ID: 1121327291

View in Genome Browser
Species Human (GRCh38)
Location 14:93028651-93028673
Sequence GCCCAGAGCAGGCCCCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 364}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121327285_1121327291 16 Left 1121327285 14:93028612-93028634 CCACGAGACAGTGTTGGTGAAGC 0: 1
1: 0
2: 0
3: 9
4: 76
Right 1121327291 14:93028651-93028673 GCCCAGAGCAGGCCCCCTGCAGG 0: 1
1: 0
2: 2
3: 37
4: 364
1121327287_1121327291 -6 Left 1121327287 14:93028634-93028656 CCTTAGCACCAAGCCTGGCCCAG 0: 1
1: 0
2: 4
3: 46
4: 427
Right 1121327291 14:93028651-93028673 GCCCAGAGCAGGCCCCCTGCAGG 0: 1
1: 0
2: 2
3: 37
4: 364
1121327283_1121327291 27 Left 1121327283 14:93028601-93028623 CCATCAGCATTCCACGAGACAGT 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1121327291 14:93028651-93028673 GCCCAGAGCAGGCCCCCTGCAGG 0: 1
1: 0
2: 2
3: 37
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121327291 Original CRISPR GCCCAGAGCAGGCCCCCTGC AGG Intronic
900152130 1:1183297-1183319 ACCCAGGCCAGGCCACCTGCAGG - Intronic
900160731 1:1222310-1222332 TCCCAGACCTGGCCCCGTGCAGG + Intronic
900313019 1:2043551-2043573 GCCCAGGCCCTGCCCCCTGCTGG + Intergenic
900318568 1:2071127-2071149 TCACAGCGCAGGCTCCCTGCCGG - Intronic
900594050 1:3472429-3472451 GCCCACAGCTGGCCCCCCCCCGG + Intronic
900605830 1:3523148-3523170 GCCCGGAGCAGGGCCCAAGCCGG - Intronic
901448041 1:9319939-9319961 CCCCTGAGCTGGCCACCTGCAGG + Intronic
901673246 1:10867942-10867964 ACCAAGAGCAGGCCCCCGCCGGG + Intergenic
902384899 1:16070995-16071017 GCCCAGAGCTTGCACCCAGCTGG - Intronic
902694048 1:18128454-18128476 GTCCAGAGAAGGCCCCATCCAGG - Intronic
902818166 1:18927787-18927809 GACCAGAGCAGGCTCCCCGGTGG + Intronic
902932373 1:19740667-19740689 CCCCAGGGCAGGCACCGTGCTGG - Intronic
903331913 1:22600876-22600898 GCCCAGCGCTGATCCCCTGCAGG + Exonic
903672814 1:25046569-25046591 GCCTAGAGCTGGCCTCCTTCAGG + Intergenic
904030059 1:27528075-27528097 CCCCACAGCTGCCCCCCTGCCGG - Intergenic
904160325 1:28518231-28518253 CCCCAGAGCATGCGCTCTGCAGG - Intronic
904681919 1:32235097-32235119 GCCCAGAGGGCGTCCCCTGCAGG - Intergenic
905282369 1:36857356-36857378 GCCCTGAGCAGGGCCCTGGCTGG - Intronic
906650402 1:47508628-47508650 GCCCAGCGCAGCCCCCCGGCGGG - Intergenic
910303603 1:85736161-85736183 GCACAGAGCAGGCCCTCTGGTGG + Intronic
911150900 1:94596215-94596237 GCCCTCTGCAGGCCCTCTGCAGG - Intergenic
911150903 1:94596226-94596248 GCCCTCTGCAGGCCCTCTGCAGG - Intergenic
911686620 1:100784350-100784372 TCCCACAGTAGGCCCTCTGCAGG - Intergenic
913550875 1:119915850-119915872 CCCCAGAGCAGGCCACCTGAAGG - Exonic
915163718 1:153936661-153936683 GCCCATAGCAGTGCCCCAGCAGG + Exonic
915590174 1:156866313-156866335 GCCTGGAGCCGGGCCCCTGCTGG + Intronic
915633890 1:157173249-157173271 GCCCTGAGCTGGAGCCCTGCAGG + Intergenic
915658241 1:157379854-157379876 GCCCTGAGCTGGAGCCCTGCAGG + Intergenic
915670774 1:157486835-157486857 GCCCTGAGCTGGAGCCCTGCTGG - Intergenic
918038615 1:180898568-180898590 GCCCAGAGAAGGCTCCCTCAGGG - Intergenic
919802430 1:201361756-201361778 GACCAGAGCTGGGCCCCAGCAGG - Intronic
921924465 1:220699918-220699940 GGCCAGAGGAGGGGCCCTGCCGG + Intergenic
922566600 1:226605458-226605480 GCCCAGAGCAGGTCCTGTGGAGG + Exonic
922681340 1:227599361-227599383 GGCCGAAGCAGGCCCACTGCAGG + Intronic
924415211 1:243850445-243850467 GCCCAGAGCCGCCGCCCCGCCGG - Intronic
1063666312 10:8062731-8062753 GCCCAGAGGAGGACCCCGGAGGG - Intronic
1064202830 10:13299474-13299496 GCCCAGGGCGGCCTCCCTGCTGG - Intronic
1065128463 10:22596846-22596868 GCTCTGGGCAGGGCCCCTGCAGG - Intronic
1065791756 10:29266808-29266830 AACCAGAGCGGGCTCCCTGCTGG - Intergenic
