ID: 1121325107

View in Genome Browser
Species Human (GRCh38)
Location 14:93015294-93015316
Sequence GAGTCTGCACTGAGGGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 246}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121325103_1121325107 -1 Left 1121325103 14:93015272-93015294 CCTGCTTATCAACAAGGCTGGTG 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1121325107 14:93015294-93015316 GAGTCTGCACTGAGGGCTGTGGG 0: 1
1: 0
2: 2
3: 20
4: 246
1121325098_1121325107 13 Left 1121325098 14:93015258-93015280 CCACGCCTCCACTTCCTGCTTAT 0: 1
1: 0
2: 3
3: 23
4: 383
Right 1121325107 14:93015294-93015316 GAGTCTGCACTGAGGGCTGTGGG 0: 1
1: 0
2: 2
3: 20
4: 246
1121325099_1121325107 8 Left 1121325099 14:93015263-93015285 CCTCCACTTCCTGCTTATCAACA 0: 1
1: 0
2: 2
3: 21
4: 290
Right 1121325107 14:93015294-93015316 GAGTCTGCACTGAGGGCTGTGGG 0: 1
1: 0
2: 2
3: 20
4: 246
1121325100_1121325107 5 Left 1121325100 14:93015266-93015288 CCACTTCCTGCTTATCAACAAGG 0: 1
1: 0
2: 0
3: 17
4: 156
Right 1121325107 14:93015294-93015316 GAGTCTGCACTGAGGGCTGTGGG 0: 1
1: 0
2: 2
3: 20
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121325107 Original CRISPR GAGTCTGCACTGAGGGCTGT GGG Intronic
900430366 1:2598532-2598554 GCATCTGCCCTGAGGGGTGTGGG - Intronic
901448916 1:9324489-9324511 GGGTCGGCTCGGAGGGCTGTGGG + Intronic
902894497 1:19469571-19469593 GAGTCAGCTCAGAGGGCTCTGGG + Intronic
903316525 1:22512211-22512233 TTGTGTGCAGTGAGGGCTGTGGG + Intronic
904282682 1:29432449-29432471 GGATATGCACAGAGGGCTGTGGG - Intergenic
904945623 1:34196809-34196831 GACTCTGCACTTAGAGCTGTTGG + Intronic
905913825 1:41671693-41671715 GGGTCTGCGCTGGGAGCTGTGGG - Intronic
906019264 1:42613162-42613184 GAGGCTGCCCCGAGGGCTGCTGG + Intronic
906149437 1:43578987-43579009 GTGTCTGCACCAAGGGCTCTGGG - Intronic
907836997 1:58119617-58119639 GAGTCTCCACTCATTGCTGTTGG + Intronic
907924277 1:58941437-58941459 GAGACGGCACAGAAGGCTGTTGG + Intergenic
908326457 1:63028471-63028493 GAGTCTGCACTCAGTTCTGCAGG - Intergenic
909386922 1:75068273-75068295 GACACAGCACTGAGGTCTGTAGG - Intergenic
911065463 1:93784106-93784128 GCGGCTCAACTGAGGGCTGTTGG - Intronic
913093974 1:115498754-115498776 GAGTGAGCACTGAGGGGTGAGGG - Intergenic
913138409 1:115915272-115915294 GAGTTTCCACAGTGGGCTGTTGG - Intergenic
914049725 1:144121452-144121474 GATTCTGGACTCAGGGTTGTAGG - Intergenic
914129457 1:144843999-144844021 GATTCTGGACTCAGGGTTGTAGG + Intergenic
915227739 1:154423161-154423183 CAGTGGGCACTGAGGGATGTCGG - Intronic
916651978 1:166841066-166841088 GAATCTGCTCTGAGGGCGGATGG + Exonic
917640147 1:176975471-176975493 GAGTCTACATACAGGGCTGTTGG + Intronic
918087851 1:181260697-181260719 GAGCCTGGAGTGAGGACTGTGGG + Intergenic
918128599 1:181605651-181605673 GAGGTTGCTCTGAGGGCTGCTGG - Intronic
920078713 1:203356156-203356178 CAGACTGTGCTGAGGGCTGTTGG + Intergenic
