG - Intergenic
1098090102 12:66892284-66892306 GGAGGCTGCTGTAGTCATCCAGG - Intergenic
1099482641 12:83188184-83188206 GGATGCTGCTGGGGTATTACAGG - Intergenic
1100146786 12:91688253-91688275 GGAGGGTTCTGAGATCAAACAGG - Intergenic
1101639479 12:106577570-106577592 GGAGGAGTCTGAGGTCAAACAGG - Intronic
1101900845 12:108790067-108790089 GCAGGCTGCTGGGGTAAGAGGGG - Intronic
1102529094 12:113532964-113532986 GCAGCCTGCTGAGGTCACACAGG - Intergenic
1102783249 12:115583794-115583816 GGAAGTTGCTGGGCTTAAACAGG - Intergenic
1103291926 12:119853824-119853846 GGAAGCTTCAGGGGTCAGACGGG - Intronic
1103484521 12:121273892-121273914 GGGGGCGGCTGGGGCCAAAAAGG - Intronic
1106104514 13:26722475-26722497 GGAGGCTGGTGGGTTCAGAGTGG + Intergenic
1109010290 13:56932347-56932369 GGAGGGAGCTTGGCTCAAACAGG + Intergenic
1109498264 13:63204002-63204024 GAAGACTGCTGGGGACAACCTGG + Intergenic
1113764030 13:112869735-112869757 GGAGGCTGCTGTGCTGTAACTGG - Intronic
1115369400 14:32595106-32595128 GGAAGCTGCTGTGGTAATACAGG - Intronic
1116400225 14:44497391-44497413 GGAGGCCTCTGGGGACAAAGAGG - Intergenic
1116752157 14:48899770-48899792 GTAGGCTGTTGGGTTCAAAGAGG + Intergenic
1117252436 14:53950817-53950839 GGATGCTGCTGAGGTTAAAGAGG + Exonic
1119558247 14:75569714-75569736 GGAGGCTGCTATGGTCACTCAGG - Intergenic
1119738074 14:76996638-76996660 GGATTCTGCTGGGGTCAAAAAGG - Intergenic
1121251314 14:92501728-92501750 GGAAGCTGCTGAGGTAAGACTGG - Intergenic
1121316624 14:92964692-92964714 GGAGGCTGCTGGGGTCAAACAGG + Intronic
1123018533 14:105386862-105386884 GGAGGCTGCTGGGGGTCAGCAGG - Intronic
1202833208 14_GL000009v2_random:58528-58550 GGAGTCTGCTTGGGTCAACAGGG - Intergenic
1123847021 15:24313050-24313072 AGAGACTGCTGGTGTCAAAGAGG + Intergenic
1123866024 15:24520113-24520135 AGAGACTGCTGGTGTCAAAGAGG + Intergenic
1125769255 15:42154136-42154158 TGAGGCTTCTCAGGTCAAACAGG + Exonic
1128348658 15:66874102-66874124 GGAGGCTTCTGGAGCCACACAGG + Intergenic
1129660043 15:77548406-77548428 GGAAGCTCCTGGGGCCAAGCAGG - Intergenic
1129746203 15:78023290-78023312 GGGGTCTGCTGGGGTCAAACAGG + Intronic
1129790445 15:78337551-78337573 GGAGGCTGAGGTGGACAAACTGG + Intergenic
1129879716 15:78998675-78998697 GCAGGCTGCTGGGGACCACCAGG - Intronic
1131426775 15:92352017-92352039 GGATGCCACTGGGATCAAACAGG - Intergenic
1132608920 16:805476-805498 GGTGGCTGCTGGGGACAGCCAGG + Exonic
1132711906 16:1272602-1272624 GGAGGCTGCTGGGCTGTGACGGG - Intergenic
1133022269 16:2971958-2971980 GGAGGCTGCTGTGGGCAGGCTGG - Exonic
1133593315 16:7266907-7266929 GGAGGTTGCTGGGGGGAGACTGG + Intronic
1134057294 16:11178561-11178583 GGAGGCTGTGGGGGTCAACTGGG - Exonic
