ID: 1121323105

View in Genome Browser
Species Human (GRCh38)
Location 14:93004189-93004211
Sequence CACCAGGGTGTGCCTCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121323105_1121323112 7 Left 1121323105 14:93004189-93004211 CCAGCAGGAGGCACACCCTGGTG 0: 1
1: 0
2: 3
3: 18
4: 201
Right 1121323112 14:93004219-93004241 GACAGCTGTGCATTGGCGACAGG 0: 1
1: 0
2: 0
3: 5
4: 84
1121323105_1121323111 0 Left 1121323105 14:93004189-93004211 CCAGCAGGAGGCACACCCTGGTG 0: 1
1: 0
2: 3
3: 18
4: 201
Right 1121323111 14:93004212-93004234 GGCAGTGGACAGCTGTGCATTGG 0: 1
1: 0
2: 0
3: 24
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121323105 Original CRISPR CACCAGGGTGTGCCTCCTGC TGG (reversed) Intronic
900126904 1:1072776-1072798 CACCGGGGTGAGCCTCCCACAGG + Intronic
901063522 1:6484737-6484759 GACCCTGGTGTCCCTCCTGCAGG - Intronic
901814350 1:11785337-11785359 CAGCAGGGGGAGCCTGCTGCTGG + Intronic
902121484 1:14169617-14169639 CACCAGGGTGACCCTGCTGCAGG - Intergenic
902149398 1:14430711-14430733 CACCCTGGTGTGAGTCCTGCAGG - Intergenic
902873249 1:19326617-19326639 CACCAACGTGAGCCTCCAGCAGG + Exonic
903046646 1:20569401-20569423 CACCAGGATGTGCCTCCCAAGGG - Intergenic
903275492 1:22218761-22218783 CACCAGGATGGGCCTCCTTCTGG - Intergenic
904457688 1:30657351-30657373 CACTAGGCGGTGACTCCTGCAGG + Intergenic
905803631 1:40861392-40861414 CTCCAGGCCTTGCCTCCTGCGGG - Exonic
906110906 1:43321389-43321411 CAGTAGGGTGTACCTCCTGCAGG - Exonic
911819032 1:102392693-102392715 CACCAGAGTTTGTCTCCTTCAGG - Intergenic
915245859 1:154555949-154555971 CAGCAGGGTATGACTCCTGAAGG + Exonic
918225481 1:182477462-182477484 TATCAGGGTGTGGTTCCTGCTGG - Intronic
918727342 1:187942322-187942344 CACAAGGTCCTGCCTCCTGCTGG - Intergenic
918825428 1:189317126-189317148 CAGTCAGGTGTGCCTCCTGCTGG - Intergenic
923287276 1:232508505-232508527 CAGCAGGCTTTGCCTCCTTCTGG - Intronic
923717259 1:236435530-236435552 GACCACGCTGTGCCTCCTGAGGG - Intronic
924743183 1:246809608-246809630 CACCAAGGGGAGCCTTCTGCAGG + Intergenic
924743199 1:246809667-246809689 CACCAGGGGGAGCCTCCCGCAGG + Intergenic
1063129271 10:3163515-3163537 CACCATGCTGAGCCTCCTGAGGG + Intronic
1063137318 10:3229039-3229061 CTCCAGGGTGTCTCACCTGCAGG + Intergenic
1064086886 10:12351664-12351686 CTCCAAGCTGTGGCTCCTGCTGG + Intronic
1067451404 10:46384264-46384286 GATCCTGGTGTGCCTCCTGCAGG + Intronic
1067585838 10:47475492-47475514 GATCCTGGTGTGCCTCCTGCAGG - Exonic
1071478340 10:86043442-86043464 CCCCTGGGAGTGCATCCTGCAGG + Intronic
1075074454 10:119341531-119341553 CACCAGGGAGGGCTTCCTGGAGG - Intronic
1075719165 10:124574942-124574964 CTCCAGCCTCTGCCTCCTGCCGG + Intronic
1076440261 10:130476636-130476658 CAGCAGGGTCGGCCTCCTCCAGG + Intergenic
