ID: 1121317925

View in Genome Browser
Species Human (GRCh38)
Location 14:92973326-92973348
Sequence CACTGGAAACAAAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 523
Summary {0: 1, 1: 0, 2: 0, 3: 41, 4: 481}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121317925 Original CRISPR CACTGGAAACAAAAGGAGGA GGG Intronic
900084076 1:878840-878862 CTCTGGAATCAGATGGAGGAAGG - Intergenic
900221904 1:1513577-1513599 CACAGGAAACAAAAGCCTGATGG - Intronic
901465163 1:9416769-9416791 CACTGAAAAATAAAGGGGGAGGG - Intergenic
902364073 1:15959466-15959488 CAATGGAGAGAAAAAGAGGAGGG + Intronic
902418398 1:16257257-16257279 CACAGGTAAGAAAAGGAGGCAGG + Intronic
902792852 1:18780858-18780880 CACTGGTAACTAAAGGGGCAGGG + Intergenic
902826180 1:18975968-18975990 CACTGGGAACAAGATGTGGATGG + Intergenic
903866224 1:26400270-26400292 CAGTTGAAACAAAAGCAGGGAGG - Intergenic
904985959 1:34549197-34549219 CACTGAGAACAAATGGAGGGAGG + Intergenic
905024159 1:34838361-34838383 CACTGGACACAGATGGAGTAAGG + Intronic
905791445 1:40791778-40791800 CACTGGAAATAAATGGAGCATGG + Intronic
906135254 1:43495268-43495290 CACTGGGAACAGCAGGAGGGAGG + Intergenic
906495002 1:46299256-46299278 AACTGGAAAAAAATGGAGGCTGG + Intronic
906550077 1:46657810-46657832 GAGTGGAAAAAAAAGGAGAAGGG + Intronic
906912426 1:49968732-49968754 AACTGGAAACCAAATGAGGCAGG - Intronic
907912852 1:58841768-58841790 CAGTGGAAAGAAAAGGCTGAGGG - Intergenic
908573295 1:65432500-65432522 CACTGGAAAGATAAGGAAGTTGG - Exonic
908606440 1:65802248-65802270 CAGTGGAGTCAAAAGCAGGAAGG - Intronic
908957544 1:69651901-69651923 CACTGAGAACAAGAAGAGGAGGG + Intronic
909072131 1:71007511-71007533 CCCTGGAAGCAAAGAGAGGAAGG - Intronic
909460142 1:75902361-75902383 CACTGGGGACAAAAGGGGGAAGG - Intronic
909539892 1:76779606-76779628 CACTGGAAAAAAATGGAGTTTGG + Intergenic
910436651 1:87212188-87212210 CACAAGAAAGGAAAGGAGGAAGG + Intergenic
910519140 1:88098241-88098263 CACTGGGAAAAATAGGAGAAGGG - Intergenic
911251276 1:95579297-95579319 CTCTGGTGATAAAAGGAGGAAGG + Intergenic
911650368 1:100381193-100381215 CTCTGGAAGCAAAAGGAGAAAGG - Intronic
913550127 1:119909091-119909113 AACTGGGAAAGAAAGGAGGAAGG + Intergenic
914194246 1:145436789-145436811 CATTAGAAACAAAAGAATGAGGG + Intergenic
914882825 1:151560759-151560781 CACTGGAAAAATAAGGAAGTTGG - Intronic
915426679 1:155833347-155833369 CACTGCAAAAAAAGGAAGGAAGG + Intronic
915479049 1:156172812-156172834 CACTGAGCACTAAAGGAGGAGGG - Exonic
915624607 1:157106971-157106993 CAGTGGAGACAAGAGGAGAAGGG - Intergenic
915679244 1:157564306-157564328 CACAGCACACAAAAAGAGGATGG - Intergenic
916335215 1:163663325-163663347 TACTGGAAACAATATGAGAAAGG + Intergenic
917236499 1:172898240-172898262 CACTGGATTCCAAAGGACGAAGG - Intergenic
917437277 1:175034087-175034109 TGCTGGAAACACAAGGAGGAAGG - Intergenic
917803247 1:178589884-178589906 CTCTGGTAACCAAAGGAGCATGG - Intergenic
918796451 1:188904013-188904035 CAAGGGAAAGAAAAGAAGGAAGG + Intergenic
919790079 1:201284920-201284942 CCCAGGAAACTCAAGGAGGAAGG + Intronic
920461348 1:206143124-206143146 CCCTGGAAAAAAAAAGAGCAGGG + Intergenic
921605680 1:217151692-217151714 CACAGGGAAAAAAAGGATGAAGG - Intergenic
921763636 1:218945348-218945370 CACTGGAAAAATAAATAGGAGGG - Intergenic
922113322 1:222584274-222584296 CATTGGAGGGAAAAGGAGGAAGG - Exonic
922355647 1:224772688-224772710 CCTTGGAAAGAAAGGGAGGAGGG - Intergenic
922412198 1:225387778-225387800 GACAGTAAACAAAAGGAGAAAGG + Intronic
922671635 1:227512512-227512534 CTCTGGAACCAGATGGAGGAAGG - Intergenic
922986194 1:229867704-229867726 CACTAGAAACTGCAGGAGGAAGG - Intergenic
923321923 1:232842785-232842807 CAAAGGAAACAGATGGAGGATGG + Intergenic
923535646 1:234849354-234849376 CACTGTACAAAAAAAGAGGAAGG - Intergenic
924101941 1:240612618-240612640 TACTGCAAACAAAAGGAGCCTGG - Intergenic
924244075 1:242064459-242064481 CTCTGGAACCAGATGGAGGAAGG - Intergenic
924385300 1:243493873-243493895 AACTGGAAGCAAAGGGAGAAGGG + Intronic
1062763170 10:43096-43118 CTCTGGAATCAGATGGAGGAAGG + Intergenic
1063182645 10:3619113-3619135 CCCTGGAAACAGGAGGAGGAGGG + Intergenic
1063367407 10:5499601-5499623 CAATCGGAACAAAGGGAGGAGGG + Intergenic
1063590143 10:7387632-7387654 AAGAGGAAACCAAAGGAGGATGG + Intronic
1063674166 10:8125130-8125152 CAACAGAAACAAAGGGAGGAGGG + Intergenic
1064086761 10:12350989-12351011 CACACGGAAAAAAAGGAGGAAGG - Intronic
1064336212 10:14445069-14445091 AAATGGAAATAAAAGGAAGAAGG + Intronic
1064754480 10:18561901-18561923 CAATGGAAAGAAATGGAGAATGG + Intronic
1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG + Intronic
1064926561 10:20575844-20575866 CACTGAGAACAAAAAGGGGAAGG + Intergenic
