ID: 1121322654

View in Genome Browser
Species Human (GRCh38)
Location 14:93001523-93001545
Sequence ACCTGGCTCCAGAAGGAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 225}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121322647_1121322654 17 Left 1121322647 14:93001483-93001505 CCTGTACTGAACCCAACAGGATT 0: 1
1: 0
2: 2
3: 13
4: 73
Right 1121322654 14:93001523-93001545 ACCTGGCTCCAGAAGGAGATAGG 0: 1
1: 0
2: 0
3: 21
4: 225
1121322649_1121322654 5 Left 1121322649 14:93001495-93001517 CCAACAGGATTCTAGAATCCTGA 0: 1
1: 0
2: 0
3: 13
4: 153
Right 1121322654 14:93001523-93001545 ACCTGGCTCCAGAAGGAGATAGG 0: 1
1: 0
2: 0
3: 21
4: 225
1121322645_1121322654 20 Left 1121322645 14:93001480-93001502 CCTCCTGTACTGAACCCAACAGG 0: 1
1: 0
2: 0
3: 11
4: 98
Right 1121322654 14:93001523-93001545 ACCTGGCTCCAGAAGGAGATAGG 0: 1
1: 0
2: 0
3: 21
4: 225
1121322648_1121322654 6 Left 1121322648 14:93001494-93001516 CCCAACAGGATTCTAGAATCCTG 0: 1
1: 0
2: 3
3: 10
4: 189
Right 1121322654 14:93001523-93001545 ACCTGGCTCCAGAAGGAGATAGG 0: 1
1: 0
2: 0
3: 21
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121322654 Original CRISPR ACCTGGCTCCAGAAGGAGAT AGG Intronic
900094735 1:935755-935777 TCCTGGCTGCAGAACGAGACCGG - Exonic
900316727 1:2060728-2060750 ACCTGCCGGCAGGAGGAGATGGG + Intronic
900931568 1:5741299-5741321 ACCTGGCTCCAGGTGGAGCTGGG - Intergenic
903055712 1:20634629-20634651 ACCTGGCTCCCTATGGGGATTGG + Intronic
903311940 1:22465616-22465638 ACTTTGCTCCAGATTGAGATCGG + Intronic
905891722 1:41522230-41522252 ACCTGGCCCCAGAAACAGACAGG + Intronic
906719039 1:47992595-47992617 ACCTGCCTCCGAAATGAGATGGG + Intronic
906776081 1:48530888-48530910 ACCTGGCTGGACAAGAAGATAGG + Intergenic
908558581 1:65282574-65282596 ACCTGTCACCAGAAGGAGGAGGG + Intronic
910213888 1:84822147-84822169 ACTTGGCCACAGAAGGAAATAGG - Intronic
912384409 1:109264130-109264152 GCCTGGCTCCAGACGGAGAGAGG - Exonic
913148681 1:116018171-116018193 ACCAGGCGCCAGAAGGAGGGGGG - Intronic
914869243 1:151459218-151459240 ACCCGGCGCCAGAAGGGGGTGGG + Exonic
915723443 1:158000939-158000961 ATCTGGCTCTGGAAGGTGATGGG + Intronic
916314643 1:163435905-163435927 ACCTGGCTGGAGAAGGGGAAAGG - Intergenic
917843290 1:179000177-179000199 ACCTGGCACCGGAAGTAGGTGGG + Intergenic
921238871 1:213155609-213155631 ACCATGCTCCAGTAGGAGCTGGG + Intronic
921338092 1:214108047-214108069 ACCTGGCTCTGGGAGGAGGTGGG - Intergenic
921433577 1:215090746-215090768 ACCTAGCTCAAGAAGGAGTGGGG - Intronic
922043771 1:221923179-221923201 ACCTGACTCCAAAAGAAAATGGG + Intergenic
922714334 1:227859063-227859085 ACCTTGCTCTGGAAGGGGATGGG + Intergenic