1134075835 16:11290692-11290714 GGAGGCTGTTGCTGTCACACAGG + Intronic
1134490613 16:14693211-14693233 GGAGGCTGCAGCGGGCAGACAGG - Intronic
1134495994 16:14732328-14732350 GGAGGCTGCAGCGGGCAGACAGG - Intronic
1134810861 16:17166070-17166092 GCAGGCTGGTGGGGTTAAGCAGG + Intronic
1135374666 16:21935045-21935067 GGAGGCTGCAGCGGGCAGACAGG - Intergenic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1135923103 16:26668787-26668809 GGAGGCTGCTGTCTACAAACAGG - Intergenic
1136154802 16:28375478-28375500 GGAGGCTGCAGCGGGCAGACAGG + Intergenic
1136208290 16:28739780-28739802 GGAGGCTGCAGCGGGCAGACAGG - Intergenic
1136264375 16:29106417-29106439 GGAGGCTGCAGCGGGCAGACAGG - Intergenic
1137563822 16:49521093-49521115 GGAGGCTGCTGCTTTCAATCTGG - Intronic
1138652408 16:58468201-58468223 GGAGGCTGTTGGGGTCCTTCTGG + Intronic
1139391090 16:66606396-66606418 GGAGGCTGCTGGGGCCTCCCAGG - Intronic
1139640689 16:68289415-68289437 GGAGCATCCTGGGGTCAAATTGG + Intronic
1140655213 16:77132641-77132663 GGAGGCTGCTTGGTTCAGAGTGG - Intergenic
1141158505 16:81613143-81613165 GGAGGCTGATGGAGCCAAAAAGG - Intronic
1141378909 16:83557771-83557793 GGGTGCTACTGGGGTCAAACTGG - Intronic
1141660183 16:85437223-85437245 GGAGGCTCCTGGGGTCACAGAGG + Intergenic
1141774031 16:86110408-86110430 GGAGGCTCATGGGATCACACAGG + Intergenic
1141877314 16:86834755-86834777 GGTGGCTGCTGAGGGCAGACTGG - Intergenic
1142374863 16:89701627-89701649 GGAGACCGCTGGGGACAGACAGG - Exonic
1142615900 17:1134937-1134959 GGCCGCTGCGGGGGTTAAACTGG + Intronic
1142780668 17:2178977-2178999 GTACCCTGCTGGGGTCAGACTGG + Intronic
1143217083 17:5233218-5233240 GGAGGCTGATGGGCTGAAGCGGG - Intronic
1144018560 17:11220385-11220407 GTGGGCTTCTGGGGTCAAACAGG - Intergenic
1147213368 17:38885154-38885176 GGAGGTGGCTGGGGTCCATCTGG + Intronic
1147912198 17:43862367-43862389 GGAGCATGCTGGGGTGAGACTGG + Exonic
1149865531 17:60149233-60149255 AGAAGCTGATGGGGTCAAAGGGG - Intergenic
1150598200 17:66626008-66626030 GGATGCTGCTGGGGGCAGAGTGG - Intronic
1151512986 17:74573056-74573078 TGAGGCCCCTAGGGTCAAACAGG - Intergenic
1152153740 17:78619166-78619188 CGGGGCTGCTGGGGTTAAACGGG - Intergenic
1152374835 17:79913682-79913704 GGAGGCTGCTCGGCTCAGGCTGG + Intergenic
1152588156 17:81198261-81198283 GGATGCAGCTGGGGACAACCTGG - Exonic
1152768794 17:82155141-82155163 CGGGTCAGCTGGGGTCAAACAGG + Intronic
1153504261 18:5779882-5779904 GGAGGCTCTGGGGGCCAAACTGG + Intergenic
1157481753 18:48059825-48059847 GGAGGCAGCTGGGGAGAGACTGG - Intronic
1159628714 18:70724677-70724699 GGAGGATATTGGGGTGAAACTGG + Intergenic