1065887708 10:30093479-30093501 ACTCACAGCTGGCCCCCTGCAGG + Intronic
1066180716 10:32958306-32958328 GCCCAGAGCCGCCCCCCGGCAGG + Intronic
1067685919 10:48466087-48466109 GCCCAGGGCAGGACCCTTCCAGG - Intronic
1068856985 10:61807897-61807919 GCTCAGAGAAGGAGCCCTGCTGG - Intergenic
1069277015 10:66604933-66604955 GCCCAGTTCAGAACCCCTGCTGG - Intronic
1069849771 10:71397229-71397251 GGCCAGAGCAGGCGGCCCGCGGG + Intronic
1069856506 10:71443848-71443870 TCCCAGAGCAGGCCCACCACAGG - Intronic
1069932445 10:71891843-71891865 GCCCAGAGCTGGGCACTTGCCGG - Intergenic
1071512062 10:86268233-86268255 GGCCAGAGCAGGTCCCTGGCAGG - Intronic
1071817937 10:89251810-89251832 AGGCAGACCAGGCCCCCTGCAGG - Exonic
1073326794 10:102647906-102647928 GCCTAGAGCAGGGACCCAGCAGG + Intronic
1073338186 10:102726401-102726423 GCACAGAGCTGGCCACCAGCAGG + Intronic
1074965076 10:118483689-118483711 TCCCAGAGCAGCGCCCCTACAGG - Intergenic
1075731858 10:124641093-124641115 GCCCAGAGCAGACACCCTCAGGG + Intronic
1075739437 10:124685383-124685405 GCCCACAGCCCGCCCTCTGCTGG + Intronic
1076209575 10:128629612-128629634 GCCCAGAGGAGTGTCCCTGCTGG + Intergenic
1076528160 10:131125816-131125838 GCCCTGAGTAGGAACCCTGCAGG + Intronic
1076775847 10:132697651-132697673 ACCCAGAACAGACCCCCAGCGGG - Intronic
1077200017 11:1302075-1302097 GCCTGGAGCAGGCCCCTTGCAGG - Intronic
1077220885 11:1415675-1415697 GGGCAGAGCAGGCCCCGGGCAGG - Intronic
1077370647 11:2180207-2180229 TGCCTGAGCAGGCCACCTGCGGG - Intergenic
1077431025 11:2516036-2516058 GCCCAGGCCAGGGCTCCTGCTGG + Intronic
1077551122 11:3200776-3200798 GCACAGCCCGGGCCCCCTGCAGG + Intergenic
1078771808 11:14358737-14358759 GCCCCGGGCAGGCCCGCTCCAGG + Intronic
1080456994 11:32427375-32427397 GGCCAGAGCAGCCTCCCCGCAGG + Intronic
1080604344 11:33852556-33852578 GGCAAGAGTAGGCTCCCTGCAGG + Intergenic
1082013463 11:47467016-47467038 CCCCAGAGCAGAAACCCTGCTGG + Intronic
1083551037 11:63590423-63590445 GCTCAGAGCTGGCCCCCAGCCGG + Intronic
1083610905 11:64003855-64003877 CACCAGGGCAGCCCCCCTGCTGG - Intronic
1083623566 11:64060539-64060561 ACCCAGAGCAGGCCCCAGCCTGG + Intronic
1083747338 11:64743477-64743499 CCCTAGGGCAGGCCCCCTGGGGG - Intronic
1083923396 11:65792248-65792270 GCCCAGAGCAGCCACCCTTGTGG + Intronic
1084178633 11:67435916-67435938 GCCCAGAGCAGGTCCCCGTGCGG - Exonic
1085444042 11:76589046-76589068 GCCCAGATCAAGGTCCCTGCAGG - Intergenic
1086561519 11:88174921-88174943 GCCCAGAGCAGGCCTCCCCAGGG - Intronic
1087637551 11:100719475-100719497 GCCCACAGAAGGCCAGCTGCTGG - Intronic
1089283950 11:117393876-117393898 GCCCACAGCTGGGACCCTGCAGG + Intronic
1089342339 11:117766855-117766877 GTGCAGAGCAGCCCGCCTGCTGG + Intronic
1089391235 11:118103289-118103311 GGCCTGAGCAGACCTCCTGCTGG - Intronic
1089698316 11:120229154-120229176 GCCCAGAGCAGCCACCCGCCAGG - Exonic
1089861182 11:121591208-121591230 GCCCAGAGCACACCCCCAGAAGG - Intronic
1090201543 11:124861381-124861403 GCAAAGAGCAGGCACCCAGCTGG - Intergenic
1090404431 11:126468369-126468391 GCCCACTGCAGGCTCCCAGCGGG - Intronic
1091583580 12:1803178-1803200 GCCCAGGGCAGGCCCCAGGTGGG - Intronic
1091890843 12:4053057-4053079 GCCAAGAGCATTCCCCATGCTGG - Intergenic
1096510472 12:52125205-52125227 GCCCACAGCAGGGCTCTTGCAGG - Intergenic
1101772118 12:107761103-107761125 GCCCAGAGGAGGCCGCGGGCCGG - Exonic
1101800364 12:108016586-108016608 CCCCAGAGCAGGTCTCTTGCAGG - Intergenic
1103324396 12:120110836-120110858 GCCCTGAGCATGAGCCCTGCAGG - Intronic
1103542707 12:121677327-121677349 GCCCAGAGCTGACACCCTCCAGG + Intergenic
1103723279 12:122985950-122985972 GCCCAGGCCAGGCCTCCTGGCGG + Exonic
1103847940 12:123912428-123912450 CCCCAGGACAGACCCCCTGCGGG - Intronic