923167630 1:231381897-231381919 ACCTCTCTCCACAAGGAGACTGG + Intronic
1063055020 10:2495447-2495469 ACCTAGCTCCAGAAAGAAACAGG - Intergenic
1063460847 10:6214157-6214179 ACCTGGCTGCAGGAGGTGAGTGG + Intronic
1066695668 10:38075610-38075632 ACCTGGCACAAGAAGGTAATTGG + Intergenic
1067244120 10:44522163-44522185 CCCTGGATCCTGAAGGATATAGG - Intergenic
1070427406 10:76302955-76302977 ACCAGACTGCAAAAGGAGATTGG - Intronic
1070982841 10:80664068-80664090 ACCTGGCACCAGAAGTAAATGGG - Intergenic
1071229593 10:83570031-83570053 AACTGCCTAGAGAAGGAGATGGG - Intergenic
1071903182 10:90142520-90142542 TCCTGGCTCCAGAAAAAGGTGGG - Intergenic
1072196399 10:93120313-93120335 ACCTGGCTGTAGAAGGACAAGGG + Intergenic
1074892427 10:117746725-117746747 ACCTGGCTGTAGAAGGGGCTGGG + Intergenic
1074904498 10:117849603-117849625 ACCTGGCACCATAAAGAGAAGGG + Intergenic
1076193143 10:128497006-128497028 AACTTGCTCCAGAAGGACACAGG - Intergenic
1076391700 10:130108199-130108221 ACCTGGTTCCTGGAGGAGGTGGG - Intergenic
1076599847 10:131650444-131650466 CCCTGGGCTCAGAAGGAGATGGG + Intergenic
1077863163 11:6200629-6200651 ATCTGGCTCCAGGAGTAGAGAGG - Intergenic
1078156907 11:8807321-8807343 ACCTGGCACCTCAGGGAGATGGG - Intronic
1080700303 11:34638791-34638813 TCCTGCCTCCAGCAGAAGATGGG + Intronic
1081802289 11:45868270-45868292 AACTGTCCCCAGAAGGAGAGAGG + Intronic
1083611686 11:64007422-64007444 AACTGGCTTTGGAAGGAGATGGG + Intronic
1084651212 11:70490490-70490512 AGGTGGCTCCAGAAGCAGCTTGG - Intronic
1089351932 11:117826295-117826317 TCTTGGCTCCAGAAGCAGAAGGG - Intronic
1089918712 11:122186018-122186040 AGATGACTCCAGAAGGAGCTTGG + Intergenic
1091006808 11:131961074-131961096 ACCTGGCTACAAAAGGATCTAGG - Intronic
1091446188 12:545496-545518 AACAGGCTCCAGGAGCAGATGGG - Intronic
1092280640 12:7095531-7095553 ACCTGGCTTCTGCAGGAGATGGG + Exonic
1093197094 12:16142390-16142412 ACCTGCCTCCAAAAAGAGCTGGG - Intergenic
1096386475 12:51198095-51198117 ATCTGGCACAAGAAGGAGAGGGG + Intronic
1097281489 12:57847320-57847342 ACCTGACTCCAGCAGGGGATGGG + Intergenic
1098929243 12:76391424-76391446 ACCTGGTGCCCGAATGAGATAGG - Intronic
1102923843 12:116812031-116812053 ACCTGGCTCCAGGAGGAGCCCGG + Intronic
1104802917 12:131566855-131566877 TTCTGGCTCCAGAGGGAGCTGGG + Intergenic
1105751426 13:23425261-23425283 ACCAGGCCCCAGATGGACATCGG - Intronic
1105811409 13:23999561-23999583 CCCTGACTCCAGATGGAGTTGGG - Intronic
1106622049 13:31379985-31380007 ACCTGGCTACAGTAGGGGAAGGG + Intergenic
1108456573 13:50620954-50620976 ACCAGGCTGCAGGAGGAGAGAGG - Intronic
1108743280 13:53361670-53361692 GCCTGGCTCCAAAAGTAGATGGG - Intergenic
1111908717 13:94285995-94286017 CCCAGACTCCAGAAGAAGATGGG + Intronic