1065070675 10:22021056-22021078 CCTTGGAAGCAAAAGGAAGAAGG + Intergenic
1065479279 10:26176309-26176331 GACTGGAAAGAAAAGGAAGGAGG + Intronic
1066676445 10:37892794-37892816 CACTGGAAATAGAAAGGGGAAGG - Intergenic
1067945117 10:50684357-50684379 ACCTGGAAACAGAAGGAAGAAGG - Intergenic
1068939145 10:62663945-62663967 AACTTGAAAGAAAAGGAAGAGGG + Intronic
1069050874 10:63792218-63792240 TACTGCAAAAAATAGGAGGAGGG + Intergenic
1070210885 10:74319721-74319743 TACAGGAAAGAAAAGGAAGAAGG - Intronic
1070508019 10:77132966-77132988 CTCTGGAAATAAATGGAAGATGG + Intronic
1070866622 10:79711229-79711251 ACCTGGAAACAGAAGGAAGAAGG - Exonic
1070880411 10:79849350-79849372 ACCTGGAAACAGAAGGAAGAAGG - Exonic
1070960490 10:80496673-80496695 CTATGGAAACTAAAGGAGAATGG - Intronic
1071194337 10:83140175-83140197 CACTGGAAGAAAAATGAAGAAGG - Intergenic
1071360635 10:84842912-84842934 GAATGGGAACAAAAGGAGAATGG + Intergenic
1071585966 10:86821804-86821826 CTCAAGAAACAAAAGGAGGGAGG - Intronic
1071633534 10:87233452-87233474 ACCTGGAAACAGAAGGAAGAAGG - Exonic
1071646981 10:87365668-87365690 ACCTGGAAACAGAAGGAAGAAGG - Exonic
1071947951 10:90669157-90669179 TTGTGGAAACAAAAAGAGGAGGG + Intergenic
1072961982 10:99937659-99937681 GACTGGAAACAAAGAGAGAATGG - Intronic
1073318415 10:102599150-102599172 CACAGGAAAGAAAAGGATGGTGG + Intronic
1073703244 10:105954154-105954176 CAAAGGAAAGAACAGGAGGAAGG + Intergenic
1074636844 10:115328578-115328600 AACTGGAGAGAATAGGAGGAGGG - Intronic
1074659426 10:115636004-115636026 CACTGGGAAGAATATGAGGAGGG + Intronic
1074829170 10:117236634-117236656 CACTGGCAACAATAGGAAGTTGG - Intergenic
1074875264 10:117608624-117608646 CACTGGAAGAAAAAAAAGGAAGG - Intergenic
1077802189 11:5551006-5551028 CACAAGGAATAAAAGGAGGAAGG - Intronic
1077963655 11:7103242-7103264 CACTAGAAAGAAAAGGTGAAAGG - Intergenic
1078028527 11:7723691-7723713 CTGGGGAAACAAAAGAAGGAAGG - Intergenic
1079169707 11:18081152-18081174 CACTGGGGACCACAGGAGGAGGG - Intronic
1080856628 11:36117197-36117219 ATCTGGAAGGAAAAGGAGGAAGG + Intronic
1081613986 11:44579648-44579670 CACTGGTAACAAAAGGAAACCGG - Intronic
1083080382 11:60086416-60086438 GACTGGAAACAAACTGAAGATGG - Intergenic
1083323427 11:61861504-61861526 ATATGGAAACAAAATGAGGATGG - Intronic
1083743105 11:64721540-64721562 CCCTGGAAGCAAGAGGAGGTAGG + Intronic
1085454584 11:76658545-76658567 CCCTGGAGACAGAAGGATGAAGG + Exonic
1087059304 11:93962597-93962619 CACTGGGAAGAACAGGAGGGAGG - Intergenic
1087407658 11:97750066-97750088 TACTGGCTAAAAAAGGAGGATGG - Intergenic
1087555200 11:99710466-99710488 TGTTGGAAACAAAGGGAGGATGG + Intronic
1088136792 11:106565161-106565183 AACTGGAAGAGAAAGGAGGAAGG + Intergenic
1089922468 11:122222729-122222751 CACTGGAAATAAAAATATGAAGG + Intergenic
1090622450 11:128572993-128573015 TACAGGAAGCACAAGGAGGAGGG + Intronic
1090745139 11:129699323-129699345 CACAGGAAGCAAAATGGGGAGGG + Intergenic
1091023607 11:132122925-132122947 AATTGGAAACAAAAAGAGCAAGG + Intronic
1091133398 11:133165653-133165675 CACAGGAAACAAAAAGCTGAGGG - Intronic
1092023251 12:5220239-5220261 CACTGGAATCACAAGGAAGGAGG - Intergenic
1092490493 12:8940605-8940627 CACTGGACACAAAAGAGGGATGG - Exonic
1094009639 12:25793850-25793872 GAATGGAAAGAAAAGGAAGAGGG - Intergenic
1094344917 12:29457168-29457190 AACTGGAAACAACTGGAAGAGGG - Intronic
1094451449 12:30586819-30586841 CACTGGAAACAGAATGAGAATGG - Intergenic
1095262604 12:40114058-40114080 CACGGGAGACAAAAGATGGATGG + Intergenic
1095399071 12:41793759-41793781 GACTGGAAAGAAAAGTAGAAAGG + Intergenic
1095421525 12:42029041-42029063 CCCTGGGAAAAAAAGGAAGATGG - Intergenic
1096262998 12:50104535-50104557 CACAGGAAAGTACAGGAGGAGGG - Intronic
1096453480 12:51765900-51765922 CACTCGAAAGACAATGAGGAAGG - Exonic
1096619458 12:52853888-52853910 CACAGAAACCAAGAGGAGGAAGG + Intergenic
1096795419 12:54074432-54074454 CAATGGAAAGAAAGGAAGGAAGG - Intergenic
1096875304 12:54625374-54625396 AACTGGAACCAAATGGAGGGAGG - Intergenic
1096945996 12:55410553-55410575 CACTGGACACAAAAGAGGGATGG + Intergenic
1098011922 12:66062186-66062208 CACAGGAAACATAGGAAGGAGGG + Intergenic
1098077965 12:66753660-66753682 CTCTGGGAACAAAATGAAGAGGG - Intronic
1098805413 12:75015954-75015976 AAAGGGAAAAAAAAGGAGGAGGG + Intergenic
1099522738 12:83683817-83683839 CACTGAAAATAAAAGGATGGAGG + Intergenic
1099567230 12:84267755-84267777 CAAGGGAAACCAAAGGAGGAGGG + Intergenic
1100293402 12:93237972-93237994 AAATGGAAACAAAGGAAGGAAGG + Intergenic
1100935611 12:99661696-99661718 TACTAAAGACAAAAGGAGGAGGG - Intronic
1101676433 12:106921220-106921242 CACTGGAAAGAGAATGAAGAGGG - Intergenic