1104412308 12:128569237-128569259 GGCTGGAGCAGGCCCCCTGAGGG + Intronic
1104623726 12:130337354-130337376 CCCCAGTGCCAGCCCCCTGCAGG - Intergenic
1105344799 13:19561873-19561895 CCCCAGAGCCGGCCCCCGCCTGG + Intergenic
1105408612 13:20151457-20151479 TCCCAGTGCAGCCCCCATGCTGG + Intronic
1105968230 13:25404168-25404190 GGCCAGAGCAGGCTTCCTGAGGG + Intronic
1106300788 13:28462854-28462876 GCACAGAGCAGGCCCCTATCTGG + Intronic
1107444427 13:40457545-40457567 GCTCAGAGCAAGTGCCCTGCTGG - Intergenic
1107605025 13:42048600-42048622 GCCCGGGGCAGGCGCCCTCCAGG - Intronic
1108242106 13:48475523-48475545 GCCCAGAGCAGGGACTCTGAGGG + Intronic
1108686954 13:52827960-52827982 GCCCAGGGCAGGCCCACATCTGG - Intergenic
1110568229 13:76977445-76977467 CCCCAGATCAGGGCCCCTACAGG - Intergenic
1111799031 13:92959905-92959927 GCACGGTGCAGTCCCCCTGCTGG + Intergenic
1113552134 13:111200791-111200813 GTCCAGTGCAGGGCCCCTTCTGG + Intronic
1113747774 13:112756826-112756848 GCTGGGAGCAGGCCCCGTGCTGG - Intronic
1113747788 13:112756880-112756902 GCTGGGAGCAGGCCCCGTGCTGG - Intronic
1113782261 13:112983420-112983442 GCCTGGAGAAGGCCACCTGCCGG - Intronic
1114269578 14:21092558-21092580 ACCCAGATCAGTCCCCCAGCCGG - Exonic
1118772612 14:68952247-68952269 GCCCAGGGCTGGCCTCCAGCAGG - Intronic
1118982071 14:70725145-70725167 GCCCAAAGCAGGCTCCCCGTAGG + Intronic
1119046377 14:71321276-71321298 GCCCGGAGCAGGACCCCAGGAGG + Intronic
1119163495 14:72472732-72472754 GCAGAGAGCAGGCACCATGCAGG + Intronic
1119716293 14:76861883-76861905 GCACAGAGCAGACCCACTGGGGG - Intronic
1121327291 14:93028651-93028673 GCCCAGAGCAGGCCCCCTGCAGG + Intronic
1121340033 14:93099713-93099735 GCCCCGAGCAGCCTCCCTTCCGG + Intronic
1122272891 14:100576254-100576276 GGACAGAGCAGGCCACCTGAGGG + Intronic
1122427653 14:101621090-101621112 GCCTGGGGCAGGGCCCCTGCTGG - Intergenic
1122804516 14:104249833-104249855 CCCCAGAGCAGCCCCGCTGTGGG - Intergenic
1122924865 14:104894880-104894902 GCCCACAGCTGGCCCGCTGTGGG - Exonic
1122956818 14:105075059-105075081 GCCCAGACCTGGCACCCAGCAGG - Intergenic
1122999933 14:105287953-105287975 GCCCAGAGCCGGCCTCCTGGTGG + Intronic
1123037080 14:105475884-105475906 GACCAGGGCAGGCGCCCTGTTGG - Intronic
1125213901 15:37247027-37247049 GCCCAGGGCAAACCCCCCGCTGG + Intergenic
1125689601 15:41585475-41585497 GGACAGAGCCGGCGCCCTGCAGG + Intergenic
1125859758 15:42987297-42987319 GCCCTTAGCAGACCCCCTACCGG - Intronic
1126675484 15:51156591-51156613 TCCCACAGCAGGCCTCTTGCTGG - Intergenic
1128061720 15:64739575-64739597 ACCAAGAGCAGGCCCCCAGGTGG - Intergenic
1128154661 15:65385034-65385056 GCCCCAGGCAGGCCCCCGGCCGG - Exonic
1129790348 15:78336966-78336988 ATCCAGAGCAGGCCCCCTGCTGG - Intergenic
1129885589 15:79035083-79035105 CCCCAGAGAAGTCCCCCTCCAGG - Intronic
1130306464 15:82715038-82715060 CCCCAGAACCGGGCCCCTGCAGG + Intergenic
1131367386 15:91852835-91852857 GGCCGGAGAAGGCCCTCTGCTGG + Intergenic
1132335485 15:101045895-101045917 CCCCAGATCAGGCCATCTGCTGG + Intronic
1132573204 16:652987-653009 ACTCAGAGCAGGCACCCAGCAGG - Intronic
1132577269 16:669863-669885 CCCCAACGCAGGCCCTCTGCGGG - Intronic
1132649629 16:1014615-1014637 GCCCTGAGCAGGGCCTGTGCCGG + Intergenic
1132803346 16:1764668-1764690 GCCCAGTGCAGGCCCACTCCAGG - Intronic
1133770640 16:8865616-8865638 GCCCGGAGCCAGCCCACTGCTGG + Intronic
1133803794 16:9107423-9107445 GCTCAGGGCAGGCCCTCTGGAGG + Intronic
1134266518 16:12697443-12697465 GCCCAGAACAAGCCTCCTGAAGG - Intronic
1135809875 16:25577393-25577415 GCACAGAGCAGGCCCCTGGGAGG - Intergenic
1138567541 16:57844602-57844624 GCCAGGAGGAGGCCCCCGGCTGG - Intronic
1138582862 16:57952952-57952974 CCCCAGGGCAGGCCCCCAGGAGG + Intronic