1114074438 14:19148944-19148966 CCGGGGCTCCAGAAGGATATAGG - Intergenic
1114075612 14:19159657-19159679 ATCTGGCTCCAGATGGCCATAGG - Intergenic
1114086549 14:19239915-19239937 ATCTGGCTCCAGATGGCCATAGG + Intergenic
1114087830 14:19251031-19251053 CCGGGGCTCCAGAAGGATATAGG + Intergenic
1116010757 14:39348889-39348911 ACATGGCTCCTGGAGGAGGTGGG - Exonic
1117421904 14:55555106-55555128 ACCTCTCCCCAGCAGGAGATTGG + Intergenic
1118297383 14:64583004-64583026 ACCTGGCCCCATAAGTAGCTGGG + Intronic
1119176965 14:72575463-72575485 ACGTTCCTTCAGAAGGAGATGGG + Intergenic
1119430934 14:74567605-74567627 AGCTGGGCCCAGAAGGAGACAGG - Intronic
1121172732 14:91868327-91868349 TCCAGGCTCCAGAAGCAGACGGG - Intergenic
1121322654 14:93001523-93001545 ACCTGGCTCCAGAAGGAGATAGG + Intronic
1122873363 14:104651402-104651424 AGGTGGCTCCAGGAGGAGCTAGG - Intergenic
1126001756 15:44217400-44217422 ACCTGGCTCCAGACCAAGGTAGG + Intergenic
1126206885 15:46056292-46056314 ACGTGGGTCAAGAAGGAAATAGG - Intergenic
1126410580 15:48369181-48369203 ACCTGGCTACAGAGTTAGATAGG + Intergenic
1126773833 15:52082736-52082758 AGCTGGCTCCACCAGGAGGTGGG - Intergenic
1130111386 15:80968282-80968304 AGATTGCTCCAGAAGGAGAATGG - Intronic
1130741519 15:86605668-86605690 ACCTGGCTTCAACTGGAGATTGG - Intronic
1131288793 15:91086804-91086826 AGGGGGATCCAGAAGGAGATGGG - Intergenic
1138316643 16:56076012-56076034 CCCTTGCTCCAGCAGGAAATAGG - Intergenic
1138499252 16:57428943-57428965 ACCTGGTTTCAGAATGGGATGGG - Exonic
1139558478 16:67727497-67727519 CCGTGGCTCCAGAGGGAGACAGG + Intronic
1140033353 16:71355605-71355627 ACCTGGCTCCAGAGTGGGCTGGG - Intergenic
1141000184 16:80300486-80300508 ACCTGGCTCCAGCAGGGGCCAGG + Intergenic
1141552514 16:84815623-84815645 GCCTGGCTGCAGAGGGAGACGGG + Intergenic
1142219104 16:88844380-88844402 ACTTTGCTCTAGAAGGAGAAGGG + Intronic
1143672362 17:8405507-8405529 TCCTGGCTCCAGATGAGGATGGG + Intergenic
1144506304 17:15834196-15834218 GCCTGGCTGCAGAAGGAGCTGGG + Intergenic
1144766895 17:17737977-17737999 CCCTGGCCCCAGAAGGAGGGAGG + Intronic
1144775071 17:17781271-17781293 ACCTCCCTCCTGAAGGAGGTGGG - Intronic
1144827886 17:18116578-18116600 AACTGGCTCCAAGAGGAGCTGGG + Intronic
1145170480 17:20652129-20652151 GCCTGGCTGCAGAAGGAGCTGGG + Intergenic
1146080149 17:29772717-29772739 TCCTAGCTCCAGGAGGAGAGAGG - Intronic
1146297745 17:31662883-31662905 TCCTGGCTCTAGAAGGAGTTAGG - Intergenic
1149972628 17:61234361-61234383 ACCTGGCTCCAGTCAGAGAGAGG - Intronic
1150004814 17:61463081-61463103 AGGTGGCTCCAGAAGGAGGAAGG - Intronic
1150435805 17:65153285-65153307 ACCTGGCTCCTGTACCAGATGGG + Intronic