923116586 1:230945933-230945955 GAGGCTGCACTGAAATCTGTTGG + Intronic
923502499 1:234577641-234577663 GAGTCTCCATTGCTGGCTGTTGG + Intergenic
923921151 1:238565631-238565653 GAGTCTTCACTGGGGACTGATGG + Intergenic
924941009 1:248812428-248812450 CACTCTGCACTGAGGTCTGAGGG + Intronic
1069302579 10:66927011-66927033 GAGGATGCCCTAAGGGCTGTAGG + Exonic
1070506671 10:77119136-77119158 GAGGCAGCACTGAGTGCAGTTGG + Intronic
1070889230 10:79929823-79929845 TGCTGTGCACTGAGGGCTGTCGG - Intergenic
1071426814 10:85565518-85565540 GTGTCTTCACTGAGTGCTCTTGG + Intergenic
1072409352 10:95185298-95185320 AAATCTGCACTGAGGTCTGCAGG - Intergenic
1073043936 10:100625166-100625188 GTGTCTGTGCTGAGGGCTGGAGG - Intergenic
1075212792 10:120505254-120505276 GAGGCTGCCCTGAGGGTTGGGGG + Intronic
1075795544 10:125117055-125117077 GAGACTGCACTGAGGGTGGCTGG - Intronic
1076041968 10:127257887-127257909 TAATCTCCAGTGAGGGCTGTTGG + Intronic
1076739600 10:132476740-132476762 ATGTCTGCACTGAGGTCTTTGGG + Intergenic
1077463928 11:2724525-2724547 GTGGCTGCACTGAGGGCAGAAGG + Intronic
1078038873 11:7838565-7838587 GAGTCTGCTATGGGAGCTGTAGG - Intergenic
1078602574 11:12746842-12746864 CAGGCTGGGCTGAGGGCTGTGGG + Intronic
1079983668 11:27178073-27178095 CATTCTGCACTGAGGGCTATTGG + Intergenic
1082752497 11:57034401-57034423 AAGTCTACACTTAGGGCTGAGGG - Intergenic
1082784082 11:57307320-57307342 GAGGCTGCATTGAGGACTGCAGG - Intronic
1083551502 11:63593526-63593548 AAGTCTACACTGTGGCCTGTAGG - Intronic
1083552301 11:63599073-63599095 GACCCTGCACTGAGTGCTGGGGG + Intronic
1084116337 11:67044988-67045010 GAGGCCGCACTCAGGGCTGGGGG + Intronic
1084681979 11:70671730-70671752 GTCTCTGCACACAGGGCTGTGGG + Intronic
1086231069 11:84570371-84570393 AAGTGTGCACTGAGTGCCGTAGG - Intronic
1088432054 11:109769284-109769306 GGAGCAGCACTGAGGGCTGTTGG - Intergenic
1088944507 11:114495814-114495836 GGATCTGGACTGGGGGCTGTAGG + Intergenic
1089559640 11:119337391-119337413 GAGTCAGAAGTGTGGGCTGTGGG + Intergenic
1090805985 11:130202520-130202542 GTGTCTGAACTGAGGGTTGAAGG + Intronic
1090945492 11:131426080-131426102 GAGGCATCACTGAGGGCTGGGGG + Intronic
1091461332 12:645714-645736 GAGTCAGCTGTGAGGGCTGATGG + Intronic
1091600000 12:1912350-1912372 GTGTCTGCACTGAGGCCTATGGG - Intronic
1092158905 12:6304357-6304379 TGGTCTTTACTGAGGGCTGTTGG - Intergenic
1095764935 12:45884690-45884712 GAGTCAGAACTGAGGGCAGTTGG + Intronic
1096320832 12:50611455-50611477 GAGGCTGCATTGAGGGGCGTGGG + Intronic
1099585144 12:84505640-84505662 AAGACTGCCCTGAGGGCTGAAGG - Intergenic
1100457978 12:94770887-94770909 GAGGCTGTGCTGAGGGCTGTAGG - Intergenic
1101136283 12:101746846-101746868 TAGTCTGCAATGATTGCTGTGGG + Exonic
1101736159 12:107464919-107464941 GAGGCTGTCCTGTGGGCTGTAGG - Intronic
1103725577 12:122995933-122995955 GGGTCTGCACTGCGGGCAGTGGG - Intronic