1139965366 16:70742270-70742292 GCCAAGAGGAGGCATCCTGCAGG - Intronic
1140037284 16:71380991-71381013 GCCCAGAGCTGGCATCCTGGCGG + Intronic
1140476298 16:75240862-75240884 ATTGAGAGCAGGCCCCCTGCCGG + Intronic
1141424129 16:83934528-83934550 GCCCAGAGAAGCCCCGCAGCGGG - Intronic
1141689335 16:85587594-85587616 GCTCAGCCCAGGCCCCCTGTTGG + Intergenic
1142172462 16:88630043-88630065 GCCCAGCGCAGGCCCAAGGCTGG - Intronic
1143316029 17:6034123-6034145 GGCAAGAGCAGGATCCCTGCAGG + Intronic
1143376094 17:6468524-6468546 GGCCAGAGCAGTCTCCCAGCTGG + Intronic
1143457608 17:7078069-7078091 GCCCAGAGCAGAGACGCTGCAGG + Exonic
1143729729 17:8874297-8874319 GCCCAGGGCAGGCACCAGGCTGG + Intergenic
1144065090 17:11617616-11617638 TCCCAGGGCAGCCCACCTGCTGG - Exonic
1144066442 17:11628569-11628591 GCCCAGCGAGGGCGCCCTGCAGG + Intronic
1145006018 17:19338254-19338276 GCCCAGAGCAGGGCACCATCAGG - Intronic
1145246537 17:21273323-21273345 TCCTAGAGCAGGGCCCCTGGCGG - Intergenic
1145817197 17:27804203-27804225 GTCCAGGGCTGGCCCCCTCCTGG + Exonic
1147819408 17:43232777-43232799 GCCCAGAGAAGGGCCGCTGGAGG + Intergenic
1147819997 17:43235807-43235829 GCCCAGAGAAGGGCCGCTGGAGG + Intergenic
1147821311 17:43243206-43243228 GCCCAGAGAAGGGCCGCTGGAGG + Intergenic
1147822112 17:43247694-43247716 GCCCAGAGAAGGGCCGCTGGAGG + Intergenic
1147823032 17:43253135-43253157 GCCCAGAGAAGGGCCGCTGGAGG + Intergenic
1147823803 17:43257736-43257758 GCCCAGAGAAGGGCCGCTGGAGG + Intergenic
1147824566 17:43262178-43262200 GCCCAGAGAAGGGCCGCTGGAGG + Intergenic
1147825718 17:43268654-43268676 GCCCAGAGAAGGGCCGCTGGAGG + Intergenic
1147826849 17:43275121-43275143 GCCCAGAGAAGGGCCGCTGGAGG + Intergenic
1147827737 17:43279999-43280021 GCCCAGAGAAGGGCCGCTGGAGG + Intergenic
1147828845 17:43286160-43286182 GCCCAGAGAAGGGCCGCTGGAGG + Intergenic
1147829940 17:43292303-43292325 GCCCAGAGAAGGGCCGCTGGAGG + Intergenic
1147831682 17:43301787-43301809 GCCCAGAGAAGGGCCGCTGGAGG + Intergenic
1151966557 17:77434550-77434572 GCCCACAGAGGGTCCCCTGCAGG - Intronic
1152227799 17:79100750-79100772 GCTCAAAGCAGGCCCCTTGCCGG + Intronic
1152351090 17:79784441-79784463 GCACCCAGCAGGCACCCTGCTGG - Exonic
1152751230 17:82063312-82063334 GCCCACAGCAGCCTCTCTGCTGG - Intronic
1152751694 17:82065381-82065403 GCCCTGAGCAGGCCGCCCGGCGG + Exonic
1153766061 18:8376168-8376190 GCCCAGTGCAGGCCCACTGGTGG + Exonic
1154502905 18:15005409-15005431 GCGCAGAAGGGGCCCCCTGCTGG - Intergenic
1157498283 18:48171689-48171711 GCCCAGAGCAGGCACACAGTAGG + Intronic
1157525475 18:48377090-48377112 CCCCACACCAGGCCTCCTGCAGG + Intronic
1157680710 18:49603302-49603324 GCCCAGAGCTGGGCTCCTGATGG + Intergenic
1160144242 18:76350637-76350659 CCGCAGAGCAGGCCCCTTGACGG + Intergenic
1160212951 18:76898363-76898385 GCCCAGAGGAGGATCCCTGAGGG - Intronic
1160567769 18:79797954-79797976 GCCCCGAGGAGGCCGCCGGCCGG + Intergenic
1160823748 19:1069777-1069799 GCCCAGTTCAGACCTCCTGCAGG - Intronic
1161293733 19:3508961-3508983 GCCCACAGCGGGCCCCCTGTTGG + Intronic
1161496584 19:4589784-4589806 ACGCTGAGCAGGCCCCCTGGTGG - Intergenic
1161593148 19:5137708-5137730 GCCCAGGGCAGGCTCCCCTCCGG - Intronic
1162500488 19:11050779-11050801 CCCCAGGGCAGGGCCCCTGAGGG + Intronic
1162531655 19:11239647-11239669 GCCCAGAGCAGGCACAGAGCAGG - Exonic
1162567344 19:11451675-11451697 GCCCCGGCCTGGCCCCCTGCGGG + Exonic
1162958719 19:14113895-14113917 TCTCTGAGCTGGCCCCCTGCCGG + Intronic
1163478405 19:17540100-17540122 GCCCAGAGCCGGGCCAATGCGGG + Intronic
1163552767 19:17974570-17974592 CCCCAGAGCAGGCCCACTCTGGG - Intronic
1163630528 19:18415921-18415943 GCCCAGGGCAGGTCCTCGGCTGG - Intergenic