1076599104 10:131645716-131645738 TAGCAGGGGGTGCCTCCCGCTGG - Intergenic
1076917583 10:133432360-133432382 CACCAGGGTGTGTGTGCAGCTGG - Intergenic
1076937581 10:133576435-133576457 CACCAGGGTGTGTGTGCAGCTGG - Intergenic
1077140831 11:1024153-1024175 CATCAGGCTTTGCCACCTGCAGG + Intronic
1077493096 11:2871144-2871166 CCCCATGGGGTGCCTGCTGCAGG - Intergenic
1078069275 11:8097707-8097729 CCCCAAGGTGTTCCTCCTGGCGG + Exonic
1078087604 11:8243549-8243571 CAGCAGGGTGGGCCGGCTGCTGG + Intronic
1078514113 11:12008543-12008565 CACCCTGCTGTGCCTGCTGCTGG - Exonic
1081658380 11:44873019-44873041 CACCAGGGAGGGCTTCCTGGAGG + Intronic
1083293576 11:61703236-61703258 CACCAGGGTGTGGCTTCTCAGGG - Intronic
1083614390 11:64019104-64019126 CTCCAGGGTGTGCTTGCTGCCGG - Intronic
1084411015 11:69005904-69005926 TACCGGCGTGAGCCTCCTGCCGG - Exonic
1084583150 11:70037120-70037142 CACCTGGGTGTACCTCTTGAAGG - Intergenic
1089500881 11:118930515-118930537 CAGTAGAGTGTGCCTCTTGCGGG + Intronic
1089681573 11:120121739-120121761 GCCCAGTGTGAGCCTCCTGCAGG - Intronic
1090101862 11:123805923-123805945 CAGCAGGGCCTGCCTTCTGCTGG - Exonic
1090106807 11:123862186-123862208 AAGCAGGGCCTGCCTCCTGCTGG - Intergenic
1090188998 11:124756314-124756336 CTCCAGGGTGTGCCCCATGTGGG - Exonic
1091702747 12:2674618-2674640 GACCAGGTGGTGCCCCCTGCAGG + Exonic
1092720148 12:11433166-11433188 CACCTGGGAATGCCTCCTTCAGG - Intronic
1094836218 12:34323331-34323353 CACTATGGGGTGCCCCCTGCGGG + Intergenic
1095970091 12:47895821-47895843 CACCAGGCTGAAGCTCCTGCCGG + Intronic
1095970754 12:47900658-47900680 ATCCAGTGTGTGCCACCTGCTGG - Intronic
1097358705 12:58632274-58632296 CTACAGGGTGTGCTTCCTTCTGG - Intronic
1102031731 12:109743742-109743764 CAGCAGGCTGTGCTTCCGGCCGG - Intronic
1103887527 12:124214106-124214128 CAACAGGATGTGACCCCTGCTGG - Intronic
1104914393 12:132257400-132257422 CACCAGGTTGTGCTTGCTGGGGG + Intronic
1112259065 13:97861861-97861883 GACCAGGTTGTTCCTCCTGAAGG - Intergenic
1114152778 14:20063837-20063859 CAATAGGGTGTGCCTCCCTCTGG - Intergenic
1121323105 14:93004189-93004211 CACCAGGGTGTGCCTCCTGCTGG - Intronic
1122060018 14:99130831-99130853 CATCTCTGTGTGCCTCCTGCAGG + Intergenic
1122249019 14:100425133-100425155 CACCTGGGTGTGTCCCTTGCTGG + Intronic
1122257694 14:100491107-100491129 GACCACAGTGTGCCTCCTGCAGG + Intronic
1122412591 14:101533584-101533606 CACCCTGGTGTACCCCCTGCTGG - Intergenic
1122798957 14:104220451-104220473 CCGCAGGCTGGGCCTCCTGCGGG - Intergenic
1123097677 14:105774143-105774165 CTCCAGGGGCTGCCCCCTGCTGG + Intergenic
1123714625 15:23017882-23017904 CACCATGGTGTGCTGCCTGCTGG + Exonic
1123990871 15:25682420-25682442 CCCCAGTGTGTGTTTCCTGCAGG - Intronic