1162328793 19:10014196-10014218 GGAGCATGCTGGAGTCAAAGTGG + Intronic
1163195686 19:15717949-15717971 GGAGGGTGCAGGGGTCATAGAGG + Intergenic
1165224121 19:34342152-34342174 GGGGGCTGCTGCGGTCCAATGGG - Exonic
1165759371 19:38311665-38311687 AGAGGCTGCTGGGGTGATCCAGG + Intronic
1166224124 19:41384344-41384366 GGAGGCTCCTGGGCTCAATCAGG - Intronic
1167088028 19:47324021-47324043 GGAGACTGCTGAGGTCAGTCTGG - Intergenic
1167605392 19:50479136-50479158 GAAGGCTGCTGGGGACCAGCAGG - Intronic
1202639459 1_KI270706v1_random:69168-69190 GGAGTCTGCTTGGGTCAACAGGG + Intergenic
924991659 2:317735-317757 GGAGCCTGCAGGGGTCCTACAGG - Intergenic
925046018 2:773694-773716 GGTGCCTGCTGGGGGGAAACAGG - Intergenic
925992987 2:9268917-9268939 TCAGGGTGCTGGGGACAAACCGG + Intronic
926655997 2:15406999-15407021 GGAGACTGCTGGGTTTAAAAAGG - Intronic
926778967 2:16449535-16449557 GGAGGCTGCTTGGCTGAAGCTGG - Intergenic
927374495 2:22397740-22397762 GGAGGCTGCAGTGGTCATACAGG - Intergenic
927815790 2:26216196-26216218 GGAGGTGGCTGGGGTCAAAATGG + Intronic
927927398 2:27023555-27023577 TGGGGCTGCTGGGGTCATTCCGG + Intronic
933124471 2:78586948-78586970 GGAGGCTACTGCAGTCATACTGG + Intergenic
933580207 2:84117249-84117271 GGAGGTTGCTGGTGGCAAAAGGG - Intergenic
934916068 2:98302081-98302103 GGAGCCGGCTGGGGCCACACTGG - Intronic
936047889 2:109200975-109200997 GGCTGCTGCTGGGGACAAAGGGG + Intronic
937227372 2:120377549-120377571 AGAGGCTGCTGGGGACAGAGGGG - Intergenic
937704978 2:124910027-124910049 AGAGGCTGATGGGGTCAAATGGG - Intronic
938029864 2:127982867-127982889 GGAGGCTGCTGGGGTCCCTCTGG + Intronic
942181946 2:173388544-173388566 TGTGGCCGCTGGGGTCAGACAGG + Intergenic
946185945 2:217980381-217980403 GGAGGCTGCTGGTGTCCAAGAGG - Intronic
947218327 2:227769368-227769390 TGAGGCTTCTGGGGCCAAATTGG + Intergenic
947878843 2:233486928-233486950 AGAGGCTGCTGGAGAGAAACAGG + Intronic
948178479 2:235961973-235961995 GGAGACTGCTGGGGACAGGCTGG + Intronic
948914910 2:241029753-241029775 GGAGGCTGCAGGGGCCAAGTAGG - Intronic
948942730 2:241204211-241204233 GGGGGCTTCTGGGGGCAAGCAGG + Intronic
1168772097 20:421876-421898 GGAGGCTCCTGGAGTCACCCAGG + Intronic
1169065341 20:2692019-2692041 GGACGCGGCTGGGGAGAAACAGG + Intergenic
1169116415 20:3069238-3069260 AGAGGCTGATGGGGCCAAGCAGG - Intergenic
1169138062 20:3209624-3209646 GGAGGGTGTTGGGGGCTAACTGG + Intronic
1169274137 20:4221730-4221752 GGAGGCTGCTGGGGCCGTTCCGG - Exonic
1170763943 20:19274489-19274511 GGAGGATGCTGGAGGCTAACAGG - Intronic
1171886119 20:30653534-30653556 GGAGCCTGCTTGGGTCAACAGGG + Intergenic
1172773672 20:37395542-37395564 GAAGGCTGCCTGGGTCAAACGGG - Intronic