1164650658 19:29888750-29888772 ACCCAGAGCAAGCTCTCTGCAGG + Intergenic
1164828692 19:31303483-31303505 GCCCTGTGCAGGCCCCGTGCAGG - Intronic
1166329199 19:42069099-42069121 GCGCAGAGCAGGCCCCTAGTGGG + Intronic
1166380310 19:42352211-42352233 GCCCTGAGAAGTCCCCCTGTAGG - Exonic
1168294660 19:55372890-55372912 GCCGGAAGCAGGCCCCCTGAGGG - Intergenic
1168323769 19:55526369-55526391 GGCCACAGCAGGCGCCCTGCGGG + Intergenic
1168558524 19:57363764-57363786 GCCCATAGAAGGGGCCCTGCAGG + Exonic
1168564418 19:57411459-57411481 GCCCCGAGGAGGGGCCCTGCAGG + Intronic
925293936 2:2765670-2765692 GCCCAGGCCTGGCCACCTGCGGG - Intergenic
925338268 2:3114693-3114715 GCCCACAGCAGTCTTCCTGCTGG - Intergenic
926104258 2:10140542-10140564 TCTCTGAGCAGGCACCCTGCTGG - Intergenic
926227776 2:10980701-10980723 GCCCAGAGCAGGCCCCTGGCTGG - Intergenic
927472478 2:23386101-23386123 GGCCGGAGCAGCCCCCCTGCTGG + Intronic
927787196 2:25982192-25982214 GCCCGGAGCCCGCCCCATGCAGG + Exonic
928120124 2:28577990-28578012 GCCCAGGGTGGGCCTCCTGCAGG - Intronic
928834231 2:35523382-35523404 GCCCAGAGAAGGCCCTGGGCAGG + Intergenic
932219939 2:69991521-69991543 GCCCAGAGAAGCCTCCCTTCAGG + Intergenic
932618967 2:73254856-73254878 GGCCAGGGAAGGCCCCCTGGGGG + Exonic
933991944 2:87640194-87640216 GCCCTGAGCAGGCTCCCTTCAGG - Intergenic
935720766 2:105976998-105977020 CCCCACAGCAGGCCCCCAGCAGG - Intergenic
936301900 2:111310624-111310646 GCCCTGAGCAGGCTCCCTTCAGG + Intergenic
937224416 2:120359999-120360021 ACCCAGAAGAGCCCCCCTGCTGG - Intergenic
937330588 2:121025883-121025905 GCTCAGGGCAGGCCCCAAGCAGG + Intergenic
938502070 2:131835579-131835601 GCGCAGAAGGGGCCCCCTGCCGG - Intergenic
938608475 2:132921594-132921616 GCTCAGAGAAGGCCTCCTGGAGG + Intronic
938844582 2:135195538-135195560 GCCCTGGGGTGGCCCCCTGCAGG - Intronic
939539497 2:143475715-143475737 GCCCAGAGCAGCCATCCTCCTGG + Intronic
940134920 2:150425190-150425212 GCTCAGCGCTGCCCCCCTGCGGG - Intergenic
940362766 2:152813702-152813724 GCCCACAGCTGCCTCCCTGCTGG - Intergenic
944206488 2:197163627-197163649 GGCCAGGGCAGGCCCAGTGCTGG + Intronic
947733174 2:232442135-232442157 GCCCAGCCCAGTCCCCATGCAGG + Intergenic
947913497 2:233817808-233817830 GCCCACAGCTGGGCCCCTGGAGG - Intronic
948069330 2:235106970-235106992 GCCCAGTGCAGGCCATCTCCTGG - Intergenic
948208895 2:236178206-236178228 GCCTTGAGCGCGCCCCCTGCGGG + Intergenic
948461281 2:238131075-238131097 GCCCAGCGAGGGCCCCCGGCTGG + Exonic
948601979 2:239112487-239112509 GCCTAGAGCAGGCCTGCTGGTGG + Intronic
948612997 2:239181342-239181364 GCCAGGAGCAGCACCCCTGCTGG - Intronic
948640980 2:239375844-239375866 GCCCAGCCCAGGCCTCTTGCCGG + Intronic
1172616175 20:36286263-36286285 GCCAAGAGAAGGCCACCTGCCGG + Intergenic
1172764549 20:37344626-37344648 GCTCAGGGCGGGCCCCCAGCTGG - Intergenic
1172768012 20:37361404-37361426 GCCAGGGGCAGGCCACCTGCAGG + Intronic
1172936491 20:38624209-38624231 TCCCAGATGAGGCCCCCTGATGG - Intronic
1174036995 20:47674539-47674561 GCCCAGACCAGGGCCCAGGCCGG - Intronic
1175518754 20:59586125-59586147 GGCCAGGGCAGGCCACCTGGAGG - Intronic
1175947404 20:62565322-62565344 GGCCAGCCCAGGCCCCCGGCAGG - Intronic
1175959608 20:62628839-62628861 GCCCAGACCCAGCCCCCTGCAGG + Intergenic
1176070704 20:63224800-63224822 GCCCAGAGCAGGCCCCACCACGG - Intergenic
1176149343 20:63581372-63581394 GCCCAGAGCAGCCCCAGGGCAGG - Intergenic
1176200441 20:63857993-63858015 GCCCAGAGCACAGGCCCTGCAGG + Intergenic
1176292630 21:5054274-5054296 ACACAGAGCAGGACCCCTTCAGG - Intergenic
1176300246 21:5095853-5095875 GCCCAGTGCAGGCCGTGTGCAGG - Intergenic
1179265173 21:39796637-39796659 GCCCAGAGCTGGGGCCCAGCAGG + Intronic
1179306128 21:40155443-40155465 ACCCAGAGTAGCCCCTCTGCAGG + Intronic