1103987428 12:124777361-124777383 GCGTCTGCACTGGGGGCTGTGGG + Intronic
1104605537 12:130184934-130184956 GAGGCTGGACTGAGGGCTGAGGG - Intergenic
1104882915 12:132084616-132084638 GAGTGTTCACTGAGGGAGGTGGG - Intronic
1105747383 13:23390998-23391020 GCGTCTGCACTGAGGGGTGCAGG - Intronic
1105837296 13:24223008-24223030 GAGCCTGCACAGGGGGCTGCGGG - Exonic
1106419290 13:29572265-29572287 GGCTCTGCCCTGAGGGCTGGGGG - Intronic
1106439275 13:29751093-29751115 GAGTCTACACTCATTGCTGTGGG + Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1106894657 13:34286473-34286495 GATTCTGGACAGAGAGCTGTGGG - Intergenic
1107564594 13:41589111-41589133 GAGTCGCCACTGAGAGCTGGGGG - Intronic
1108003255 13:45923819-45923841 GTGTCTGCATGGGGGGCTGTGGG - Intergenic
1108589998 13:51904957-51904979 GAGTCTGTTCTGTGTGCTGTGGG + Intergenic
1111847364 13:93528301-93528323 GAGTAAGCAAAGAGGGCTGTGGG + Intronic
1112362559 13:98730643-98730665 AACGATGCACTGAGGGCTGTGGG - Intronic
1113823599 13:113232773-113232795 GAGTGTACCCTGAGGGCTGTTGG + Intronic
1114499249 14:23155757-23155779 GAGTCTGCACTGAGCCCAGGAGG + Intronic
1117224288 14:53638783-53638805 GTGTCTGCACCCTGGGCTGTTGG + Intergenic
1120176708 14:81302019-81302041 CACTGTGCACTGAGGGCAGTTGG + Intronic
1120994068 14:90401984-90402006 GAGTCTGCACTGAGTCTTGAGGG + Intronic
1121325107 14:93015294-93015316 GAGTCTGCACTGAGGGCTGTGGG + Intronic
1121843195 14:97151554-97151576 GAGTTTGCACTGAATGATGTTGG + Intergenic
1122651281 14:103228517-103228539 GAGTCTGCACTAAGGGTGCTGGG + Intergenic
1124459295 15:29874317-29874339 CAGTCCCCACTGTGGGCTGTCGG + Intronic
1124966243 15:34435210-34435232 GTGGCTGCAGTGAGGGCTGTTGG - Intronic
1124982845 15:34581293-34581315 GTGGCTGCAGTGAGGGCTGTTGG - Intronic
1126485401 15:49174937-49174959 GAGTCTGCAGTGTGGACTGAAGG + Intronic
1127303430 15:57679826-57679848 GAGTGTGCCCAGAAGGCTGTGGG - Intronic
1127610772 15:60634301-60634323 GAGGCTGGACAGAGGACTGTGGG - Intronic
1129038053 15:72662896-72662918 GGCTCTGCTCTGATGGCTGTGGG + Intronic
1129116107 15:73366316-73366338 GAGTTTGCAAAGAGGGCTCTGGG + Intronic
1129211837 15:74074335-74074357 GGCTCTGCTCTGATGGCTGTGGG - Intronic
1129398566 15:75266749-75266771 GGCTCTGCTCTGATGGCTGTGGG + Intronic
1129402174 15:75291025-75291047 GGCTCTGCTCTGATGGCTGTGGG + Intronic
1129516341 15:76159909-76159931 GCGTCTGCAGTGAAGGCAGTAGG - Intronic
1129728958 15:77918607-77918629 GGCTCTGCTCTGATGGCTGTGGG - Intergenic
1130321455 15:82846017-82846039 GACTGTGCACAGAGGGCAGTTGG - Intronic
1131178939 15:90227480-90227502 AAGTCTGCAGTGAGGGGTGAGGG + Intronic
1133306679 16:4813896-4813918 GATTCTGATCTGAGGTCTGTAGG - Intronic
1135872427 16:26163173-26163195 CAGTCTGCAATGAAGGCTGGAGG + Intergenic
1136139536 16:28279753-28279775 GGGTCGGCACTGAGGGCAGCAGG + Intergenic
1137615090 16:49841655-49841677 AAGTGTGGGCTGAGGGCTGTGGG - Intronic