1151716582 17:75834253-75834275 ACCTGGCTCCAGCAGCACCTGGG - Intronic
1152930548 17:83107527-83107549 CCCTCTCTCCAGAAGGAGAAGGG - Intergenic
1155334671 18:24751632-24751654 GCCTGGCTCCAGAAGCATCTTGG - Intergenic
1157605162 18:48921885-48921907 CCCAGGCTCCAGAAGAAGTTGGG + Exonic
1158423901 18:57322149-57322171 AGCTGAATCCACAAGGAGATTGG + Intergenic
1160910736 19:1472679-1472701 AGCTGTCTCCAGAAGGGGACAGG + Exonic
1163396144 19:17062762-17062784 AACAGGCTCCTGCAGGAGATGGG - Exonic
1164539815 19:29114189-29114211 GCCTGGCTCTAGGAGGTGATGGG + Intergenic
1164539835 19:29114245-29114267 GGCTGGCTCTAGAAGGTGATGGG + Intergenic
1167100524 19:47401826-47401848 ACCTGGCCTCTGAAGGAGAAGGG + Intergenic
925817628 2:7768905-7768927 ACGTGGCTAGAGAAGGAGAAAGG - Intergenic
927038735 2:19206618-19206640 TCCTGGCTCCTGAAAGAGTTTGG - Intergenic
927042225 2:19241098-19241120 ACCTGGCTCCAGAGGAGCATTGG + Intergenic
927259052 2:21068466-21068488 ACCTAGCTACAGAAGGAGGATGG - Intergenic
927691590 2:25212313-25212335 GCCTGTTTCCAGAAGGAAATGGG - Intergenic
929773215 2:44910332-44910354 ACATGGCTTCAACAGGAGATTGG + Intergenic
932826719 2:74948006-74948028 CCCTGGCTCCAGCAGGGGAAAGG - Intergenic
933427416 2:82130211-82130233 ACCTGGGTAAAGAATGAGATTGG + Intergenic
937989180 2:127652964-127652986 CCTTGGCTCAGGAAGGAGATTGG + Intronic
938257222 2:129868718-129868740 TCCTCCCTCCAGAAGGAGAGCGG + Intergenic
944015865 2:195036705-195036727 ACCTGACACCAGCAGAAGATGGG + Intergenic
944160690 2:196656163-196656185 ACCTGCCTCTAGAAGCAGAAGGG - Intronic
945042297 2:205752408-205752430 ACCTGGCTCTCAGAGGAGATGGG - Intronic
947109774 2:226706405-226706427 TCCTGGCTCAAGCAGGAGATGGG + Intergenic
948257347 2:236577873-236577895 AGCTGGGTCCAGAGGGAGCTCGG - Intronic
1168973284 20:1945577-1945599 ACCTGTCTCCAGAATGAGGCCGG + Intergenic
1169457821 20:5767886-5767908 AGCTGGCTACAGGAGGAGAAGGG + Intronic
1169661511 20:7983395-7983417 ACCTGGCCCCAGAAGAAGTGTGG + Intronic
1170261399 20:14412260-14412282 AGCTGGCTCCAGAAGGGCCTAGG - Intronic
1170485622 20:16813039-16813061 ACCCAGCTGCAGAAGGAGGTAGG - Intergenic
1173304771 20:41837657-41837679 AACTGGCACCAGTAGGAGAATGG - Intergenic
1173415317 20:42849939-42849961 ACCTGGACCCAGAAGGAAATGGG - Intronic
1174203625 20:48824274-48824296 ACCCAGTTCCTGAAGGAGATGGG + Intronic
1175345692 20:58272994-58273016 ACCTGTGTCCAGAAGGAGGACGG + Intergenic
1175922161 20:62455376-62455398 CCCAGGCTCCAGAAGGATCTGGG - Intergenic
1176617769 21:9037522-9037544 ATCTGGCTCCAGATGGCCATAGG + Intergenic
1176707375 21:10126165-10126187 ATCTGGCTCCAGATGGCCATAGG - Intergenic
1177224836 21:18241031-18241053 AACTGGCTCCTGAATGAGGTAGG + Intronic