1179712537 21:43271690-43271712 GCCCAGGTCGGGCCCCCAGCTGG + Intergenic
1179823595 21:43951591-43951613 GCACAGAGCAGGACGCCAGCTGG + Intronic
1179856776 21:44166058-44166080 GCCCAGTGCAGGCCGTGTGCAGG + Intergenic
1179864630 21:44209376-44209398 ACACAGAGCAGGACCCCTTCAGG + Intergenic
1180036166 21:45251393-45251415 ACCCAGAGCAGAAGCCCTGCAGG - Intergenic
1180985903 22:19903780-19903802 CCACAGAGCAAGCCCCCGGCAGG - Intronic
1181031960 22:20152609-20152631 GCCCAGCCCAGGCCTCCTGCAGG - Intergenic
1181468642 22:23124741-23124763 GCCCAGATCAGGGTCCCAGCAGG - Exonic
1182476431 22:30579073-30579095 GGCCAGAGCAGGCACCAAGCAGG + Intronic
1183512359 22:38243637-38243659 GCCCTGAGCAGGTCCCCATCTGG + Intronic
1184099721 22:42335795-42335817 CCCCAGAGCTGGCACCCTGAAGG - Intronic
1184331063 22:43828260-43828282 GGCCATAGGAGGCCCCCTGTTGG - Intronic
1184376874 22:44119182-44119204 GCCCAGCCCAGGGCCGCTGCAGG - Intronic
1184514557 22:44954025-44954047 GCTCAGAGCAGACCCCCAGTGGG + Intronic
1184620400 22:45672189-45672211 GCCCGGGGCAGCCCCCCGGCCGG - Intronic
1184667009 22:45994603-45994625 GCCCGGCACAGGCCCCTTGCTGG - Intergenic
1184975273 22:48057367-48057389 GCCCAGCGCTGGTTCCCTGCAGG - Intergenic
1185133770 22:49056777-49056799 GCCCACAGCAGCCCCCCTGGAGG - Intergenic
1185342738 22:50299013-50299035 GCCAAGAGCAGCCCCCAAGCTGG - Intronic
950482170 3:13250957-13250979 GTCCAGAAGAGGCTCCCTGCCGG + Intergenic
950678758 3:14570377-14570399 GCCCAGGGCAGCTCCCCTCCTGG - Intergenic
951544450 3:23810718-23810740 GCGCGGAGCAGCCCCCGTGCGGG + Intronic
952145884 3:30531440-30531462 CCCCTGAGCTGGCCCCCTGAGGG - Intergenic
953234074 3:41090934-41090956 GTTCCGAGCAGGCCCCATGCAGG - Intergenic
954402175 3:50324702-50324724 CCTCACTGCAGGCCCCCTGCAGG - Intronic
954457195 3:50606228-50606250 GGCCAGGGCAGTCACCCTGCAGG + Intergenic
954640416 3:52094374-52094396 GCCCACAGCAGGCCCCGCTCTGG - Intronic
954796118 3:53161975-53161997 GCCCAGGCCAGGCCGCCCGCCGG + Intronic
961216151 3:125162263-125162285 GCCCACAGCAAGCCCCGTGCTGG + Intronic
961351483 3:126307308-126307330 GCCCATTTCAGGCCCCATGCTGG - Intergenic
961361497 3:126370915-126370937 GCCCAGAGCATGCACCTTCCTGG + Intergenic
962102168 3:132354148-132354170 GCCCAGAGCTGGCCTTCTGATGG - Intronic
963091516 3:141487325-141487347 GCCCGGCCCAGGCCCCCTCCCGG - Intronic
966077185 3:175951493-175951515 GGCCAGTGCAGGCCCCCTCAAGG - Intergenic
967876901 3:194273625-194273647 GTCCACAGCTGGCCGCCTGCTGG - Intergenic
968318270 3:197742699-197742721 TCCCAGAGCAGGGAACCTGCGGG + Intronic
968657906 4:1786565-1786587 GGCCAGAGCAGGCTTCTTGCAGG + Intergenic
969444940 4:7239349-7239371 GCCAGGAGCAGCTCCCCTGCTGG + Intronic
969511748 4:7622065-7622087 CCCCAGAGCACGGCCCCTGGGGG + Intronic
969870388 4:10101018-10101040 GCCCAGGGCAGGCTTCCTGGAGG - Intronic
970598230 4:17619131-17619153 TACCAAAGCAGGCCCACTGCAGG - Intronic
972316998 4:37935988-37936010 GGCCAGAGAAGGCCTCCTGGGGG - Intronic
976020222 4:80614514-80614536 ACCAAGAGCAGGCACTCTGCGGG + Intronic
977660456 4:99579397-99579419 GCCCCGAGGAGGGCTCCTGCAGG - Intronic
984616421 4:181903754-181903776 GCCCTGAGGAGGGCCCCTCCTGG + Intergenic
984953254 4:185021522-185021544 GCACAGAGCAGGCCAGCTTCGGG + Intergenic
985086237 4:186315768-186315790 CCCCAGACCAGGCCCCCTTCTGG - Intergenic
985335406 4:188887544-188887566 TCCCAGAGCAGGCTCTTTGCAGG - Intergenic
985480779 5:108974-108996 GCCCAGAGCGAGCCTCCTGGGGG + Intergenic
985647079 5:1090065-1090087 GATCAGAACAGGCCCCGTGCGGG + Intronic
985863897 5:2496324-2496346 GCTCAGAGGTGGCCTCCTGCAGG - Intergenic
986584369 5:9299472-9299494 GCTCAGAGAAAGTCCCCTGCAGG - Intronic
987761172 5:22164425-22164447 GAGCACAGCAGGCACCCTGCTGG + Intronic