1124407952 15:29408415-29408437 CACCAGGGCGTTCCTCCTTTTGG - Intronic
1127283283 15:57510346-57510368 ACCCAGGCTGTGCCTCTTGCTGG - Intronic
1128557077 15:68639164-68639186 CACAAGGAGGTGCCTCCTTCAGG - Intronic
1129328923 15:74816780-74816802 CGGCAGGGTGGGCCCCCTGCTGG - Intronic
1130543111 15:84836137-84836159 CACCAGGCTTTGACTCTTGCAGG - Intronic
1132765796 16:1533561-1533583 CAACAGGATGTGCTTCCTGATGG - Exonic
1132802271 16:1760271-1760293 AACCAGGCTGTGCCTTCTCCAGG + Intronic
1132904314 16:2274334-2274356 CACACGTGTGTGCCTCATGCGGG + Intergenic
1133763451 16:8818643-8818665 CACCAGACTCTGCCTCCTGGAGG - Intronic
1134126804 16:11621681-11621703 CACCTGGGGCTGCATCCTGCCGG - Intronic
1135886270 16:26311321-26311343 CTCCTGGTTGTGCCTCCAGCTGG - Intergenic
1141814366 16:86399746-86399768 CCTCAGGATGTTCCTCCTGCTGG - Intergenic
1142006896 16:87693597-87693619 CAGCAGCCTCTGCCTCCTGCGGG - Intronic
1142071420 16:88092871-88092893 CCCCAGCCTGTGCCTTCTGCTGG + Intronic
1143322264 17:6075831-6075853 CCCCAAGGTGTGCTTCCTGTGGG - Intronic
1143388708 17:6547535-6547557 CAACAGGCTCTGCCACCTGCAGG + Intronic
1144629867 17:16865536-16865558 CTCCAGGGTGACCCTCCTCCTGG + Intergenic
1144651563 17:17010581-17010603 CTCCAGGGTGACCCTCCTCCTGG - Intergenic
1146008389 17:29176690-29176712 CTCCAGGGGGAGCCTCCTCCCGG + Intronic
1147663450 17:42129939-42129961 CACCAGGCTGTTCCTTCTTCTGG + Intronic
1148159937 17:45444062-45444084 GGCCAGGGTGTGCCTCGAGCAGG - Intronic
1148905529 17:50909566-50909588 CACCAGGGGTTACCTCCTGCTGG + Intergenic
1149555219 17:57568820-57568842 CACCAAGGTGGGCCTCCAGGGGG + Intronic
1149963396 17:61136893-61136915 CACCAGGGTCTGGTTACTGCTGG - Intronic
1151490413 17:74429756-74429778 CACCAGGGTCTGACTCATGGTGG + Intronic
1151686561 17:75650614-75650636 CTCCTGGGTGTCTCTCCTGCAGG + Intronic
1151880052 17:76889343-76889365 CACCAAGGGGTGGCTCCAGCAGG + Intronic
1152067687 17:78120756-78120778 CCGCAGGGTGGGCGTCCTGCAGG - Exonic
1152713820 17:81888637-81888659 GACCAGGGTGTGGCGCCAGCTGG - Intronic
1154197957 18:12279909-12279931 GACCAGGATGTGCCCCATGCAGG + Intergenic
1156868643 18:41917430-41917452 CACCCAGATGTTCCTCCTGCAGG - Intergenic
1157087843 18:44600013-44600035 ACCCAGGGTGTGCCTCCTCCGGG + Intergenic
1157192718 18:45594859-45594881 GACCAGGGTGTGACGGCTGCTGG - Intronic
1160296993 18:77647789-77647811 TGGCAGGGGGTGCCTCCTGCTGG + Intergenic
1160578495 18:79870378-79870400 CACCAGTGTTGGCTTCCTGCTGG + Intronic
1160839789 19:1141005-1141027 CTCCAGGGTGTGTCTTCTCCAGG - Intronic
1160919837 19:1514122-1514144 CAGCAGGGTGGGCTTCCTGGAGG - Intergenic
1161298724 19:3532682-3532704 CCTCAGGATGTGCGTCCTGCTGG + Intronic
1161499801 19:4607576-4607598 CATCAGGGTGGGCTTCCTGGAGG + Intergenic