1178108513 21:29348242-29348264 ACCGTGCTCCAGAAGGAACTAGG + Intronic
1179022551 21:37653418-37653440 GCCAGGCTGCAGAAGCAGATGGG + Intronic
1180290084 22:10841884-10841906 CCGGGGCTCCAGAAGGATATAGG - Intergenic
1180291314 22:10852823-10852845 ATCTGGCTCCAGATGGCCATAGG - Intergenic
1180492882 22:15871306-15871328 CCGGGGCTCCAGAAGGATATAGG - Intergenic
1180494119 22:15882245-15882267 ATCTGGCTCCAGATGGCCATAGG - Intergenic
1182960980 22:34474914-34474936 AACAGGCTCCAGAAAGAGAGAGG - Intergenic
1183276451 22:36901077-36901099 AGCTGGCACCAGAATGAGAACGG - Intergenic
1184118210 22:42434213-42434235 GCCAGGCTCAAGAAGGAGAGGGG - Intergenic
1184286905 22:43477054-43477076 ACCCTGCTCCAGAAGGGGTTTGG + Intronic
1184947237 22:47812196-47812218 ACCTGGAGCCAGGAGGAGCTGGG + Intergenic
949358572 3:3207446-3207468 AGCTGGAACCAGAAGGTGATAGG - Intergenic
950547210 3:13645651-13645673 ACCTGTCTCCTGAAGGGGAAGGG + Intergenic
951437372 3:22680179-22680201 ACTTGGCCCCAGAGAGAGATTGG - Intergenic
952116782 3:30191730-30191752 AACTACCTCCAGAAGGAGGTAGG + Intergenic
953838675 3:46370271-46370293 TCCTGGGTCCAGAAAAAGATGGG + Intergenic
956508727 3:69972157-69972179 ACCTGCCTCCAAGAGGAGGTTGG - Intergenic
957614613 3:82510286-82510308 ACCTGGCTACAGCAGCTGATAGG + Intergenic
958733665 3:97986193-97986215 ACTTGACTGGAGAAGGAGATTGG + Intergenic
961648310 3:128404506-128404528 TCCTGGCACCAGAGGGAGACGGG + Intronic
962359365 3:134724519-134724541 ACCCAGCTCCAGAAGTAGGTGGG + Intronic
966877075 3:184328566-184328588 ACGTTGCCCCAGAAGGAGAGTGG + Intronic
967528491 3:190521749-190521771 ACCTGGGTCCTGAAGGGGATGGG - Intronic
968664588 4:1814159-1814181 TCCTGGCTCCAGAGGCAGCTGGG - Exonic
968797974 4:2721638-2721660 ACCTTCCTCCAGCAGGAGAGAGG - Intronic
969993685 4:11290406-11290428 TCCTGGCTCCAGCAGCAGCTTGG + Intergenic
971632944 4:29018367-29018389 ACCTGGCTCCAAAGGGATTTAGG + Intergenic
972406488 4:38751427-38751449 CCCAGGTTCCAGAAGCAGATGGG + Intergenic
977320261 4:95505284-95505306 ACCTGGCTGTGGAAGGAAATTGG - Intronic
978199747 4:106012090-106012112 ACCAGGCTCCAGGAGGATACTGG + Intergenic
978234059 4:106436596-106436618 ACCTTTCTCCAGAAAGAGCTAGG - Intergenic
978656809 4:111074842-111074864 CCCTGGCTCCAGCAGGGGAAAGG - Intergenic
980191081 4:129525998-129526020 CCCTGGGGTCAGAAGGAGATGGG + Intergenic
985267116 4:188160573-188160595 CCCTGGCTCCAGAAGCAGAGAGG - Intergenic
985762487 5:1757408-1757430 ACCTGTCTCCAGAAGACCATGGG + Intergenic
987373574 5:17215643-17215665 ATCTGGCCCCAAAAGGAGGTGGG + Intronic
987396458 5:17429422-17429444 TCCTGGATCCAGAAGGAAAGAGG - Intergenic
989243926 5:39232191-39232213 AGCTGACTCCTGAAGGAGATTGG - Intronic