990267620 5:54095060-54095082 GCCCACTGCAGGCCCACTGAAGG - Intronic
990313501 5:54562465-54562487 GCCAACAGCAGGCCCCATGTAGG + Intergenic
991895962 5:71397879-71397901 GAGCACAGCAGGCACCCTGCTGG + Intergenic
992563189 5:77972717-77972739 GCCCAGAGCAGGCCGCAGCCTGG + Intergenic
997500793 5:134371727-134371749 GCCCACAGCCGGCCCTCTGAGGG - Intronic
998139100 5:139689970-139689992 GCCCAGACCTGGCCCCCAGGAGG - Intergenic
999084322 5:148873683-148873705 GCCCAGGGCAGTTCCCCTGCTGG - Intergenic
999371702 5:151059415-151059437 GCCCAGTGCAGGGCCCCCTCAGG - Intronic
1000456694 5:161458002-161458024 ACCCAGAGCAGACCCAGTGCTGG - Intronic
1001476549 5:172054782-172054804 GCACAGACCAGTCCCCCTGAGGG - Intronic
1001971373 5:175957464-175957486 GCCCAGAGCAGGCTCCTAGGAGG - Intronic
1002246069 5:177886313-177886335 GCCCAGAGCAGGCTCCTAGGAGG + Intergenic
1002493512 5:179596690-179596712 CCCCAGCCCAGGCTCCCTGCAGG - Intronic
1003459997 6:6320489-6320511 GCCCAGAGCAAGCCGCTTGCTGG + Intronic
1004250132 6:14016732-14016754 GCCCAGCGCAGGGCCCAGGCAGG + Intergenic
1004604259 6:17179040-17179062 GTCCACAGCAGCCCCCATGCAGG - Intergenic
1006287960 6:33112594-33112616 GTCCAGAGCAGGGCCACTCCAGG + Intergenic
1006669415 6:35720356-35720378 GCCCACACCAGGCTCCCTGGGGG + Exonic
1009862893 6:69357756-69357778 GCCCAGTGCAGGTCCACTACAGG - Intronic
1010954161 6:82071318-82071340 GCACAGAGCAGGCACCGAGCAGG + Intergenic
1012746782 6:103101138-103101160 TCCCACAGCAGGCCATCTGCAGG - Intergenic
1015440311 6:133240854-133240876 GGCCACTGCGGGCCCCCTGCCGG - Intronic
1016908665 6:149176064-149176086 TCCCACAGTAGGCCCTCTGCAGG + Intergenic
1018286053 6:162238893-162238915 GACCAGAGGAGACCCCCTTCGGG - Intronic
1019344732 7:523668-523690 GCCCTGGGCAAGCGCCCTGCTGG + Intergenic
1019348594 7:542720-542742 TCCCCAAGCAGACCCCCTGCTGG + Intergenic
1019478451 7:1255237-1255259 CCTCAGAGCAGGCCCCAGGCCGG - Intergenic
1019735526 7:2648186-2648208 TCTCAGAGCAGGCCCAGTGCAGG - Intronic
1022310140 7:29189477-29189499 GCCCAGAGCAGGCTTACAGCTGG + Intronic
1023262077 7:38368332-38368354 GCTGAGAGCAGGCCCTCTTCAGG + Intergenic
1023727231 7:43156286-43156308 GGACAGAGCAGGCCCCCAGTAGG + Intronic
1023826988 7:44016309-44016331 GCCCAGAGCAAGCCCCCAGAAGG + Intergenic
1029423387 7:100483344-100483366 CGCCGGAGCACGCCCCCTGCTGG + Intergenic
1029738140 7:102476056-102476078 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1029755273 7:102569710-102569732 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1029773221 7:102668790-102668812 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1030283063 7:107797159-107797181 ACCCTGAGCAGGGCCCTTGCAGG - Intronic
1032420577 7:131775956-131775978 GGGCAGAGCAGGGCCCCTGGCGG - Intergenic
1032463038 7:132125911-132125933 GCCCAGAGAAGCCCCTCTCCGGG - Exonic
1032650174 7:133869325-133869347 GCCCAGAGCTGCCCCCAGGCTGG - Intronic
1033317856 7:140313275-140313297 GCTCAGAGCAGGGCCCAGGCAGG + Intronic
1034432271 7:151047016-151047038 GCCCAGAGTAGGGCCTCAGCTGG + Intronic
1034533521 7:151712452-151712474 GGCCAGAGCAAGGCCCCTGCAGG - Intronic
1034697773 7:153069240-153069262 GCCCAGGGTAGGGCCCATGCTGG + Intergenic
1035291227 7:157840600-157840622 CCACAGAGCAGGCCCCGTGTTGG + Intronic
1035618168 8:1017741-1017763 GCCCACGGCAGGCCCCTTGCAGG - Intergenic
1037766096 8:21773238-21773260 GCTCAGAGCAGCTCCCATGCTGG - Intronic
1041511569 8:58659526-58659548 GCCCCGACTAGGCCCCCGGCTGG + Exonic
1044306459 8:90645912-90645934 GCCCAGCGCGGGCCCTCAGCCGG + Exonic
1044525841 8:93250495-93250517 GCCCAGAGCAGGGTTCCTCCTGG - Intergenic
1047349722 8:124062082-124062104 TCCCACAGCAGGCACTCTGCAGG - Intronic
