ID: 1121321103

View in Genome Browser
Species Human (GRCh38)
Location 14:92992096-92992118
Sequence ATTCGAGGAGGTGCCGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 77}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121321103_1121321110 6 Left 1121321103 14:92992096-92992118 CCTTCAGCGGCACCTCCTCGAAT 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1121321110 14:92992125-92992147 CAAACCCATCACTCTTCGAATGG 0: 1
1: 0
2: 0
3: 4
4: 105
1121321103_1121321115 30 Left 1121321103 14:92992096-92992118 CCTTCAGCGGCACCTCCTCGAAT 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1121321115 14:92992149-92992171 CTTGTCCGGGACATGAGATGTGG 0: 1
1: 0
2: 0
3: 3
4: 91
1121321103_1121321114 17 Left 1121321103 14:92992096-92992118 CCTTCAGCGGCACCTCCTCGAAT 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1121321114 14:92992136-92992158 CTCTTCGAATGGACTTGTCCGGG 0: 1
1: 0
2: 0
3: 4
4: 52
1121321103_1121321113 16 Left 1121321103 14:92992096-92992118 CCTTCAGCGGCACCTCCTCGAAT 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1121321113 14:92992135-92992157 ACTCTTCGAATGGACTTGTCCGG 0: 1
1: 0
2: 1
3: 14
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121321103 Original CRISPR ATTCGAGGAGGTGCCGCTGA AGG (reversed) Intronic