1101750626 12:107580331-107580353 CACTGGAAGAAATAGGAAGATGG + Intronic
1101960715 12:109247669-109247691 CACTGTAAACACATCGAGGAAGG + Exonic
1102802339 12:115747257-115747279 TACTGGAAGCACAAGGAGCAAGG - Intergenic
1102875205 12:116443766-116443788 GACTGGAAAGCATAGGAGGAGGG + Intergenic
1103007885 12:117436279-117436301 CACAGAAAACAAAAGGAGACCGG - Intronic
1103018239 12:117512838-117512860 CACTGGAAGAAAATAGAGGAGGG - Intronic
1103436582 12:120931568-120931590 CTCTGGAAACACAAGGTGGGGGG - Intergenic
1103933693 12:124463984-124464006 CACTGGAAATAAAAGTGGGCAGG + Intronic
1104211773 12:126695767-126695789 AACTGGAAACCAAAGCAGAAAGG - Intergenic
1104453469 12:128890183-128890205 CACAGGAAACAAAAAGCAGATGG - Intronic
1104803012 12:131567488-131567510 CATTAGAAACAAAAGGAGAGAGG - Intergenic
1105366763 13:19772408-19772430 CATTGGAAACAACTGGAGAAAGG + Exonic
1106497937 13:30297850-30297872 CACTGGAAACTAATAGAGGTGGG + Intronic
1106514053 13:30437844-30437866 CACAGGAATCAAGAGGATGATGG - Intergenic
1106556002 13:30809127-30809149 GACTGGGAACAAAAGGGGGGAGG + Intergenic
1106636558 13:31534847-31534869 CAAAAGAAACATAAGGAGGAAGG - Intergenic
1106666863 13:31860433-31860455 CAGAAGAAAGAAAAGGAGGATGG - Intergenic
1106744554 13:32686149-32686171 CACTGTAATCAAAAGGAAGCTGG - Intronic
1109443579 13:62405519-62405541 CTCAGGAAGCAACAGGAGGAGGG - Intergenic
1110494498 13:76150386-76150408 CACAGGAAAAAAAAAAAGGAGGG - Intergenic
1111233275 13:85372761-85372783 GAGAGGAAACAAGAGGAGGAGGG - Intergenic
1111880637 13:93952142-93952164 CACAGGAAACATCTGGAGGAAGG + Intronic
1112146097 13:96702053-96702075 CACTGGAATCCACAGGAAGATGG + Intronic
1112383305 13:98914445-98914467 CATTTGAAACAGGAGGAGGAAGG + Intronic
1114460653 14:22884256-22884278 TGCTGGAAACAGGAGGAGGAAGG + Intronic
1115142262 14:30185696-30185718 CACTGTAAAATAAAGGAGAAAGG - Intronic
1115199571 14:30838592-30838614 GACTGAAAGCAAAAGGAGTATGG - Intergenic
1115933893 14:38529772-38529794 TACTGGAAACATGAGGAAGAGGG + Intergenic
1116436355 14:44898312-44898334 CTCTGGAAAAAACGGGAGGAGGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116944247 14:50821550-50821572 CACTGGGACAGAAAGGAGGAGGG - Intronic
1117942611 14:60984308-60984330 CACTGGAAGTAGAGGGAGGAAGG + Intronic
1118597688 14:67448780-67448802 GACTGGAAACAGAGGGAGTAGGG + Intronic
1118620254 14:67608526-67608548 CACCTTAAACAAAAGGAGGGAGG + Intergenic
1119012604 14:71010966-71010988 CAATGGAAACAGTAGGAGGAGGG + Intronic
1119189641 14:72671907-72671929 CACTGAAAGCAAAAGGAAGTTGG + Intronic
1119534960 14:75395571-75395593 CCCTGGAAGCAAAGGGAGAAGGG - Intergenic
1119949644 14:78731035-78731057 CACAGGCAAGAAAAGAAGGAAGG - Intronic
1121317925 14:92973326-92973348 CACTGGAAACAAAAGGAGGAGGG + Intronic
1121430947 14:93888086-93888108 CCCTGGAAAGAAAGGAAGGAAGG - Intergenic
1122111375 14:99505517-99505539 CTCTGGAAATAAAAGGAAAAAGG - Exonic
1122939334 14:104974234-104974256 AACTGGACACACAAGGAGGACGG - Intronic
1123929007 15:25148911-25148933 GATTGGAAGCAAAAGAAGGAGGG + Intergenic
1124201429 15:27681706-27681728 TCCTGGGAACAAAAGGATGAGGG - Intergenic
1124552009 15:30690252-30690274 CACTTGAACTAAAAGGAGGGGGG + Intronic
1124807085 15:32895338-32895360 AAAGGGAAACAAAAAGAGGAAGG + Intronic
1126338931 15:47618360-47618382 CCCTGGAAAGCAAAGGAGGCTGG + Intronic
1126867409 15:52951343-52951365 GAGTGGAAACAAAAGCTGGATGG + Intergenic
1126914900 15:53455660-53455682 CACTGACAACAAAAGGAGAAAGG - Intergenic
1127105884 15:55614538-55614560 CACTGAAGAGAAAAGGAGAAAGG + Exonic
1127508841 15:59620526-59620548 CAATATAAACAAAATGAGGATGG - Exonic
1127635950 15:60869822-60869844 CAGAGGGAACAAGAGGAGGATGG - Intronic
1128256187 15:66198778-66198800 CTCTAGAAACAAAAGGAGGCTGG - Intronic
1129709314 15:77812448-77812470 GACTGGAAGCAAAATAAGGAAGG + Intronic
1130542474 15:84831109-84831131 CACTGGAAGCAAAAAGATAATGG - Intronic
1130622132 15:85474735-85474757 CACTGGAAACACAAGGTGGTAGG - Intronic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1131602237 15:93861275-93861297 CACTGGACAAAATGGGAGGAGGG + Intergenic
1131662101 15:94528593-94528615 CACTGGAAGTAAAAAGTGGAAGG - Intergenic
1132230909 15:100183332-100183354 CACTGGAAAAAAAATGAGCTGGG - Intronic
1132276815 15:100573620-100573642 CACTGCATACAAAAGGAGTTTGG + Intronic
1132447313 15:101936187-101936209 AAAAGGAAAGAAAAGGAGGAAGG + Intergenic
1132997912 16:2832896-2832918 AAGTGGAGACAAAGGGAGGAGGG + Intronic
1133369472 16:5237142-5237164 GTCTGGAAAAAAAAAGAGGAAGG + Intergenic
1133825585 16:9275393-9275415 GACTGGAACCCAAATGAGGAGGG - Intergenic
1134397663 16:13880159-13880181 CACTGAAGACAAAATGAGGCTGG + Intergenic