1047900922 8:129421839-129421861 GCCCTGGGTAGGCCCCCTGAAGG + Intergenic
1048321208 8:133401601-133401623 GCCCACAGCAAGCCAACTGCAGG - Intergenic
1048327109 8:133448351-133448373 GACCAGGGCAGGCCCTCGGCAGG - Intergenic
1049046876 8:140159354-140159376 GCACAGAGCAGGCCCTCAGGAGG + Intronic
1049095706 8:140546974-140546996 GCCAAGCGCTGGCCACCTGCCGG - Intronic
1049110135 8:140637059-140637081 GACCACAGCAGGGCCCCTGGGGG + Intergenic
1049252300 8:141595802-141595824 GCCCAGAGCAGGCACAGGGCCGG + Intergenic
1049266623 8:141671118-141671140 CCCCAGGGCAGGCCCACAGCGGG - Intergenic
1049316891 8:141974181-141974203 GCCCAGATGATGCCACCTGCAGG - Intergenic
1049381775 8:142319794-142319816 CCCCAGAACAGGCACCCAGCAGG + Intronic
1049429183 8:142551288-142551310 AGCCAGAGCCCGCCCCCTGCTGG + Intergenic
1049733794 8:144192650-144192672 GCCCAGTGCAGGCCCAGTACAGG + Intronic
1051186533 9:14466633-14466655 GGGCAGAGAAGGCCCCTTGCTGG - Intergenic
1051199222 9:14598114-14598136 GCCCAGAGCAAGCTGCCTGGAGG + Intergenic
1052223392 9:26054761-26054783 GCCCAGTGTAGGGCCTCTGCAGG - Intergenic
1054827957 9:69591616-69591638 GCCCAGAGGAGGCACCAAGCTGG + Intronic
1055422747 9:76161298-76161320 GCCCTCAGCAGGCCGCCTGCAGG + Intronic
1056663133 9:88559234-88559256 GCCATGAGCAGGCCTCCTCCCGG - Intronic
1056737056 9:89219144-89219166 CCCCAGAACAGACCCCCTGGTGG - Intergenic
1056824866 9:89869880-89869902 GCCCACAGCTGTCCCCATGCAGG + Intergenic
1056926385 9:90838293-90838315 TCCCAGAGCTGGCCCTCTGGTGG + Intronic
1057891710 9:98874716-98874738 GCCCAGAGAAGCTCCCCTGGAGG - Intergenic
1060152507 9:121298023-121298045 GGCCAGAGCTGGCCCACTGCAGG + Intronic
1060176344 9:121499808-121499830 GCCCAGAGCAGAAGCCCGGCCGG - Intergenic
1060375508 9:123112678-123112700 GCCCAGAGCAGTCCACCCCCAGG + Intronic
1060486803 9:124052699-124052721 GCCCTGAGGAGACACCCTGCTGG - Intergenic
1060544001 9:124450059-124450081 GCCCTGAGCCGGCTCCCTACAGG - Intergenic
1060700563 9:125746830-125746852 GCCCGGAGGAGGGCCCCGGCGGG - Intergenic
1060751665 9:126173720-126173742 GCCCAGGGCATGGCCTCTGCAGG - Intergenic
1061252657 9:129435885-129435907 GCCCAGAGGTAGCCGCCTGCAGG - Intergenic
1061444644 9:130631029-130631051 CCCCAGAGCCGTTCCCCTGCGGG + Intronic
1061492576 9:130954212-130954234 GCCCAGTGCTGGGCACCTGCAGG + Intergenic
1061837924 9:133341561-133341583 GCCCAGTGCTGGCCCCCTACAGG - Exonic
1062129728 9:134885891-134885913 GCCCAGGGTAGGGCCGCTGCTGG + Exonic
1062148866 9:135007259-135007281 GCACAGAGCAGGGCCTCTGCAGG - Intergenic
1062167227 9:135113893-135113915 CCCCAGACCAGGGCGCCTGCAGG + Intronic
1062181844 9:135195152-135195174 GTCCTTAGCAGGGCCCCTGCAGG - Intergenic
1062450076 9:136611480-136611502 GCCCAGGGCAGGCCCAGTGTGGG + Intergenic
1062685603 9:137811418-137811440 GCTCAGTGCAGGCTTCCTGCTGG - Intronic
1062729700 9:138102059-138102081 GCCCAGGGCAGGGCTGCTGCTGG - Intronic
1187195312 X:17077937-17077959 GCCCAGAGCAGCCCACCTGAAGG - Intronic
1187270631 X:17776454-17776476 GCCCTCCGCAGGCCCCCAGCAGG - Intergenic
1187319876 X:18229271-18229293 GCCCTCCGCAGGCCCCCAGCAGG + Intergenic
1191671149 X:63750156-63750178 GCCCAGAGCAAGCACTCTGCAGG + Intronic
1192797624 X:74437243-74437265 GTCCAAATAAGGCCCCCTGCAGG + Intronic
1200067249 X:153509796-153509818 GCCAAGAGCACGCCGACTGCAGG + Intergenic
1200267322 X:154653329-154653351 GCCGAGAGGAGGCGCCCCGCGGG - Exonic
1200690714 Y:6305061-6305083 GCCCAGTGCATGCGCCCTGAGGG - Intergenic
1200831122 Y:7689535-7689557 GCCCGGCGCATGCCCCCTGAGGG - Intergenic
1201044558 Y:9869655-9869677 GCCCAGTGCATGCGCCCTGAGGG + Intergenic
1201190289 Y:11438466-11438488 GCCCAGAGCAGGGCCAGGGCAGG - Intergenic
1202583334 Y:26403449-26403471 GCCCAGAGCAGGGCCAGGGCAGG + Intergenic