1161585474 19:5103144-5103166 GGCCAATGTGTGCCTCCTGCAGG + Intronic
1162145320 19:8609569-8609591 CGGCAGGGACTGCCTCCTGCCGG - Intronic
1162477258 19:10908069-10908091 CTCCAGGGTGTGGCCCCGGCAGG - Exonic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
1163862068 19:19747834-19747856 GACCCGCCTGTGCCTCCTGCTGG - Intergenic
1166129819 19:40739521-40739543 CAACATGATCTGCCTCCTGCAGG + Exonic
1168689603 19:58368751-58368773 CACCAAGGGGTTCCTCCCGCGGG + Exonic
926697945 2:15783888-15783910 CACCAGGAAGAGCTTCCTGCAGG - Intergenic
928120124 2:28577990-28578012 GCCCAGGGTGGGCCTCCTGCAGG - Intronic
929925293 2:46202393-46202415 CCCCAGGATATGGCTCCTGCTGG - Intergenic
932495543 2:72144213-72144235 GACCCGGGTGTGGCTCCCGCAGG - Exonic
937337899 2:121072933-121072955 AACCACGTGGTGCCTCCTGCAGG + Intergenic
938117069 2:128609256-128609278 CAGGAGGGTATGCCTGCTGCTGG + Intergenic
938769854 2:134491991-134492013 CTCCAGCCTGTGCCACCTGCTGG + Intronic
942251504 2:174051247-174051269 AACCAGGGAGGGCTTCCTGCAGG - Intergenic
942491034 2:176490199-176490221 GACCTGTGTGTGCCTCCTCCAGG + Intergenic
948679946 2:239626996-239627018 ACCCAGGGTGTGCCCCCGGCTGG + Intergenic
948791945 2:240383686-240383708 CAACAGGGTGAGGCTCCTCCTGG + Intergenic
1171405448 20:24909594-24909616 CAGCAGTGTGTGGCTCCTCCTGG - Intergenic
1172097949 20:32469774-32469796 CACCAGTGTGGGACCCCTGCAGG - Intronic
1172881429 20:38202353-38202375 CATCAGGGTGGGCTTCCTGGAGG + Intergenic
1174486638 20:50865588-50865610 CACCAGCTTGTCCCTGCTGCTGG + Intronic
1174757645 20:53175499-53175521 CACAAGGGTGTGTTTCCTTCTGG - Intronic
1175734076 20:61373185-61373207 CACCCAGGTGTGTGTCCTGCCGG + Intronic
1176112702 20:63417820-63417842 CAGCAGGGTGTGTCTGCCGCTGG - Intronic
1179046236 21:37847855-37847877 AACCAGGGTGTGCCTCACGGAGG + Intronic
1180029966 21:45200260-45200282 CACCAGGGTGTCCATCCCACTGG + Intronic
1180698654 22:17769990-17770012 CAGCAGCGTGTCCCTCCTGGGGG - Intronic
1180790730 22:18574150-18574172 CGCCAGGGTTCGCTTCCTGCTGG - Intergenic
1181231007 22:21421164-21421186 CGCCAGGGTTCGCTTCCTGCTGG + Intronic
1181247641 22:21513704-21513726 CGCCAGGGTTCGCTTCCTGCTGG - Intergenic
1181323052 22:22023330-22023352 GGCCAGGATGTGCTTCCTGCAGG + Intergenic
1181368827 22:22400137-22400159 CACCGTGGGGTGCCTCCTTCTGG + Intergenic
1182519761 22:30878728-30878750 CACCAAAGTGTGTCTCCTGAGGG - Intronic
1185221896 22:49633213-49633235 CCCCAGCGTCTGCCTCCTGCGGG - Intronic
950787801 3:15450410-15450432 CCCAAGGGTGTCCCTCCAGCTGG + Exonic
951781578 3:26369295-26369317 CAGCAGGCTGTGTCTCCTCCCGG + Intergenic
952762076 3:36923746-36923768 CACCAGAGTGTAGCTCCTGCCGG - Intronic
954425764 3:50442277-50442299 CACAGGAGTGTGCCTCATGCTGG - Intronic