1138280018 16:55765519-55765541 GGGTCTGCTCTGATGCCTGTAGG - Intergenic
1138288478 16:55828120-55828142 GGGTCTGCTCTGATGTCTGTAGG + Intronic
1138353655 16:56360776-56360798 GAAGCAGCACTCAGGGCTGTGGG - Intergenic
1138519565 16:57563348-57563370 GAGCCTGGACTGTGGGGTGTGGG - Intronic
1138562525 16:57810455-57810477 GACTCAGCACTGAGAGCTGTGGG - Intronic
1139971939 16:70781785-70781807 GACCCTGCACTGGGGGCTGGGGG - Intronic
1140456215 16:75107134-75107156 GAGTCAGCACCCAGTGCTGTGGG - Intronic
1142315976 16:89345319-89345341 GTGTCGGCACTGAGCTCTGTGGG - Intronic
1143726209 17:8848511-8848533 GTGACTGCACTGAGTACTGTAGG + Intronic
1144814690 17:18025758-18025780 AAGTCAGCACTGATGGCTGGAGG - Intronic
1146913420 17:36662831-36662853 GAGTCTGCTCTTTGGGCTCTTGG + Intergenic
1148640424 17:49183572-49183594 GAGTCTGCACTCCAGTCTGTGGG + Intergenic
1148857721 17:50587890-50587912 GAGTCTGTACTGATGGCTTGTGG - Intronic
1149637601 17:58183369-58183391 GAGTCTGCTCTGGGGACTATAGG + Intergenic
1150476078 17:65476334-65476356 CAGCCAGCACTGAGGGCTGGGGG - Intergenic
1150639050 17:66937365-66937387 GGGTCAGGACTGAGGGCTTTTGG + Intergenic
1152777932 17:82213777-82213799 GAGGCGGGACTGAGGACTGTGGG - Intergenic
1153726077 18:7956662-7956684 GAGCCACCACTCAGGGCTGTGGG - Intronic
1154303377 18:13213850-13213872 GAGGCTGCAGTGATGGCTGCTGG - Intergenic
1157256595 18:46145071-46145093 GAGGCTGCACTGAGTGGTGATGG + Intergenic
1159604518 18:70461299-70461321 GAGTCTGCAGTGAGTTCTGATGG - Intergenic
1160520873 18:79507284-79507306 GAGGCTGCACTCAGAGCTGGTGG + Intronic
1161851783 19:6740929-6740951 GAGTCTGGTCGGCGGGCTGTGGG + Intronic
1162013414 19:7830984-7831006 CAGGCTGAGCTGAGGGCTGTGGG - Intronic
1162384367 19:10352581-10352603 GGGGCTGCACTGAGGGCTTGGGG + Intronic
1164417219 19:28057353-28057375 CATTATGCACTGAGGCCTGTGGG + Intergenic
1164658392 19:29941270-29941292 GAGGCTGTACAAAGGGCTGTAGG + Intronic
1165043025 19:33082293-33082315 GAGTGTCCAGTAAGGGCTGTTGG + Intronic
1166511219 19:43410233-43410255 CCGGCTTCACTGAGGGCTGTGGG + Intronic
1166838090 19:45679569-45679591 GAGTGTCCACTGAGGGATGGGGG + Intronic
1167052856 19:47090227-47090249 TAGTCTGCACCCACGGCTGTGGG - Intronic
1202689115 1_KI270712v1_random:74015-74037 GATTCTGGACTCAGGGTTGTAGG - Intergenic
925043090 2:748876-748898 GTGTCTGCATAGAGGCCTGTGGG + Intergenic
925043098 2:748951-748973 GTGTCTGCATAGAGGCCTGTGGG + Intergenic
925615545 2:5741327-5741349 GAGTTTGGACTGAGGGTCGTGGG - Intergenic
926280806 2:11444195-11444217 GAGTCTGCACTTCGGCCTGAAGG + Intergenic
926806579 2:16716995-16717017 GAGTCTGCATTCAGGGGGGTCGG - Intergenic
928437461 2:31264214-31264236 GTGACTGTACTGAAGGCTGTAGG + Intronic
929694500 2:44102562-44102584 GCCTCTGCACTGACGGCTGATGG - Intergenic
930241330 2:48938385-48938407 GAGTATGCACACAGGGCTCTGGG + Intergenic
931670667 2:64644158-64644180 GTGTTTCCACTTAGGGCTGTGGG - Intronic