1134869358 16:17637913-17637935 CACTGAAATGAAAGGGAGGAAGG + Intergenic
1135759681 16:25127065-25127087 CACTTGAAACAAAAGTAGGCTGG + Intronic
1136397532 16:30001329-30001351 AAATGCAAACAGAAGGAGGATGG - Intronic
1136582376 16:31160780-31160802 CTCTGGAAAACAAAGGAGGTGGG + Intergenic
1137516112 16:49146022-49146044 CACTGGAAAAATAAAGAGGATGG + Intergenic
1137880541 16:52042088-52042110 CACAGGAAACAAAAACAAGAGGG - Intronic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1137929569 16:52574115-52574137 CACTGGCAACAAATGGATTAAGG + Intergenic
1138396533 16:56708976-56708998 CACTGGCAACAGCAGGGGGATGG + Intronic
1138798381 16:59996731-59996753 CACTGGAAAAAAAAAGGGGGGGG + Intergenic
1138801259 16:60033061-60033083 CACTGTAAAGGAGAGGAGGAGGG - Intergenic
1139915977 16:70428729-70428751 CACTGTAGAGAAGAGGAGGAAGG - Intronic
1139930527 16:70522715-70522737 CACTGAAAATTAAAGGAGGCAGG + Intronic
1140083470 16:71773361-71773383 CACTGCAAAAGAAAAGAGGAAGG + Exonic
1140743747 16:77963431-77963453 CCCTGGAAACAAATGCAGGAAGG + Intronic
1140766183 16:78160071-78160093 CGATGGAAATAAAAGGAGAAAGG - Intronic
1141472217 16:84246828-84246850 AACTGGAATAAACAGGAGGAAGG + Intergenic
1141501232 16:84445506-84445528 GACTGGATATAAGAGGAGGAAGG - Intronic
1142781009 17:2181223-2181245 TATGGGAAACAAAAGAAGGAAGG + Intronic
1143229119 17:5336702-5336724 AACAGGAAAAAAAAGGAGGGAGG - Intronic
1143443525 17:6994159-6994181 AAAGGGAAACAAAAGCAGGAGGG + Intronic
1143619513 17:8073022-8073044 CACTGAAACCAAAGGGTGGAGGG - Intronic
1143654528 17:8286094-8286116 CATGGGAAACAAAAGGAGCCAGG - Intergenic
1144155838 17:12500975-12500997 CCCTGGAAACAAAACCAGGCAGG + Intergenic
1144277106 17:13681275-13681297 GACTGGATAAAATAGGAGGAAGG - Intergenic
1144582926 17:16470083-16470105 CACTGGAAACAAAGACAGGTGGG - Intronic
1145264136 17:21371417-21371439 CACAGGAAACATATGGTGGAGGG + Intergenic
1146180286 17:30693803-30693825 CCCTGGTAACAAAGGGCGGACGG - Intergenic
1146501300 17:33367136-33367158 CACTGGAAGCACCAGCAGGAAGG - Intronic
1146546363 17:33742215-33742237 CACTGGAAACAAATGGGGCGTGG - Intronic
1147570730 17:41568999-41569021 CACTGGAGACTCAAGGACGAAGG + Intronic
1148230455 17:45930101-45930123 TACTGAAAACTAAAGGAAGATGG + Intronic
1148631963 17:49117853-49117875 AGCTGGAAACAAGAGGAGAAGGG - Intergenic
1149935379 17:60800380-60800402 CACTGGAAAGAAGAGATGGATGG - Intronic
1150008039 17:61481705-61481727 CCCTGGAGAAAACAGGAGGAGGG + Intronic
1150488224 17:65558735-65558757 CTCTGGAAAGAAAAGGAAGGGGG + Exonic
1151140465 17:71986602-71986624 GTCTGGAAACAAAAAGAGGCGGG + Intergenic
1151210891 17:72543093-72543115 AACTGGCAAAAAAGGGAGGAAGG - Intergenic
1151559318 17:74862088-74862110 GACTGGAAACGGAAGCAGGAAGG + Intergenic
1152260822 17:79266116-79266138 CATTGGAATCAAAGGAAGGAGGG - Intronic
1152780643 17:82226150-82226172 AACTGGGAACAAAAGGAAGTTGG + Intergenic
1152956079 18:43427-43449 CTCTGGAATCAGATGGAGGAAGG + Intergenic
1155329001 18:24695258-24695280 AACTGGCAAAAAAAGGAGGTAGG + Intergenic
1155889092 18:31244267-31244289 CACAGAAAACAAATGCAGGAAGG - Intergenic
1155990594 18:32275334-32275356 CACTGGCAACACAAGGAGAGAGG + Intronic
1157310884 18:46552447-46552469 TGGTGGAAACACAAGGAGGAGGG - Intronic
1158432874 18:57406229-57406251 ATCTGGAAACAAATGCAGGAAGG - Intergenic
1159484272 18:69033884-69033906 CACTTCACACCAAAGGAGGATGG - Intronic
1159688545 18:71456271-71456293 CACTGGAGACAAATAGAGGGGGG - Intergenic
1160222296 18:76986022-76986044 CACTGCAAACATGGGGAGGAAGG + Intronic
1160637963 19:96346-96368 AAAAGGAAAGAAAAGGAGGAAGG - Intergenic
1161935859 19:7371867-7371889 CACTGGAATAAAAAGAAGGGAGG + Intronic
1162978314 19:14221737-14221759 CCCTGGTAACAAAGGGCGGACGG + Intergenic
1165440713 19:35825300-35825322 GACAGGAAAGAAAAGAAGGAAGG + Intergenic
1168387754 19:55979974-55979996 CCCAGGAAACAAAAGCAGAATGG - Intronic
1168414909 19:56161591-56161613 CACAGGAACCAAAAGGACCAGGG - Intergenic
1168593928 19:57658971-57658993 GACCAGAAACCAAAGGAGGATGG + Intergenic
1168710114 19:58494725-58494747 CAACAGAAACAAAGGGAGGAGGG - Intronic
925286526 2:2719841-2719863 CGCTGGAGACATGAGGAGGAAGG + Intergenic
925498706 2:4480986-4481008 CACAGGAAACAAAGGAAAGAAGG + Intergenic
926290286 2:11523733-11523755 CACTGGAAAAGAAAACAGGAAGG - Intergenic
929237389 2:39620530-39620552 TAATGGAAACTAAAGGAGCAAGG - Intergenic
929978651 2:46658451-46658473 GCCTGGAGACAAAAGGTGGATGG - Intergenic
930087174 2:47505906-47505928 CACTGGAAACAATGGGGGTAGGG + Intronic
930241552 2:48940887-48940909 CAAGGGAAAGAAGAGGAGGAGGG - Intergenic
930915090 2:56677054-56677076 AACTTGAAACACAAGGAAGATGG + Intergenic