1173001664 20:39109785-39109807 GGGGGCTGCCGGGGTGGAACCGG - Intergenic
1173227940 20:41172823-41172845 GGAGGCTGCTCTTGTCAAAGGGG - Exonic
1173553481 20:43949312-43949334 GGAGGCTCCTGCGGTCATCCCGG - Intronic
1173839285 20:46146726-46146748 GGAGGCTGCTGGGGAGAGAGGGG - Intergenic
1175118495 20:56700902-56700924 TGAGGCTGCTGAGGGCAAACTGG - Intergenic
1175895277 20:62333236-62333258 GGAGGCAGCTGGGGGGACACAGG + Exonic
1176647787 21:9366777-9366799 GGAGTCTGCTTGGGTCAACAGGG + Intergenic
1178473418 21:32915953-32915975 GGAGGCTGCTGGGGCTCCACTGG - Intergenic
1178941561 21:36911213-36911235 GCTGGCTGCTGGGGACACACAGG - Intronic
1179574224 21:42297311-42297333 GGAGGCAGCTGAGGTGATACAGG - Intergenic
1180362483 22:11912696-11912718 GGAGTCTGCTTGGGTCAACAGGG - Intergenic
1181483016 22:23212962-23212984 GGAGGCTGCCGGCCTCAAAAAGG + Intronic
1183169447 22:36175516-36175538 GGAGGCTGCTGACCTCCAACAGG + Intergenic
1183716145 22:39534834-39534856 GGACGCTGCAGGGGTCCACCTGG - Intergenic
1184071963 22:42152232-42152254 GGAGGCCGTTGGGGTGAAAGGGG + Intergenic
1184493221 22:44822477-44822499 TGCGGCTTCTGGGGTCTAACAGG - Intronic
1185157822 22:49204942-49204964 GGAGGCCGCTGGGGTCACCTGGG - Intergenic
1185399267 22:50607537-50607559 GGGGGCTGCTGAGGTTATACAGG + Intronic
1185406685 22:50656203-50656225 GAAGGCTGCTGGGGACGAAGGGG + Intergenic
949485767 3:4536138-4536160 GGAGGCTGCAGAGGTGCAACTGG + Intronic
949943273 3:9171114-9171136 GGAGGCTGCTGGGGCCTCAGGGG - Intronic
951145358 3:19220152-19220174 GGAGGCTGATGAGGGCAAGCAGG + Intronic
952287107 3:31980340-31980362 GGAGGCTGCAAGGCACAAACTGG + Intronic
953405357 3:42657148-42657170 GGAGGCTGCTGTGGTAGAGCCGG + Intronic
953453569 3:43023991-43024013 GGGGGCAGCTGGAGTCAATCGGG + Intronic
954629101 3:52038658-52038680 GGATGCAGCTGGGGTCAGGCTGG - Intergenic
954653350 3:52178623-52178645 GGAGGAGGCTGGGGTGACACTGG + Intergenic
954877258 3:53810226-53810248 GGAAGCTGCTGGGGACAGTCAGG - Exonic
961347692 3:126274745-126274767 GGAGGCTGCTGGGGACAGCAAGG - Intergenic
961552168 3:127675814-127675836 GGAGGGTGTTGGGGTCAGAGTGG + Intronic
962827498 3:139110699-139110721 GGAGGCTGCTGTGGCTGAACAGG - Intronic
962915768 3:139902135-139902157 GGAGGCTGCTGGGGTGATACAGG - Intergenic
964139867 3:153385550-153385572 GGAGGTTGTTGGAGTCACACTGG - Intergenic
965386660 3:168054329-168054351 AGAGGCTGCTGGGGTCGGGCAGG - Intronic
967884158 3:194322027-194322049 GGAGGCTGCTGGGGTTGACCAGG + Intergenic
1202739096 3_GL000221v1_random:38210-38232 GGAGTCTGCTTGGGTCAACAGGG - Intergenic
968488394 4:876345-876367 GTAGGCTGCTGGGGTGGACCCGG - Intronic
