ID: 1121321232

View in Genome Browser
Species Human (GRCh38)
Location 14:92992790-92992812
Sequence CACCTGAATGCTGCGTGACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 45}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121321225_1121321232 14 Left 1121321225 14:92992753-92992775 CCTGAGTCAGACAGACCTGGCTG 0: 1
1: 2
2: 6
3: 43
4: 266
Right 1121321232 14:92992790-92992812 CACCTGAATGCTGCGTGACGTGG 0: 1
1: 0
2: 0
3: 5
4: 45
1121321223_1121321232 22 Left 1121321223 14:92992745-92992767 CCGGGGAGCCTGAGTCAGACAGA 0: 1
1: 0
2: 0
3: 54
4: 545
Right 1121321232 14:92992790-92992812 CACCTGAATGCTGCGTGACGTGG 0: 1
1: 0
2: 0
3: 5
4: 45
1121321228_1121321232 -1 Left 1121321228 14:92992768-92992790 CCTGGCTGGATGCTGGCCCAGCC 0: 1
1: 0
2: 3
3: 35
4: 307
Right 1121321232 14:92992790-92992812 CACCTGAATGCTGCGTGACGTGG 0: 1
1: 0
2: 0
3: 5
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121321232 Original CRISPR CACCTGAATGCTGCGTGACG TGG Intronic
903973007 1:27131260-27131282 CAACTGGACGCTGCGTGACAGGG - Intronic
1062848013 10:722724-722746 CACCTGGTTGCTGCGTCAGGTGG - Intergenic
1064266645 10:13830729-13830751 CACAGGGATGCTGCGTGACATGG - Intronic
1064692388 10:17931319-17931341 CATCTAAATGCTGCTTGACTAGG + Intergenic
1070836219 10:79448511-79448533 CACCTGAATGCTGCCACACTGGG - Intergenic
1076277728 10:129218563-129218585 CACCTGCAAGCTGTGTGATGTGG - Intergenic
1090357640 11:126150577-126150599 CACCTGGGTGCTGGGGGACGTGG - Intergenic
1091099333 11:132855648-132855670 CATCTGAAGGCTGCCTGACCAGG - Intronic
1103938525 12:124489427-124489449 CCCCTTATTGCTGTGTGACGTGG - Intronic
1104392901 12:128406230-128406252 CACCTTACTGCTGTGTGAAGTGG + Intronic
1104447917 12:128847793-128847815 TACCTGAAAGCTGTGTGCCGTGG + Intergenic
1113445902 13:110366623-110366645 CACCTAAATGCTGCATGCAGTGG + Intronic
1113854017 13:113434332-113434354 CACCTGGATGCTGGGTCACGGGG - Intronic
1121321232 14:92992790-92992812 CACCTGAATGCTGCGTGACGTGG + Intronic
1121975801 14:98403155-98403177 CACCTGGATGCTGTGTGATTCGG - Intergenic
1124899948 15:33813056-33813078 TACCTGAATGCTGAGTGTGGAGG - Intronic
1125000830 15:34768502-34768524 TACCTGAATGCTGTGAGACCTGG - Intergenic
1128112585 15:65085925-65085947 CACCTGTTTGCTGGGTGACATGG + Intergenic
1128393876 15:67203340-67203362 CACCTGGATGGTGAGTGATGTGG - Intronic
1129833100 15:78683200-78683222 CAGCTGAATGCTGTGTGACCTGG + Intronic
1142241049 16:88945787-88945809 AACGTGAATGCTGGGTGGCGTGG - Intronic
1142549059 17:726740-726762 CACCTGGAAGCTGTGTGACCTGG - Intergenic
1144787235 17:17838626-17838648 CACCTGCTTGCTGTGTGACCTGG + Intergenic
1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG + Intronic
1150614069 17:66755395-66755417 CACCTGAATCATGTGTGATGAGG - Intronic
1164968988 19:32514340-32514362 CACTTGATTGCTGGGTGATGTGG - Intergenic
1167027640 19:46932777-46932799 CACCTCCTTGCTGAGTGACGTGG - Intronic
944986420 2:205182825-205182847 CACCTGAAAGCCAGGTGACGAGG - Intronic
947488731 2:230575781-230575803 CAGATGAATGCTGGGAGACGTGG - Intergenic
1168893575 20:1309189-1309211 CCCCTGAATTCTTCGTGAAGGGG - Exonic
1174871050 20:54182764-54182786 CAACTGAGTGCTGTGTGACTTGG - Intergenic
1184460150 22:44633291-44633313 CACCCCAATGCTGGGTGATGAGG - Intergenic
959896758 3:111614966-111614988 AACCTCAAAGCTGTGTGACGGGG - Intronic
960935092 3:122894434-122894456 CAGCTGTGTGCTGCGTGACATGG - Intergenic
961792223 3:129384452-129384474 CACCTGAAAGCAGCCTGACCTGG + Intergenic
961806244 3:129491359-129491381 CACCTGAAAGCAGCCTGACCTGG + Intronic
966596220 3:181726526-181726548 CTCCTAAATGCTGCCTGAAGAGG - Intergenic
1013283851 6:108663717-108663739 CTCATCACTGCTGCGTGACGTGG - Exonic
1026741075 7:72978952-72978974 CACCTGACTGCTGGGTGAGGTGG - Intergenic
1026800905 7:73399267-73399289 CACCTGACTGCTGGGTGAGGTGG - Intergenic
1027102658 7:75386126-75386148 CACCTGACTGCTGGGTGAGGTGG + Intergenic
1031743845 7:125468638-125468660 CTCCTGACTGCTCCGTGAAGTGG + Intergenic
1034948360 7:155279183-155279205 CTCCCAAATGCTGCGTGATGGGG - Intergenic
1035260759 7:157660069-157660091 CACATGAATTTTGCTTGACGTGG + Intronic
1036695950 8:10975272-10975294 CTCCTGAAGGCTGGGTGATGGGG - Intronic
1041983355 8:63890091-63890113 AACCTGAATGCTGGGTAACTGGG + Intergenic
1049604542 8:143523177-143523199 CACCAGAGTGCTGGTTGACGAGG - Intronic
1050562760 9:6851264-6851286 CACCTGAGTGCTGGGTGCAGTGG - Intronic
1057849223 9:98551722-98551744 CACCTGAATGCAGAGAGAAGTGG + Intronic
1061523755 9:131139975-131139997 CAACTTAATGGTGCCTGACGGGG - Intronic
1193975870 X:88118235-88118257 CACCTGCATGCTGCATAACATGG + Intergenic