931044385 2:58334002-58334024 CAATGGAAAAGAAAGGAGGAGGG - Intergenic
931427825 2:62187145-62187167 AACTGGAAAAAAAAGCATGAGGG - Intergenic
931677160 2:64708831-64708853 CACTGCAAAGAAAAGAAAGATGG - Intronic
931878588 2:66541763-66541785 TGCTGGAATCAAAAGAAGGAAGG - Intronic
932284057 2:70518028-70518050 CACTCCAAACAAAGGAAGGATGG + Intronic
932628720 2:73320138-73320160 CTATGGAAACTAAAGGAGAAAGG - Intergenic
932822585 2:74914220-74914242 AAAAGGAAAAAAAAGGAGGAAGG + Intergenic
933188204 2:79302314-79302336 CACTCCAAGCAAAAGGAGCAGGG - Intronic
933343878 2:81058380-81058402 AAGTGGAAACAAAAAGAGCAGGG - Intergenic
933997789 2:87682589-87682611 GACAGGAAAAGAAAGGAGGAAGG + Intergenic
936265969 2:111007008-111007030 GAATGGAAAGAAAAGAAGGAAGG + Intronic
936296064 2:111268281-111268303 GACAGGAAAAGAAAGGAGGAAGG - Intergenic
936378788 2:111965841-111965863 CAGAGGAAACAAGAGGAAGAGGG - Intronic
936895482 2:117422911-117422933 CACTGAGAACAAAGTGAGGAAGG + Intergenic
938388446 2:130884751-130884773 CCCTGGAAACAAAATAATGAGGG - Intronic
938553811 2:132404857-132404879 CACATGAAAGAAAAGAAGGAAGG - Intergenic
938767254 2:134468672-134468694 CGCTGGAAACTTAGGGAGGAGGG - Intronic
940990512 2:160091887-160091909 CAGTGGGAAAATAAGGAGGAAGG - Intergenic
942692578 2:178601967-178601989 CAGTGGAAAAAAGAGGAGAATGG + Intronic
942914408 2:181285819-181285841 CACTGGAGACTAATGGAGGAAGG + Intergenic
943011956 2:182460937-182460959 CAAGGAAAACAAAAGGTGGAGGG + Intronic
943808209 2:192150728-192150750 CTCAGGGAACAAATGGAGGATGG + Intronic
944654565 2:201864718-201864740 CAAAGGAAACAGAAGGGGGAAGG + Intronic
944982386 2:205136231-205136253 GAATGGAAAGAAAAGGAGGAAGG - Intronic
945264941 2:207881778-207881800 CACTGGAAAGAGTAGGAGAAAGG - Intronic
945954472 2:216073200-216073222 TCCTGGAAACAAAAGGAGAAAGG - Intronic
947321826 2:228927601-228927623 TATGGGAAAGAAAAGGAGGAAGG + Intronic
947572027 2:231243577-231243599 CACTGGAAACCAGAGGAGGGAGG + Intronic
947671460 2:231939123-231939145 AACTGGTAACAAAAGGATGAGGG + Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
948003287 2:234586364-234586386 CACTTAACACAAAAGGAGGCTGG - Intergenic
948021516 2:234737447-234737469 CTCTGGAGCCAAAAGGAGGGTGG + Intergenic
1172053964 20:32141286-32141308 CACTAGAGCCCAAAGGAGGAGGG + Intronic
1172885272 20:38226827-38226849 CTCTGAAAACAAAGGGAGGAGGG + Intronic
1173008104 20:39156629-39156651 CACTGGGAACCCAAGGAGGGTGG + Intergenic
1173217899 20:41103799-41103821 CCCTGGAAAGAATAGGAGAATGG - Intronic
1174950433 20:55036029-55036051 CACTGGAATAAACAGGAGGGAGG + Intergenic
1175516588 20:59574274-59574296 CACTGGAGAGACCAGGAGGAGGG - Intergenic
1175611994 20:60359195-60359217 CACTGGATACATGAGGATGAGGG - Intergenic
1177783886 21:25648992-25649014 CACTGTTAAAAAGAGGAGGAGGG - Intronic
1179551164 21:42144914-42144936 GTATGGAAACAGAAGGAGGAAGG + Intergenic
1182164711 22:28161751-28161773 GACAGGAAAGGAAAGGAGGAAGG + Intronic
1183354933 22:37353161-37353183 GACTGGATGCAAGAGGAGGAAGG - Intergenic
1184605402 22:45570826-45570848 TACTTTAAAGAAAAGGAGGAAGG + Intronic
1184689798 22:46112352-46112374 CACTGGAGACCCTAGGAGGAGGG - Intronic
1184818138 22:46887910-46887932 CAGTGGAAGCTTAAGGAGGATGG + Intronic
950904561 3:16525919-16525941 CACTGGAAACCCAAGGATTAAGG + Intergenic
952123173 3:30268497-30268519 CACTGGTACCAAGAGGAGGCTGG - Intergenic
952679814 3:36078323-36078345 ATCTGGAAACAAAAGTGGGAAGG + Intergenic
952974807 3:38684711-38684733 CACTGTTACCAAAAGGAGGAAGG - Intergenic
953788543 3:45929271-45929293 CCCTGGAAGCTAGAGGAGGAAGG + Intronic
954064158 3:48092574-48092596 CAGAGGAAACAATATGAGGAGGG - Intergenic
954528027 3:51290716-51290738 AAATGGAAACAAAAAGAGCAGGG + Intronic
955166391 3:56518431-56518453 CCCTGGAAAGAAAAGAAGGAAGG + Intergenic
955638184 3:61053308-61053330 TCCTGGAAAGAAAAAGAGGATGG + Intronic
957002043 3:74898376-74898398 ACCTGGAAACAAAAGCAAGATGG + Intergenic
957487652 3:80883216-80883238 CTCTGGTAACAACACGAGGATGG + Intergenic
958815197 3:98906363-98906385 TACTGGAAACCTTAGGAGGATGG + Intergenic
958842839 3:99229039-99229061 CAGAGGAATCAAAAGAAGGAAGG + Intergenic
959368625 3:105494658-105494680 CCCTAGAAAAAAAAGAAGGAAGG - Intronic
959409375 3:106001152-106001174 CACTGGAAACTACTAGAGGAGGG + Intergenic
960077551 3:113504938-113504960 CACTGCAGATAAAATGAGGAAGG + Intronic
960299670 3:115986685-115986707 CACTGGAAAAAAAAAGAGGGGGG + Intronic
961787688 3:129357495-129357517 TACCTGAAATAAAAGGAGGAAGG - Intergenic
962857153 3:139357957-139357979 CTCTGCAGACAAAAGGAAGAGGG + Exonic
963284686 3:143422579-143422601 CACTGGAAACTACTAGAGGAGGG + Intronic
963763552 3:149309419-149309441 CACTGAAGAAAAAAGGGGGATGG + Intergenic