968605366 4:1532709-1532731 GGAGGCTGCTGGGGACACATCGG - Intergenic
968652660 4:1766375-1766397 GGAGGCTGCTGGGGCCATGGCGG + Intergenic
968703819 4:2069175-2069197 GGAGGCGGCGGGGGCCAAACTGG - Intergenic
968753618 4:2403134-2403156 GAAGGCAGCTGGGGCCACACAGG - Intronic
969484383 4:7463899-7463921 GGAGGCTGGTGATTTCAAACAGG + Intronic
969500065 4:7547281-7547303 GGAGGCTGCTGGAGTCAGCTTGG - Intronic
970171037 4:13290796-13290818 GGAGGGTGCTCAGATCAAACTGG + Intergenic
970320758 4:14873308-14873330 GGAGGCTGTTGCAGTCATACTGG + Intergenic
971390793 4:26183653-26183675 GAAGGCTGCTGGGATCAGCCAGG - Intronic
973118889 4:46492971-46492993 GGAGGCTTCTGAGGACAGACTGG - Intergenic
973369714 4:49235531-49235553 GGAGCCTGCTTGGGTCAACAGGG + Intergenic
973391317 4:49559885-49559907 GGAGCCTGCTTGGGTCAACAGGG - Intergenic
973782402 4:54300752-54300774 TGAGGCTGCTGGGGGGAAATGGG - Intergenic
973982288 4:56316405-56316427 GGATGCTGGTGGGGTCTGACTGG - Exonic
977067093 4:92332391-92332413 GGTGGGAGCTGGGGTCTAACAGG - Intronic
978083135 4:104619098-104619120 GGAGGCTTCTGGTGTCAAAGTGG + Intergenic
983160684 4:164410618-164410640 GAAAGTTCCTGGGGTCAAACTGG - Intergenic
984711003 4:182885148-182885170 GGAGGCTGCAGGGGAGAAAGAGG - Intergenic
1202766818 4_GL000008v2_random:155037-155059 GGAGTCTGCTTGGGTCAACAGGG + Intergenic
985491571 5:182750-182772 GGAGGCTGCTGGGCTCTTCCTGG - Exonic
986062102 5:4201571-4201593 GCAGGCTGCAGGGGTCTAAAGGG - Intergenic
997386394 5:133476114-133476136 AGAGGCTGCTGGGGCAAAAACGG + Intronic
997510042 5:134447870-134447892 CGAGGCTTCTGGGGACAATCAGG - Intergenic
998599878 5:143574786-143574808 GGAGGCTGTTGGAGTCATCCTGG - Intergenic
999401170 5:151265345-151265367 AGAGGCTGCTGGGCTCAGGCTGG - Intronic
1000450152 5:161375604-161375626 CGAGGCTTTTGGAGTCAAACAGG + Intronic
1001055931 5:168449898-168449920 AGAGGCTGCTGGGGCCAAGGAGG + Intronic
1001120980 5:168979655-168979677 GAAGGGGGCTGGGGCCAAACAGG + Intronic
1002094488 5:176823038-176823060 GGAGGCTGCCGTGGTCATCCAGG + Intronic
1002443599 5:179276656-179276678 ACAGGCTGCTGGGGACACACAGG + Intronic
1002568361 5:180126901-180126923 CGTGGCTGCTGGGGTGAAGCTGG - Intronic
1002972990 6:2043483-2043505 AGGGGCTGCTGTGGTCAGACAGG - Intronic
1005517118 6:26565607-26565629 GGAGGCTGCTTGGGTCCCTCGGG - Intergenic
1005905830 6:30260863-30260885 GGCTGCTGCAGGGGTCAAAGGGG - Intergenic
1006052592 6:31355910-31355932 GGCTGCTGCAGGGGTCAAAGGGG + Intronic
1006153630 6:32002381-32002403 GGGGGCTGCAGGGGGCAAAGGGG - Exonic
1006159938 6:32035118-32035140 GGGGGCTGCAGGGGGCAAAGGGG - Exonic
1007513418 6:42392008-42392030 AGAGGCTGATGGGGTGAAGCTGG - Intronic