954644842 3:52124909-52124931 CTCCAGAATGGGCCTCCTGCAGG - Intronic
954682364 3:52352701-52352723 CACCAATGTAGGCCTCCTGCAGG + Exonic
955151868 3:56375390-56375412 CACCAGTGTCTTCCTCCTACTGG - Intronic
956174075 3:66456930-66456952 CACCAGGGAGTGCCTCCAGCTGG - Intronic
956868550 3:73393141-73393163 CAGCAAGATGTGTCTCCTGCAGG - Intronic
958980178 3:100710222-100710244 AACCAGGCTGGGCCTCCAGCCGG - Intronic
959898579 3:111633728-111633750 CATCAGTGTGTGCATCCTGGCGG + Intronic
960936715 3:122908864-122908886 CTCCAGGGTGTGAGTCCAGCGGG - Intergenic
961381439 3:126498634-126498656 GGCCAGGGGGTGCCTCCTCCTGG + Intronic
961390314 3:126548744-126548766 CTCCAGGGTCTGCTTCGTGCAGG + Intronic
961432871 3:126895689-126895711 CAGGAGGGTGTGACTCCTGCTGG + Intronic
965534815 3:169812953-169812975 CACCAGGGAGGGCTTCCTGAAGG + Intronic
966050802 3:175616676-175616698 CACAAGGGAGTGCAGCCTGCTGG - Intronic
966208341 3:177427434-177427456 CACGAGGGTATGAATCCTGCAGG + Intergenic
966496711 3:180589942-180589964 CACCAGGATGTGACTGCTGAAGG + Intergenic
967907881 3:194516767-194516789 CACCAGGGTTTACCACCAGCTGG - Intergenic
967996917 3:195173806-195173828 CACCAGGGAGTCCCTCCTATGGG + Intronic
968809766 4:2794560-2794582 CTCCAGGGTGTGCCTAACGCAGG - Intronic
969479330 4:7439509-7439531 GACTAGGGTGTGCGTTCTGCAGG - Intronic
969598131 4:8160280-8160302 CAGCAGGGTGTACCTACGGCAGG - Intergenic
979600614 4:122583269-122583291 CACCAGTTTGTGCCTCAAGCTGG - Intergenic
981354632 4:143774330-143774352 TACCAGGGTGTGCCTGGTGATGG + Intergenic
985261367 4:188118086-188118108 CACCAGGGTGTGTCGCATCCTGG - Intergenic
985862887 5:2488192-2488214 GACCAGGCTGAGCCTCCAGCAGG + Intergenic
986044652 5:4025374-4025396 CACCTGGGTTTCCTTCCTGCAGG - Intergenic
988009631 5:25465255-25465277 CACTAGGGAGTGCCTCATGGGGG - Intergenic
989625767 5:43428341-43428363 CACCTGCCTGGGCCTCCTGCAGG + Intergenic
992204826 5:74421229-74421251 CACCAGGCTGCCCCTCCTCCAGG - Intergenic
996405019 5:123095532-123095554 GACCCGGGAGTGCCGCCTGCTGG - Intronic
1001107525 5:168867885-168867907 CACTGGGGTGAGCCTGCTGCAGG - Intronic
1002200814 5:177527049-177527071 CACCAGGGAGTGCTTCCTGGAGG + Intronic
1003246199 6:4384385-4384407 CAGCAGGATGTGCCTCCTCATGG - Intergenic
1003701430 6:8469265-8469287 CATCAGTGTATGCCTTCTGCTGG + Intergenic
1004218086 6:13720682-13720704 CTCCAGGGAATGCCCCCTGCAGG + Intergenic
1007399760 6:41597169-41597191 CACCAGGGTGGGGCTCCTGGAGG - Exonic
1007909994 6:45504063-45504085 CACTCGGGTCTGTCTCCTGCTGG + Intronic
1008639838 6:53450429-53450451 CTGCAGGGTTTGCCTCCTCCAGG + Intergenic
1011215653 6:85003024-85003046 CACAAGGGTTTGCAGCCTGCTGG - Intergenic
1012335040 6:98045008-98045030 CCCCAGGGTATACCTCCAGCAGG - Intergenic