931714528 2:65018710-65018732 GAGTCTGCACTGAGTTCCCTAGG + Intronic
932481187 2:72040361-72040383 GAATCTGCGCAGAGGTCTGTAGG - Intergenic
933957323 2:87382090-87382112 GATTCTGGACTCAGGGTTGTAGG + Intergenic
934241440 2:90273986-90274008 GATTCTGGACTCAGGGTTGTAGG + Intergenic
934271734 2:91542698-91542720 GATTCTGGACTCAGGGTTGTAGG - Intergenic
934646618 2:96062828-96062850 GAGTCTGCAGCGGGGGCGGTGGG - Intergenic
934756811 2:96830066-96830088 GAGTCTGAAGTGTAGGCTGTGGG + Intronic
934840019 2:97618910-97618932 GAGTCTGCAGCGGGGGCGGTGGG - Intergenic
936953945 2:118005685-118005707 GAGGCTGCAGTGAGTGGTGTTGG + Intronic
938804087 2:134789705-134789727 CAGGGTTCACTGAGGGCTGTTGG + Intergenic
938942754 2:136183288-136183310 CAGCCTGCACTGAGAGATGTGGG + Intergenic
939035097 2:137121598-137121620 GAGTATGAACTTAGGGCTATAGG - Intronic
944210132 2:197198416-197198438 TAGTCTGCACAAAGGGCTCTGGG + Intronic
945377514 2:209096721-209096743 CTGTCTCCACTTAGGGCTGTTGG - Intergenic
945646526 2:212502833-212502855 GAGGCTGCACTGAGTCCTGATGG - Intronic
946403119 2:219479193-219479215 GAGTCTGAGGTGAGGGCAGTGGG + Exonic
1168790504 20:572854-572876 GAGACAGCAGAGAGGGCTGTGGG + Intergenic
1171493753 20:25539766-25539788 GAGTCTAAACAGAGGGCTTTGGG - Intronic
1172523185 20:35582396-35582418 CACTGGGCACTGAGGGCTGTAGG + Intergenic
1175806401 20:61831634-61831656 GAGGCTGCACTGTGGCCTGCCGG - Intronic
1175937400 20:62520076-62520098 GGGGCTGCACCGAGGGCTGCGGG - Intergenic
1176014388 20:62922325-62922347 GAACCTGCACTGAGGGGAGTAGG - Intronic
1177275523 21:18908166-18908188 GAGGCTGAACTGGGGGCAGTGGG + Intergenic
1177605420 21:23371418-23371440 GAGTCCTAACTGAGGGCAGTTGG + Intergenic
1177799153 21:25810430-25810452 GAGACAGCCCTGAGGGCTGCTGG + Intergenic
1178119478 21:29453711-29453733 GTGTCTGCACTGCGGAGTGTTGG + Intronic
1179020068 21:37631824-37631846 AAGGCTGCACTCAGGGCTGGTGG - Intronic
1179354166 21:40642963-40642985 GAGCCTGGACTCAGGGCTCTGGG + Intronic
1179363233 21:40732198-40732220 GATTCTGCAATGACTGCTGTGGG + Intronic
1179962709 21:44779147-44779169 GAGGCGGCACTCAGGGCTGTCGG + Intronic
1183508164 22:38220710-38220732 GAGCCGGCAGTGCGGGCTGTGGG + Exonic
1184098779 22:42330697-42330719 GGGCCTGCCTTGAGGGCTGTGGG + Intronic
1184661725 22:45968558-45968580 GGTTGTGCACTGAGGCCTGTAGG - Intronic
1184835660 22:47019587-47019609 GAATCAGCAGTGGGGGCTGTGGG + Intronic
950190902 3:10975412-10975434 GAGACTGCACAAAGGGCTCTAGG + Intergenic
950707033 3:14789229-14789251 GACCCTGCACTGAGGGCTGTCGG + Intergenic
951634796 3:24761557-24761579 GGGTCTGCACTAAGTGCTTTAGG - Intergenic
951860108 3:27242544-27242566 GAGTCTGCACTATGTCCTGTTGG + Intronic
956920017 3:73918390-73918412 AAGTCTCCTCTTAGGGCTGTAGG + Intergenic
958734906 3:97997199-97997221 GAGTCATCACTGAAGGCTTTCGG + Intronic
960965152 3:123099548-123099570 GAGTCTGCAGTGAGGGCTCGTGG + Intronic