964091995 3:152888291-152888313 CACTGGAACCAAGAGTAAGATGG - Intergenic
964789836 3:160443338-160443360 CACTGGAAACAATAAGACAATGG + Intronic
965391154 3:168106021-168106043 GACAGGAAACAAAAGCAGCAAGG + Intergenic
965716144 3:171605259-171605281 CAGTGAAAAGAAACGGAGGAGGG + Intronic
967650282 3:191977167-191977189 CTCTGGAAACAAAAGGTAAAAGG + Intergenic
970450989 4:16166263-16166285 CAGAGAAAACAAAAGCAGGACGG - Intronic
971089546 4:23324881-23324903 CCCAGGACACAAAAGGATGAGGG - Intergenic
972148274 4:36056663-36056685 CACTGAAAACAATAGTAGTAAGG - Intronic
972356544 4:38284511-38284533 CAATGGAAATGAAAGGGGGATGG + Intergenic
973608752 4:52613211-52613233 CACTGGAAAGAAAGGAAAGAGGG + Intronic
973707406 4:53593942-53593964 CACTGGAAAGAAAAGAGGGAAGG + Intronic
973738111 4:53892444-53892466 TGCTGGAAACAAAATGGGGAAGG - Intronic
974028162 4:56752246-56752268 GAATGGAGACAAAAGGAGAATGG + Intergenic
974317613 4:60302915-60302937 GAGTGGAAATAAAAGAAGGATGG + Intergenic
974508545 4:62807725-62807747 CAATGGGAACAAAAGGGGGCTGG + Intergenic
974586437 4:63885040-63885062 CCATGGAAACAAATGGAGAATGG + Intergenic
975057636 4:69954515-69954537 CACTGGAAATATAAGAAAGATGG + Intergenic
975363976 4:73506468-73506490 CACAGGAAAGAAAAGTAGCAAGG - Intergenic
975732003 4:77346582-77346604 CACTGGAAACAAGAGGACAAAGG + Intronic
975940962 4:79645111-79645133 GACTGCAAAGAAAAGGAGGATGG + Intergenic
977545352 4:98370476-98370498 GACTGGAGAAAAAAGGAGAAAGG - Intronic
978403057 4:108350649-108350671 CACTTGAAACAAACCAAGGAGGG + Intergenic
978478219 4:109156748-109156770 CACTGAAAACAAAAACTGGATGG - Intronic
978816703 4:112914537-112914559 CACTTGAACCCAGAGGAGGATGG + Intronic
978836358 4:113154314-113154336 CACTGGAAATCCAAGGAGTAAGG + Intronic
978873609 4:113610281-113610303 CACTGGGAGCAAAAGAAGGCAGG + Intronic
980518038 4:133890314-133890336 CACTGCAAATAAAAAGAGCAGGG - Intergenic
980841715 4:138269444-138269466 CATTGAAAACAAAAGGAGAATGG + Intergenic
981128938 4:141136509-141136531 CACTGGAAAAAAGAGTAGCAGGG - Intronic
981323524 4:143420352-143420374 CCCTGAAAACAAAAGGAAAAGGG + Intronic
982362393 4:154533995-154534017 TAATAGAAACAAAGGGAGGAGGG - Intergenic
982471884 4:155802357-155802379 CATTGGCAACAGACGGAGGAAGG - Exonic
983178069 4:164615036-164615058 CACTGTAAGCAACTGGAGGATGG - Intergenic
983888538 4:173007309-173007331 GAATGGAAACAAAACCAGGATGG - Intronic
984584573 4:181548946-181548968 AACTGGAGCCCAAAGGAGGATGG + Intergenic
985440186 4:189978252-189978274 CTCTGGAATCAGATGGAGGAAGG + Intergenic
985619195 5:944840-944862 CACAGGACACAAGAGGAGTACGG - Intergenic
985726251 5:1517282-1517304 CCCTGGAAACAGGAAGAGGAAGG + Intronic
985902669 5:2808826-2808848 GACTGGAAGCAAAAGGAAGGAGG + Intergenic
987330410 5:16852092-16852114 CACTGGGAAGGAAAGAAGGAAGG + Intronic
987528454 5:19082818-19082840 CTCTGGAAAAAAATGGAGTAAGG - Intergenic
987866035 5:23540357-23540379 CCCTGAAAACAAAAGGAAGAAGG - Intergenic
988294770 5:29342389-29342411 CACTGGAATGAAAAGGTGGCAGG + Intergenic
988427775 5:31083596-31083618 CAAAGGAAAGGAAAGGAGGAAGG + Intergenic
988778788 5:34500474-34500496 CTCTGGTAACCAGAGGAGGATGG - Intergenic
990553326 5:56905714-56905736 AACTGGAAACAACAGGAAGTGGG + Intergenic
991069652 5:62462879-62462901 CACTGAAAAAAAAAAAAGGATGG - Intronic
991581624 5:68161500-68161522 CACAGGAGAAAAAAGGAAGATGG + Intergenic
992027820 5:72688169-72688191 GACTGGAATAACAAGGAGGAGGG + Intergenic
992407465 5:76473337-76473359 CACAGGAAAAAAAAAGAGAAAGG - Intronic
993266471 5:85732338-85732360 CAGTGTAAACAAAAGGGGCAGGG + Intergenic
993322636 5:86492142-86492164 GATTGGAAAGAAAAGAAGGAAGG - Intergenic
993439035 5:87932500-87932522 CTCTGAAAACAAAAAGAGGAAGG + Intergenic
993464417 5:88227489-88227511 TACTGGAATAAAAAGAAGGAAGG + Intronic
994807673 5:104471967-104471989 CACTGCACACAAAAGAAGGCAGG - Intergenic
994865013 5:105256792-105256814 CACAGGAAAAAAAAAGAGAAAGG - Intergenic
995257521 5:110064352-110064374 CACAGGAAACAAATGGTGGTTGG - Intergenic
995456207 5:112354978-112355000 CAAAATAAACAAAAGGAGGAAGG + Intronic
996011565 5:118486428-118486450 CCCTGGAACAAAAGGGAGGAGGG - Intergenic
996456474 5:123689388-123689410 AACTGGAAACAATAGGTGAATGG + Intergenic
996813616 5:127548100-127548122 CCTGGAAAACAAAAGGAGGAAGG - Intronic
997203031 5:132024222-132024244 GAATGGAAATAAAAGGATGAGGG - Intergenic
999010881 5:148038550-148038572 CACTGAAAAAAAAAGAAAGATGG - Intronic
999656805 5:153818541-153818563 GACTGGACACAAGAGGATGATGG - Intergenic
999970934 5:156861985-156862007 CACTAGAGTCAAAAGAAGGAAGG + Intergenic
1000731399 5:164838651-164838673 AATAGGAAAGAAAAGGAGGAAGG - Intergenic