1009249039 6:61275587-61275609 GGAGGGTGAGGGGGTCAGACAGG - Intergenic
1010176757 6:73036509-73036531 AGTGGCTGCTGGGGTCAGGCTGG - Intronic
1011032157 6:82935342-82935364 GGAGGCTGTTTGGGTCACAGGGG - Intronic
1011720015 6:90145858-90145880 GAAGGCAGCTGGGGAGAAACCGG + Intronic
1014205372 6:118651083-118651105 GGAGGCGGCCGGGGTAAGACAGG + Intronic
1014715424 6:124859534-124859556 GGAGACTGCTGTGGTGACACAGG + Intergenic
1015633186 6:135251569-135251591 AGAGGCTGCAGGGTTCACACAGG + Intergenic
1015793037 6:136982836-136982858 GGAGGGTGCTGTGGGCAAAAGGG + Intergenic
1017042883 6:150322118-150322140 GGAGTCTGCTGAGGTGACACAGG + Intergenic
1017656133 6:156631354-156631376 GTAGGCTGGTGGGGACAGACAGG + Intergenic
1018705718 6:166461985-166462007 GGAGCCTGCAGCGGTCACACAGG - Intronic
1019144175 6:169966323-169966345 GGAGGCTCCTGGAGTCATCCAGG - Intergenic
1019186879 6:170225613-170225635 GGACATTGCTGAGGTCAAACAGG + Intergenic
1019995509 7:4722009-4722031 GGAGGCAGCCGGGGTGAGACTGG + Intronic
1020149724 7:5672730-5672752 GGAGGCTGCTGTGGTCTTCCTGG + Intronic
1022388746 7:29925571-29925593 GGTGGCTGCTGTGGACACACTGG + Intronic
1022757713 7:33311258-33311280 GGAGGCTGCTGAGGTGATCCAGG + Intronic
1022794663 7:33722549-33722571 TGAGGCAGCTGTGGTCACACTGG - Intergenic
1023812127 7:43919745-43919767 GGATGCTGGTGGGGCCCAACAGG - Intronic
1023817395 7:43961503-43961525 GGAGGCAGATGGGGTCAGACAGG - Intergenic
1023984739 7:45088170-45088192 GGAGGCTGATGGGGTCTACGGGG - Intronic
1026265182 7:68790187-68790209 GGAGGTTCCTGGGATCAACCTGG - Intergenic
1027215192 7:76179041-76179063 GGAAGCTGCTGGGGACAAGGAGG + Intergenic
1028222414 7:88213152-88213174 GGGAGCTGCTGGAGTCATACAGG - Intronic
1029259689 7:99293442-99293464 GGAGGCTGCTGGGCACTACCTGG + Intergenic
1029742020 7:102496377-102496399 GGAGGCAGATGGGGTCAGAGAGG - Intronic
1029760009 7:102595542-102595564 GGAGGCAGATGGGGTCAGAGAGG - Intronic
1032223160 7:130009350-130009372 GGAGGCCGCTGGGCTGAAAGAGG + Intergenic
1034949030 7:155284641-155284663 GGAGGCTGCTGCGGACATGCAGG - Intergenic
1035328035 7:158077462-158077484 GGAGGATGCTGAGGTCAAAGGGG + Intronic
1038012058 8:23483188-23483210 GGAGGCTGCAGAAGACAAACAGG + Intergenic
1040300787 8:46186965-46186987 GGAGGCTTCTGGGATGAGACAGG + Intergenic
1040303516 8:46200359-46200381 GGAGGCTTCTGGGATGAAAGAGG - Intergenic
1040307455 8:46219566-46219588 GGAGGATGCTGGGATGAAAGAGG + Intergenic
1040330201 8:46381981-46382003 GGAGGCTTCTGGGATGAAAGGGG - Intergenic
1040333879 8:46406317-46406339 GGAAGCTTCTGGGATGAAACAGG - Intergenic
1041427477 8:57738795-57738817 GTGGGCTGCTGAGGTCAGACTGG + Intergenic