962084957 3:132180921-132180943 AAGTTAGCACAGAGGGCTGTAGG + Intronic
962429003 3:135302180-135302202 GAGTCTGCACATGGGGTTGTGGG - Intergenic
963887579 3:150599240-150599262 GAGTCTGCAGTGAGCCCTGATGG - Intronic
964824639 3:160811760-160811782 GAGTCTACTCTGAGGACTCTGGG - Intronic
968652015 4:1763886-1763908 GAGGCTGCCCAGAGGGCTCTGGG - Intergenic
970606562 4:17687099-17687121 GAGTATGCCATGGGGGCTGTTGG + Intronic
972483279 4:39518411-39518433 GAGGCTGCAGTGAGCCCTGTTGG - Intronic
973348361 4:49081645-49081667 GAGTGTGCCCTGAGGGAGGTAGG + Intergenic
976206166 4:82625440-82625462 GAGTCTGCCATGACGCCTGTGGG + Intergenic
980129618 4:128806188-128806210 GAGGCTGCACTGAGCCATGTTGG + Intergenic
985268780 4:188175266-188175288 GTCTCTGTCCTGAGGGCTGTGGG - Intergenic
986280286 5:6316665-6316687 ATGTTTGCACTGAGGTCTGTGGG + Intergenic
988468901 5:31518148-31518170 GTGACTGCACTGAATGCTGTGGG + Intronic
989632922 5:43505384-43505406 GAGTCTGCACAGGGCTCTGTGGG - Intronic
990881197 5:60541214-60541236 GTGTCTGCTCTGATGTCTGTGGG - Intergenic
991478259 5:67047271-67047293 GACTCTGCACTGTGGCCTGCAGG + Intronic
992713572 5:79486181-79486203 GTGGCTTAACTGAGGGCTGTGGG - Intronic
993789166 5:92185707-92185729 GAGTCTGCAGTGAGGTCACTGGG + Intergenic
998001561 5:138629976-138629998 GATCCTGCACTGAGGGGAGTTGG + Intronic
999202236 5:149824686-149824708 GAGTCTGGCCTGAGGGTTGAAGG + Intronic
1000150375 5:158494636-158494658 GACTCGGGACTGGGGGCTGTGGG + Intergenic
1001502914 5:172253092-172253114 GAGTCTGCACTGAGCTATGGTGG - Intronic
1001904070 5:175456319-175456341 GAGTCTGAACAGAGTACTGTGGG - Intergenic
1002295926 5:178231508-178231530 GAGTCTGCAGGAAGAGCTGTGGG + Exonic
1002571319 5:180140772-180140794 GTGGCTGCACTGAGGGCTGACGG + Intronic
1004284689 6:14310336-14310358 AAGTCTGCATTGATGCCTGTAGG + Intergenic
1005877092 6:30019333-30019355 GAGCCTTCAGAGAGGGCTGTGGG - Intergenic
1007697078 6:43740717-43740739 GCATCTGCAGTGAGGGCTGGAGG - Intergenic
1007727346 6:43924423-43924445 GCGGCTGCACTGCGGGCTCTGGG - Intergenic
1007968330 6:46024725-46024747 GAATCTGTATAGAGGGCTGTAGG + Intronic
1010760760 6:79719776-79719798 GAGTCAGCACAGAGGGCAGTGGG - Intergenic
1012266529 6:97151321-97151343 GTCTCTGCACTGAATGCTGTAGG - Intronic
1012499710 6:99875131-99875153 GAGGCTGCAATGAGGGAAGTGGG + Intergenic
1012858781 6:104534037-104534059 GAGTCTGGAGTCAGAGCTGTTGG + Intergenic
1014266954 6:119289985-119290007 GAGTGTCCACTAAGGGTTGTTGG - Intronic
1016507423 6:144798524-144798546 GACTCTGCACTGTCGGCTTTGGG - Intronic
1016909008 6:149178623-149178645 GGGTCTTTACTGAGGTCTGTTGG + Intergenic
1017780904 6:157714553-157714575 GTGTCTACACTGATGGATGTTGG + Intronic
1018393266 6:163357310-163357332 CAGTCTTCACTGAGTGCTGCTGG - Intergenic
1018768499 6:166952636-166952658 CATTCAGCACTGAGTGCTGTGGG + Intronic
1019918354 7:4147753-4147775 GTATCAGCACTCAGGGCTGTCGG + Intronic