1016521859 6:144954875-144954897 CACCAGTGTGTGCCCCATGTAGG - Intergenic
1019080520 6:169426632-169426654 CACCAGCCTGTGCTTCCTGCAGG + Intergenic
1019216411 6:170446839-170446861 CACCAGGCAGTGCCTCCCTCAGG + Intergenic
1019510312 7:1414379-1414401 CACCTGGCTGTGCCCCCAGCTGG + Intergenic
1019544848 7:1569238-1569260 CACCAGGATGTGACTGCTGAAGG + Exonic
1019578388 7:1748575-1748597 CACCAGGGCGTGCTGCCTGGAGG - Intergenic
1023868374 7:44249663-44249685 CACCAGGAAGTGCCACCTCCCGG + Intronic
1023879814 7:44312038-44312060 CCCCAGTGTGTGCTTCCTGCTGG + Intronic
1023931138 7:44707406-44707428 CATCAGGGTGTCCCCCCAGCGGG + Intronic
1024606959 7:51029356-51029378 CGCCAGGGAGTCTCTCCTGCTGG + Exonic
1024812069 7:53223616-53223638 CCCCACAGTGTCCCTCCTGCAGG + Intergenic
1025149971 7:56540161-56540183 GACCTGCCTGTGCCTCCTGCTGG + Intergenic
1026898788 7:74026016-74026038 GCCCAGGATGTGCCTGCTGCAGG - Intergenic
1028719553 7:94012939-94012961 GGCCAGGGAGTGCCTCCTGTAGG + Intergenic
1034086494 7:148327212-148327234 CACCAGGGTCAGTCCCCTGCAGG - Intronic
1034426313 7:151016071-151016093 CACCAGGCTCTGTCCCCTGCAGG + Intronic
1034999686 7:155603008-155603030 CACCAGCGTGGGCATCCTGGAGG - Intergenic
1049293167 8:141814582-141814604 CCCAAGGGTGTGCCATCTGCTGG - Intergenic
1049449538 8:142653018-142653040 CACCATGGTCTGCCTGCTGATGG - Intergenic
1053167375 9:35854091-35854113 GACCAAGGAGTCCCTCCTGCAGG + Exonic
1055594628 9:77852490-77852512 AAACAGGGTGTGCTTCCTCCTGG + Intronic
1056621171 9:88216324-88216346 CTTCGGGGTGTGCCTGCTGCTGG - Intergenic
1056933729 9:90899841-90899863 CACGAGGGTGTGTCCACTGCAGG - Intergenic
1057705592 9:97392817-97392839 CCCCAGGGAGTGCCTTCTGCAGG + Intergenic
1061861877 9:133472486-133472508 CTGCAGGGCGGGCCTCCTGCAGG - Intronic
1062433732 9:136536936-136536958 CCCCACTGTGTGCCTCCTGGGGG + Intronic
1062439604 9:136563819-136563841 GACCAGGGTCTGACACCTGCCGG + Intergenic
1062443027 9:136579510-136579532 CAGCAGGGTGAGCCTCCTGCAGG + Intergenic
1062449006 9:136607744-136607766 TACCAGGGTGTGGAGCCTGCTGG + Intergenic
1062544441 9:137055220-137055242 CACCAGGGAGTGCAGGCTGCTGG + Intergenic
1062576712 9:137212253-137212275 CAGCAGGGTCTGGCTCCTGTGGG + Intronic
1187854759 X:23626095-23626117 CACCTGGGAGTTCCTCCTCCTGG + Intergenic
1190050093 X:47142993-47143015 AACTAGGGAGTGCCTCCTGAAGG - Intronic
1193296038 X:79831581-79831603 CACCTGCGTGTGCCATCTGCAGG + Intergenic
1197262619 X:124334056-124334078 CACCAGGGTGTGCATCCTCCGGG - Intronic
1197721500 X:129747734-129747756 CACCTGTGAATGCCTCCTGCAGG - Exonic
1197726877 X:129782295-129782317 CACAAGGGGGTGCCTGCTGTAGG + Intronic
1199347709 X:146761263-146761285 CATATAGGTGTGCCTCCTGCTGG - Intergenic
1202604545 Y:26627385-26627407 CACCAGGGTGCGGGCCCTGCGGG - Intergenic