989539971 5:42606930-42606952 ACCTAGCTCTGGAAGCAGATAGG - Intronic
990620128 5:57550274-57550296 CCCTGGCTCCAGCAGGCGAAAGG + Intergenic
996646713 5:125826395-125826417 AAGTGGATCCAGAAGGAGAATGG - Intergenic
997475432 5:134139770-134139792 ACTTGGCTCCCCAAGGAGATCGG + Intronic
997599655 5:135130635-135130657 CCCTTGCTCCAGAGGGAGGTTGG - Intronic
997743579 5:136279021-136279043 ACCGGGCAGCAAAAGGAGATGGG + Intronic
998365508 5:141628211-141628233 ACCTGGCACCCCAAGGGGATGGG + Intronic
998397221 5:141826458-141826480 ACCAGCCTCCAGATTGAGATTGG - Intergenic
998400250 5:141844973-141844995 TCCTGGCTCCAGAAGGACCCCGG + Intergenic
998815873 5:146013659-146013681 ACCTGGCTTCAGATGTACATGGG + Intronic
998940192 5:147273411-147273433 GCCTGGGTCCAGAATGAGAAAGG + Intronic
1001332739 5:170773584-170773606 ACCTGGCTTCAGGTGGGGATTGG - Intronic
1005931909 6:30490541-30490563 TCCTAGCCCAAGAAGGAGATGGG - Intronic
1006182693 6:32163707-32163729 ACCTGGCTCCCCAAGGAGGGTGG + Intronic
1007114010 6:39330533-39330555 ACCTGGGGCCAGAAGGGGAGGGG + Exonic
1007320464 6:41024990-41025012 ACCTGACTCAAGAAGGCAATGGG - Intergenic
1007476206 6:42121705-42121727 ACCAGGCTCCAGGAGGAGTCTGG - Intronic
1007503813 6:42318929-42318951 ACCTTGCTGCAGGAGGAGATGGG - Intronic
1007760826 6:44132719-44132741 ACCTGTGTCCAGGAGGAGCTAGG - Intronic
1012442498 6:99274184-99274206 GCCTGGCTTCAGAAGGGGAATGG + Exonic
1016461680 6:144285410-144285432 CTCTGGCTCCAGAAGCCGATTGG + Intergenic
1016770290 6:147841895-147841917 ACATGGCTCCAGATGGAGGCTGG + Intergenic
1018938092 6:168287137-168287159 ACCTGGTTCCTGGAGGAGGTGGG + Intergenic
1019125569 6:169838216-169838238 ACCTGGCCCCAGAAGAAGGCTGG - Intergenic
1023887768 7:44373484-44373506 ACCAGGGTCCAGAGGGAGAATGG - Intergenic
1026977341 7:74506706-74506728 CCCTGGGTCAAGAAGGAGAGGGG + Intronic
1028598289 7:92571048-92571070 TCTTTCCTCCAGAAGGAGATGGG - Intronic
1029710094 7:102294756-102294778 ACCTGGCTACAGATGGAGAGAGG - Intronic
1033533140 7:142286405-142286427 ACCTGGCTTCTCAAGGAGTTTGG + Intergenic
1034968058 7:155403677-155403699 CTCTGGCTCCAGGAAGAGATGGG + Intergenic
1036235873 8:7039004-7039026 GTCTGGCTCCAGAAGGAACTAGG + Intergenic
1036661239 8:10710478-10710500 GGCTGACTGCAGAAGGAGATTGG + Intronic
1037573608 8:20179902-20179924 ACCTGGCCACAGGAGGGGATGGG + Intronic
1038612957 8:29071123-29071145 GCCTGGGTCCAGATGGAGAAGGG - Intronic
1039080068 8:33725375-33725397 TCCTGGCCACAGGAGGAGATAGG + Intergenic
1039262443 8:35786478-35786500 ACCTGCCTCAAGAAAGAGAAGGG - Intronic
1039567706 8:38563445-38563467 ACCTGGCTCCAGCAGCAGGAAGG - Intergenic
1039919418 8:41882792-41882814 CCCTGACTCCAGAGGGAGAGGGG - Intronic