1001818736 5:174693252-174693274 CTCTGGAAACACAGGGGGGAGGG - Intergenic
1001921599 5:175604435-175604457 CACTACAAACATAAGGAGAAAGG - Intergenic
1002370055 5:178744809-178744831 CACTGGGAACTACTGGAGGATGG + Intergenic
1002713310 5:181208466-181208488 CACGGTAGCCAAAAGGAGGAAGG - Intergenic
1004889762 6:20089350-20089372 CACTGGAGAGAAGAGGAGGCTGG - Intergenic
1005205378 6:23397119-23397141 CATTGGAGACAAAATGAGGAGGG - Intergenic
1005572387 6:27157780-27157802 CTTTGGCAACAAAAGGAAGAGGG - Intergenic
1005704361 6:28436718-28436740 AAAGGGAAACAAATGGAGGATGG + Intronic
1006851354 6:37101127-37101149 CACTAGAAAGGAAAGGAAGAGGG + Intergenic
1007177076 6:39904141-39904163 ACCTGGAAACAAAAGGACTATGG + Exonic
1007620799 6:43213386-43213408 CAAAGGAAAGAAAAGGAAGAGGG - Intronic
1007835364 6:44669856-44669878 TCCTGTAAACAAGAGGAGGAAGG + Intergenic
1007961748 6:45966644-45966666 AAAAGGAAACAAAAAGAGGAGGG - Intronic
1008124751 6:47655650-47655672 CTAAGGAAACAAAATGAGGAAGG + Intergenic
1009397322 6:63214472-63214494 AACTGGAAAGAAAAGGAGAGGGG - Intergenic
1009437630 6:63636104-63636126 CACTGGCAGCAAGAGGAAGATGG - Exonic
1010243390 6:73639109-73639131 CACAGGAAAAAAAAGAAGAAAGG - Intronic
1010756763 6:79674053-79674075 CTTTGGAAACAGAAGTAGGAAGG + Intronic
1010839877 6:80636330-80636352 CACAGAAAACAAAAAGAGAAGGG + Intergenic
1011290836 6:85775501-85775523 CAATGGAAACAAAAAGAGGCAGG - Intergenic
1011717822 6:90125612-90125634 CAATGGAAAAAAATGGGGGACGG + Intronic
1012788530 6:103661567-103661589 CAGCAGAAAGAAAAGGAGGAAGG - Intergenic
1012917570 6:105187012-105187034 CACTGAAAACAAAAGCAAAAGGG - Intergenic
1013279572 6:108622977-108622999 CAGTGGAAGCAACAGGAGGGTGG + Intronic
1013299882 6:108794996-108795018 CTTTGGGGACAAAAGGAGGAAGG + Intergenic
1013447859 6:110249353-110249375 CACTGGAATCAAAAGAGGGTGGG - Intronic
1014489491 6:122044679-122044701 CAGAGGAAAAAAAAGGGGGAGGG - Intergenic
1014693574 6:124591491-124591513 CATTGGAAGCAAAGGGAGGGAGG - Intronic
1015794862 6:137001524-137001546 CACAGGAAACAAAAGGCAAAAGG + Exonic
1015872880 6:137794787-137794809 AAGTGGGAAGAAAAGGAGGAAGG + Intergenic
1016053219 6:139551792-139551814 GACTGGAAAGGAAAGGAGAAAGG + Intergenic
1016096118 6:140039686-140039708 CCCTGGAAAGAAAAACAGGATGG + Intergenic
1017890741 6:158636785-158636807 AACTAGAGACAAAAGGAGAAAGG + Exonic
1018405740 6:163480288-163480310 CAATGGAAAGAAAGGAAGGAAGG - Intronic
1018454735 6:163941642-163941664 TCCTGGAGACAGAAGGAGGAGGG + Intergenic
1018650194 6:165986584-165986606 TACTTGAAGGAAAAGGAGGAAGG - Intronic
1018922353 6:168184116-168184138 CTCTGGGACCAGAAGGAGGAAGG + Intergenic
1019771681 7:2887233-2887255 CAGAGGAAAAAAAAGGAAGAAGG + Intergenic
1020518956 7:9162270-9162292 TTCTGAAAACTAAAGGAGGAGGG - Intergenic
1021138633 7:16995964-16995986 CACTGGAAACTACTAGAGGAGGG - Intergenic
1021428528 7:20532338-20532360 CACTGGAAAATAAAGCAGGCAGG - Intergenic
1021912597 7:25401394-25401416 CACAGGACAATAAAGGAGGATGG - Intergenic
1022496231 7:30854816-30854838 CCCTAGGAACAAAAGGAGGCAGG + Intronic
1022549587 7:31226459-31226481 AACTGGGAACAAAAAGAGGTTGG - Intergenic
1022595710 7:31711881-31711903 CACTGGAATCCAAAGCAGGGTGG - Intergenic
1023859599 7:44210203-44210225 CACAGGAAACAAAAGGCGGTGGG - Intronic
1023897325 7:44444857-44444879 CGCTGGGAATAAAAGGAAGAAGG - Intronic
1024208573 7:47184428-47184450 CACTGGAAACCAAGGAGGGAAGG + Intergenic
1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG + Intronic
1024663603 7:51522798-51522820 CAGAGAAAACAAAAAGAGGATGG - Intergenic
1027420987 7:78018163-78018185 TAATGGAAACAAAAGGACAAAGG + Exonic
1028604454 7:92640401-92640423 CAATAGATACAAAAGAAGGATGG + Intronic
1028692326 7:93667429-93667451 AACTGGAAACAAAAGCAGAGAGG - Intronic
1028719270 7:94011174-94011196 TTCTGGACACAAAAGGAGGCAGG - Intergenic
1030148733 7:106381754-106381776 CACTGAAAACACAAGGAAAACGG - Intergenic
1030170780 7:106600641-106600663 CAATGGTAATAAAAGGAGAATGG + Intergenic
1030770364 7:113467562-113467584 TACAGGAAACAAAAGGAGTGTGG - Intergenic
1030927330 7:115475185-115475207 CACTGGAAATGAGAAGAGGAAGG + Intergenic
1031282849 7:119826451-119826473 CAGTAGAAACATAAGAAGGAAGG + Intergenic
1031738652 7:125399518-125399540 CACTGGAGAGAAAAGAAGAAGGG - Intergenic
1031774685 7:125892775-125892797 CTGTGGAAAAAAAAGGAGTAGGG - Intergenic
1033301290 7:140188519-140188541 CACACGAAAGAAAAGGAGAAAGG + Intergenic
1033495214 7:141887233-141887255 CACTGCATACAAGAGGAAGAAGG - Intergenic
1033685527 7:143637028-143637050 CATTGGAAAAAAAAAAAGGATGG - Intronic
1033688697 7:143716245-143716267 CATTGGAAAAAAAAAAAGGATGG - Intronic