1020711077 7:11605897-11605919 GATTCTGAACTGAGGTCAGTAGG - Intronic
1020976497 7:15013226-15013248 GAGTCTGCATTGAGGACAGCAGG + Intergenic
1022177218 7:27883072-27883094 AAGTGTGCACTGATGGATGTTGG + Intronic
1022659697 7:32355315-32355337 AAGTCTGCATTGAGGGCTAAGGG - Intergenic
1026805166 7:73424746-73424768 GGGGCTGCACAGAGTGCTGTGGG - Intergenic
1026928675 7:74210831-74210853 GACTCTGCTCTGGGGTCTGTTGG - Intronic
1027775083 7:82454929-82454951 GAGGCTGGACTGAGTGCTGCTGG + Intergenic
1029403234 7:100358171-100358193 GAGGCTCCCCAGAGGGCTGTGGG - Intronic
1030787318 7:113678277-113678299 GACTCAGCACTGAGGGTTGATGG + Intergenic
1030995357 7:116352819-116352841 GAGTCTACACAGAAGGATGTGGG + Intronic
1033641931 7:143269580-143269602 GAATCTGCACTGAGGGTTAAGGG - Intronic
1034419537 7:150981847-150981869 CAGTCTGCAGTCAGTGCTGTGGG + Intergenic
1035867794 8:3103439-3103461 GAGACTGTACTGAAGACTGTAGG + Intronic
1036090389 8:5658474-5658496 AAGTCAGCACTGGGGGATGTGGG - Intergenic
1040132953 8:43818759-43818781 GGGAGTGCACTGAGGCCTGTAGG + Intergenic
1041449373 8:57991189-57991211 GAGTCTGATCTGAGGGCTGAGGG + Intergenic
1042117756 8:65450653-65450675 GAAGCTGCTCTGAGGGTTGTGGG - Intergenic
1044605151 8:94041838-94041860 GAGTTTGCAGGGAGAGCTGTGGG - Intergenic
1047324019 8:123819292-123819314 GAGTCTGCAGGGAGAGCCGTGGG + Intergenic
1049425913 8:142537796-142537818 GAGGCTCCACAGGGGGCTGTTGG - Intronic
1050176602 9:2875540-2875562 GCATCTGCACAGAGAGCTGTGGG + Intergenic
1053294455 9:36902916-36902938 GAGGCTGCACTTAGGGCTCTGGG - Intronic
1054473092 9:65553767-65553789 TAGTATCCAGTGAGGGCTGTGGG + Intergenic
1054823048 9:69543213-69543235 GAGCCTGGACTGCGGGCTGCTGG + Intronic
1056130817 9:83584773-83584795 GATTCTGCACTCATTGCTGTGGG + Intergenic
1057717514 9:97506208-97506230 GAGTTGGCACAGGGGGCTGTGGG - Intronic
1057943864 9:99307720-99307742 GAGGCTGCAGTGAGGCCTGATGG + Intergenic
1061852182 9:133422673-133422695 GAGTCTGTACTTGGGGCTTTGGG + Intronic
1062029146 9:134354192-134354214 ATGTCTGCAAGGAGGGCTGTGGG + Intronic
1062160899 9:135079190-135079212 GTGTCTGCACCGAGTGCTCTGGG + Intronic
1185781740 X:2853841-2853863 GAGACCGCAGTGAGGGCTGTGGG + Intronic
1187178902 X:16924108-16924130 GACTCTGCAGTGAGAGCAGTAGG - Intergenic
1188619218 X:32199406-32199428 TAGTTTTCACTGAGTGCTGTTGG + Intronic
1189589506 X:42496495-42496517 CACTATCCACTGAGGGCTGTGGG - Intergenic
1194692963 X:97009737-97009759 GGGTCTGCAGTGGGGGCTTTAGG + Intronic
1196847121 X:119905186-119905208 GAAACTGCCCTGAGGGCTGTAGG - Intronic
1196932489 X:120695721-120695743 GAGTCTGAGCTGAAGGCTGAAGG + Intergenic
1197719474 X:129735391-129735413 AATTCTGCCCTGAGGGCAGTGGG + Intergenic
1200003414 X:153073180-153073202 GAGGCTGCCCTGAGGCCTATGGG + Exonic
1200004309 X:153076829-153076851 GAGGCTGCCCTGAGGCCTATGGG - Intergenic
1200070674 X:153527565-153527587 AAGTCTACACTGAGGGTTGGGGG - Intronic