1042166794 8:65953390-65953412 ACCTGGCTCCCTAAGGAGAGTGG + Intergenic
1042701945 8:71625158-71625180 ACCTGGCTACAGGAGGAGCTGGG - Intergenic
1047306215 8:123655029-123655051 ACATGGTTCCAGAAGCAGACAGG - Intergenic
1047450533 8:124961430-124961452 ACCTCGCTCCAGAATGTTATGGG - Intergenic
1048253276 8:132885051-132885073 GCCTGGTTACAGAAGGAAATTGG + Intronic
1049521591 8:143094263-143094285 ACCTGGACCCAGAAGGACAGAGG - Intergenic
1049797839 8:144504673-144504695 ACCTGGCGCAGGAAGGTGATGGG - Exonic
1049819213 8:144624443-144624465 ACTGGTCTTCAGAAGGAGATTGG - Intergenic
1050266658 9:3897853-3897875 ACCTGGCTCTGGAATCAGATGGG + Intronic
1052935995 9:34093644-34093666 ACCTAGATACTGAAGGAGATAGG + Intronic
1054325586 9:63710765-63710787 ATCTGGCTCCAGATGGCCATAGG - Intergenic
1054350191 9:64013511-64013533 ATCTGGCTCCAGATGGCCATAGG + Intergenic
1054540013 9:66263084-66263106 ATCTGGCTCCAGATGGCCATAGG + Intergenic
1054938334 9:70712990-70713012 ACCTGGTTCCAGTGGGAGAGAGG - Intronic
1054940025 9:70730983-70731005 ACCTGGTTCCAGTGGGAGAGAGG - Intronic
1056457421 9:86774192-86774214 CCCTGGCTCCAGGAGGGGCTGGG - Intergenic
1058731839 9:107857846-107857868 GCCTGGCTCTAGAATGAGATTGG - Intergenic
1059334048 9:113557530-113557552 ACCTGGCTTGAGAATGAGAGAGG + Intronic
1059343759 9:113614793-113614815 ACCTGCTTCCAGTGGGAGATTGG + Intergenic
1060073019 9:120566747-120566769 GCCTGGCTCCAGAAGCCAATGGG + Intronic
1060513508 9:124251117-124251139 TGCTGGCTGCAGAAGGAGTTGGG + Intergenic
1060513867 9:124253684-124253706 TGCTGGCTGCAGAAGGAGTTGGG - Intergenic
1060957221 9:127650828-127650850 TACTGGCTGCAGAAGCAGATGGG + Intronic
1061405840 9:130392614-130392636 GTCTGGCTTCAGAATGAGATTGG + Intronic
1061850885 9:133414588-133414610 ACCAGCCTCCATAAGGAGACAGG + Intronic
1061941501 9:133886601-133886623 TCTTGTCTCCAGTAGGAGATTGG - Intronic
1202792122 9_KI270719v1_random:95045-95067 ATCTGGCTCCAGATGGCCATAGG - Intergenic
1185797655 X:2980776-2980798 ACATGGTCTCAGAAGGAGATGGG + Intergenic
1186753582 X:12646979-12647001 TCCTGGAGCCAGAAGGAGCTGGG - Intronic
1193659065 X:84235271-84235293 GCCTGGCTGCAGAAGAAGAATGG + Intergenic
1194053331 X:89100230-89100252 ACCAGGCTCCAGCAGGTGTTGGG + Intergenic
1196225118 X:113157510-113157532 ACCAGGCTCCAGGATGATATTGG + Intergenic
1196517288 X:116628617-116628639 CCCTGGCTCCAGCAGGGGAAAGG + Intergenic
1196736015 X:118981682-118981704 ACAAGGCTTCAGAAGGAGCTGGG + Intronic
1197013539 X:121596096-121596118 ACCAGGATCCAGAATGAGGTAGG + Intergenic
1197367551 X:125582717-125582739 ACCTTCCTCAAGAAGGAAATGGG + Intergenic
1197817310 X:130511646-130511668 AGCTGGCTCCAAAAGTGGATTGG + Intergenic