1033699087 7:143820593-143820615 CATTGGAAAAAAAAAAAGGATGG + Intergenic
1034348185 7:150399675-150399697 CACGGGAAACCAAACCAGGAGGG + Intronic
1034641740 7:152609431-152609453 AGCTGGAAAAAAAAGGAGCAGGG + Intergenic
1035752462 8:2005935-2005957 AACCGGAAGGAAAAGGAGGAAGG - Exonic
1036057644 8:5275903-5275925 CAAAGGAAACAGAAGAAGGAAGG - Intergenic
1036415568 8:8544602-8544624 CACTGGAATCAGAAGGAACAGGG - Intergenic
1037251460 8:16900159-16900181 CAATGCAAACAAAGGGAAGAAGG + Intergenic
1038158751 8:25016462-25016484 CACTGGTAAAGAAGGGAGGAGGG + Intergenic
1038941442 8:32310110-32310132 GAATGGAAAGAATAGGAGGAGGG + Intronic
1039099956 8:33930292-33930314 CACTGGAAACAAGAAGACTAAGG - Intergenic
1040799428 8:51324820-51324842 CACTGGAAACAAATGAAAAATGG - Intronic
1041105746 8:54442500-54442522 TGGTGGAAACAAAAGGAAGATGG + Intergenic
1044208663 8:89522913-89522935 GACTGGAAAGAAAAGGCAGAAGG + Intergenic
1045481492 8:102596504-102596526 GACTGGACATAAAAGCAGGAAGG + Intergenic
1046190379 8:110787758-110787780 CACTGGAAACAAAAAAAATATGG + Intergenic
1046265128 8:111821270-111821292 CACAGGAAAGAAAGGAAGGAGGG + Intergenic
1046494717 8:114998669-114998691 CAATAAAAAAAAAAGGAGGAAGG - Intergenic
1046773768 8:118142168-118142190 CACTGGAAACAAGAGGTTCAAGG - Intergenic
1046993429 8:120487235-120487257 CACTGGAAGCAAAATGAAGCTGG - Intronic
1047012493 8:120687147-120687169 CACTGGGAAAAAGAGGAGAAAGG + Intronic
1047397859 8:124518700-124518722 GACTGGAAACAATAGGAAAATGG - Intronic
1048557466 8:135494576-135494598 CTCAAGAAACAAAAGGAGGAGGG - Intronic
1049274355 8:141712230-141712252 CTCAGGAAACAACATGAGGACGG - Intergenic
1050721581 9:8597541-8597563 CAGTGAAAATAAAAGGAAGAAGG + Intronic
1051265566 9:15306376-15306398 CAGTTGAAACCAAAGGAGGCCGG + Intronic
1051569705 9:18541791-18541813 AATTGGAAACAAATGGAGGATGG + Intronic
1054771594 9:69088868-69088890 CTCAGAAAACAAGAGGAGGAAGG + Intronic
1055972201 9:81922620-81922642 TACTGGTAACATAGGGAGGAAGG + Intergenic
1055973954 9:81937692-81937714 TACTGGTAACATAGGGAGGAAGG + Intergenic
1056025423 9:82489957-82489979 GACTGGAAAGAAAAAGAGTAAGG - Intergenic
1056544358 9:87601428-87601450 GACAGGCAGCAAAAGGAGGAAGG + Intronic
1056851193 9:90085929-90085951 CACTGGGAACAAAAAGACTAGGG - Intergenic
1057081790 9:92178995-92179017 GAGTGGAGACAAAAGGAAGAAGG + Intergenic
1057353825 9:94319728-94319750 ACCTGGAAACAGAAGGAAGAAGG + Exonic
1057567565 9:96178793-96178815 TTCTGGAAGCAAAAGCAGGAAGG + Intergenic
1057653926 9:96937864-96937886 ACCTGGAAACAGAAGGAAGAAGG - Exonic
1058596410 9:106620719-106620741 CAATGGAAAGACAAGAAGGAGGG + Intergenic
1058771484 9:108237237-108237259 CACTGCATACAAACTGAGGATGG + Intergenic
1058959388 9:109978551-109978573 TACAGGCAACATAAGGAGGATGG - Intronic
1059552663 9:115245096-115245118 CACAGAGAAAAAAAGGAGGAAGG - Intronic
1061138732 9:128751643-128751665 CATTAAAAACAAAAGGAGTAGGG - Intronic
1062714639 9:138002246-138002268 CATTGGAAATCAATGGAGGAAGG + Intronic
1185844617 X:3426192-3426214 AAATGGAAAGAAATGGAGGATGG + Intergenic
1186603924 X:11069005-11069027 CAGTGGAAAAAAAAAGAAGAAGG + Intergenic
1186913413 X:14193793-14193815 CCCTGGAATTAAAAGGAGGGTGG + Intergenic
1188523591 X:31065127-31065149 GACTGGGAGAAAAAGGAGGATGG + Intergenic
1188582173 X:31727580-31727602 CTCTGGACACAAAAGATGGAAGG + Intronic
1189459830 X:41231014-41231036 CACTGGAAAAAAAAGGATTTGGG + Intronic
1190014925 X:46818611-46818633 CACTGGAAACAAGAGCAGTAGGG + Intergenic
1190832037 X:54067466-54067488 CACCAGAAACAAAGGGAGAAAGG + Intergenic
1191043471 X:56110589-56110611 CACAGGAAACAAAATTAGAAGGG - Intergenic
1191611050 X:63114103-63114125 CACTGGAATCTATTGGAGGATGG + Intergenic
1191745470 X:64482192-64482214 AACTGAAAACAAAAAGAGGCAGG - Intergenic
1192845449 X:74902642-74902664 CACTGGAAACAAATGAATAATGG + Intronic
1193821262 X:86168357-86168379 CAATGGAAACCAAAGAAGCAAGG - Intronic
1195078603 X:101350427-101350449 CACTGGTAACAAAAAGACTAAGG + Intronic
1195119011 X:101730797-101730819 CACTGAAAAAAAAAAAAGGAAGG - Intergenic
1195534161 X:105992085-105992107 GATTGGAAAGAAAAGAAGGAAGG - Intergenic
1196154798 X:112416985-112417007 CAATGTAATCCAAAGGAGGAGGG + Intergenic
1198148386 X:133882222-133882244 CACTGGTTACAAAAGGAAGCAGG - Intronic
1198273545 X:135079081-135079103 CTAGGGAAAAAAAAGGAGGAGGG - Intergenic
1198827117 X:140711128-140711150 CACTGGAAGCACAGAGAGGAAGG - Intergenic
1198914449 X:141652447-141652469 CTCAGGAAACAAAAAGAGGCAGG - Intronic
1199843671 X:151675405-151675427 CACAGGGAGCAAAAGGAGCAGGG - Intronic
1200326434 X:155245176-155245198 CATTGGATACATAAGGAGGAGGG - Intergenic
1201256542 Y:12113104-12113126 CTCTGGAAAAAAAAAAAGGAAGG - Intergenic