1041809026 8:61887175-61887197 TGAGGCTGCAGGGGCCAATCTGG + Intergenic
1045587814 8:103559129-103559151 TGAGGCTGCTGGGGGCAAATGGG - Intronic
1045650883 8:104340826-104340848 GGAGGCTGATGGGTTCAGACTGG + Intronic
1046629262 8:116607319-116607341 TCAGGCTGCTGGGCTCAAAATGG + Intergenic
1047920314 8:129628543-129628565 GGAGGCTGCTGCGAGCACACTGG - Intergenic
1048204847 8:132407176-132407198 GGCTGCTCCTGGGGTGAAACTGG - Intronic
1048564828 8:135584735-135584757 GGAGGAAGATGAGGTCAAACGGG - Intronic
1049216582 8:141411081-141411103 GGAGGCTGCTAGGCACACACAGG - Intronic
1049326296 8:142023234-142023256 GGAGGCTGCTGGGGCCAGTGAGG - Intergenic
1049389116 8:142359050-142359072 GGAGGCAGCCTGGGTGAAACAGG - Intronic
1052876988 9:33574825-33574847 GGAGCCTGCTTGGGTCAAGAGGG - Intergenic
1053499021 9:38569569-38569591 GGAGCCTGCTTGGGTCAAGAGGG + Intronic
1056072931 9:83007653-83007675 GGAGGCTGCTGAGGCCACAGAGG - Intronic
1056377139 9:86025553-86025575 AGAGGCAGAAGGGGTCAAACTGG - Intergenic
1056586596 9:87931530-87931552 GGAGCCTGCTTGGGTCAAGAGGG + Intergenic
1056610280 9:88121412-88121434 GGAGCCTGCTTGGGTCAAGAGGG - Intergenic
1056803887 9:89713137-89713159 AGAGCCTGCTGGGTTCAATCTGG + Intergenic
1057106335 9:92421276-92421298 GGAGGCTGAGGGGGGCAGACTGG - Intronic
1057162069 9:92895904-92895926 GGAGCCTGCTTGGGTCAAGAGGG + Intergenic
1057574990 9:96235334-96235356 GGAGGGGGCTGGGGTCACAGAGG - Exonic
1057678458 9:97154051-97154073 GGAGCCTGCTTGGGTCAAGAGGG + Intergenic
1057758772 9:97856145-97856167 GGAGGCTGCTGAGGTGTAGCAGG - Exonic
1060374568 9:123106959-123106981 GGATGCTGCTGGGATTACACAGG - Intergenic
1060664217 9:125423344-125423366 GGGGGCTGCTGGCCTCAACCAGG + Intergenic
1060827621 9:126695770-126695792 GGAGGCTGCTGGGGTGTAGCTGG + Intronic
1060927954 9:127468357-127468379 GGAGGCTGTCGGGGTCATCCAGG + Intronic
1061031721 9:128088506-128088528 GGAGGCTGCTGGGTTCCACCTGG + Intronic
1062215738 9:135388919-135388941 GGATGCTGCTGGGGTGACATGGG - Intergenic
1062544446 9:137055231-137055253 GCAGGCTGCTGGGGCCCAAAGGG + Intergenic
1203707825 Un_KI270742v1:68654-68676 GGAGTCTGCTTGGGTCAACAGGG - Intergenic
1186626270 X:11296993-11297015 GGAGGCTGCTGGGACGACACAGG - Intronic
1188004348 X:25007023-25007045 GGAGGAGGCAGGAGTCAAACAGG - Intronic
1195364980 X:104116664-104116686 GCAGGCTGATGGGGACAAAAGGG + Intronic
1195497815 X:105558118-105558140 TGTGGATTCTGGGGTCAAACTGG + Intronic
1196008669 X:110863130-110863152 GGTGGATGCTGTGGTCACACTGG + Intergenic
1196150709 X:112370281-112370303 GGAGGCTGCTGGGGGCAGGTTGG - Intergenic
1197618073 X:128716341-128716363 TGAGACAGCTGGGGTCAAAAGGG + Intergenic