ID: 1121333071

View in Genome Browser
Species Human (GRCh38)
Location 14:93060044-93060066
Sequence GCAGGAGACCAGAGGGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1034
Summary {0: 1, 1: 3, 2: 25, 3: 127, 4: 878}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121333067_1121333071 -7 Left 1121333067 14:93060028-93060050 CCAAGAGGGGTCACTGGCAGGAG 0: 1
1: 1
2: 3
3: 24
4: 255
Right 1121333071 14:93060044-93060066 GCAGGAGACCAGAGGGCAGGAGG 0: 1
1: 3
2: 25
3: 127
4: 878
1121333062_1121333071 7 Left 1121333062 14:93060014-93060036 CCAGTTGCACTTGGCCAAGAGGG 0: 1
1: 0
2: 2
3: 8
4: 101
Right 1121333071 14:93060044-93060066 GCAGGAGACCAGAGGGCAGGAGG 0: 1
1: 3
2: 25
3: 127
4: 878
1121333059_1121333071 16 Left 1121333059 14:93060005-93060027 CCAGGGCTTCCAGTTGCACTTGG 0: 1
1: 0
2: 5
3: 15
4: 239
Right 1121333071 14:93060044-93060066 GCAGGAGACCAGAGGGCAGGAGG 0: 1
1: 3
2: 25
3: 127
4: 878

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121333071 Original CRISPR GCAGGAGACCAGAGGGCAGG AGG Intronic
900458851 1:2790510-2790532 CCAGGACACCAGCTGGCAGGAGG + Intronic
900555779 1:3279673-3279695 GCAGGAGGGCAGAGGGTCGGGGG + Intronic
900607665 1:3531076-3531098 GCCGGTGACCAGAGGCCAGGTGG - Intronic
900667567 1:3825529-3825551 GAAGGAGCCCCGAGGGGAGGTGG + Intronic
900883774 1:5401399-5401421 GAAGGAGTCCACGGGGCAGGCGG - Intergenic
900972093 1:5997333-5997355 GAAGGGGAAGAGAGGGCAGGAGG + Intronic
901245827 1:7730280-7730302 GCAGGAGACGATAGAGCTGGAGG - Intronic
901539989 1:9909772-9909794 GCAGGGGCCCAGAGGTCGGGAGG + Intronic
901804955 1:11732749-11732771 GCTGGAGACAGGAGGTCAGGAGG - Intergenic
901860405 1:12070671-12070693 GTGGGAGCGCAGAGGGCAGGAGG + Intronic
901864360 1:12094426-12094448 GCTAGAGATCAGAGGGCAAGGGG + Intronic
901921062 1:12538079-12538101 GCAGGAGATCAGAGGGCAAGAGG - Intergenic
902447640 1:16477074-16477096 GCTGCAGGACAGAGGGCAGGTGG + Intergenic
902677702 1:18020301-18020323 GAAGGAGGCCCAAGGGCAGGAGG + Intergenic
902686443 1:18080613-18080635 GGAGGAGGCCAGGGTGCAGGAGG - Intergenic
902741899 1:18444672-18444694 ACAGGAGTCCAGAGGTCAGATGG + Intergenic
902837801 1:19058143-19058165 TCTGGAGACCTGAGGGAAGGGGG + Intergenic
902961609 1:19967507-19967529 GCAGAATAGGAGAGGGCAGGTGG - Intergenic
903056783 1:20641662-20641684 CCAGGAGAGCAGAGGCTAGGAGG - Intronic
903129839 1:21271672-21271694 GGAGGAGCCCAGTGGGCAGACGG + Intronic
903326067 1:22569259-22569281 ACAGGAGACAAGAGGGCATCAGG - Intronic
903330047 1:22592677-22592699 GGAGGAGGCCTGAGGGCTGGAGG + Intronic
903474624 1:23611023-23611045 GCAAGAGGACAGAGGACAGGTGG - Intronic
903865198 1:26392738-26392760 GGAGGAGTAGAGAGGGCAGGAGG + Intergenic
904058199 1:27686130-27686152 CCAGGGGAGCTGAGGGCAGGAGG + Intergenic
904200841 1:28818144-28818166 GCAGGTGGGCAGAGTGCAGGTGG + Intronic
904321375 1:29699524-29699546 GCAGGAGACGAGAGGCTAGGAGG - Intergenic
904475049 1:30759358-30759380 TCAGGAAACCAGGGGCCAGGAGG + Intergenic
904584081 1:31569470-31569492 GCAGGAGCTCAGTGAGCAGGAGG - Intergenic
904789887 1:33011541-33011563 GCAGGAGAGCTCAGGTCAGGAGG + Intronic
905262843 1:36731482-36731504 ACAGGAGATCAGAGGGTGGGAGG + Intergenic
905434201 1:37945912-37945934 GCAGGGGAACAGAGGGAAGGTGG - Intronic
905671258 1:39791758-39791780 TAAGGAGACCAGTGGGGAGGAGG - Intergenic
905695385 1:39969723-39969745 GCAGGAGGCCACAGAGCAGCCGG - Exonic
905773614 1:40654120-40654142 GGAGGAGATGGGAGGGCAGGCGG - Intronic
906110127 1:43317169-43317191 GGATGAGACAAGAGGGCAGACGG - Intronic
906148143 1:43572068-43572090 GAAGGTGAGCAGAGGGCCGGAGG - Intronic
906209925 1:44007084-44007106 GCAGGTGAGCAGAGGCCAGAAGG - Intronic
906237625 1:44221419-44221441 GCATGAGCCCACAGGGCAGCTGG + Exonic
907107742 1:51899500-51899522 GTAGGAGATCAGAGGTCATGGGG + Intergenic
907299325 1:53476742-53476764 GCAAGAGAGCAGAGGGCAGGAGG - Intergenic
907300127 1:53481841-53481863 GTAGGAGACCAGCAGGCAGGAGG - Intergenic
907364256 1:53946253-53946275 GCAGGCGACCCGAGGGCCGAGGG - Exonic
907466362 1:54640397-54640419 GCAGGAGGCCAGAGAGGAAGAGG + Intergenic
907567003 1:55444654-55444676 GCAGGAGATCAGAGGGAGGAGGG + Intergenic
907668045 1:56450437-56450459 GCAAGAGACGGGAGGGCAGGAGG - Intergenic
907754499 1:57298008-57298030 GCAGTGGTCCAGGGGGCAGGAGG - Intronic
907929606 1:58987187-58987209 GCAGGAGATCAGAGGCTGGGAGG - Intergenic
908415465 1:63909145-63909167 GCAGGTGCGCAGGGGGCAGGAGG - Intronic
908472317 1:64456207-64456229 GTGGGAGACAAGAGGGCAGAGGG - Intergenic
908615032 1:65910754-65910776 GCAAAAGATCAGAAGGCAGGAGG - Intronic
908738417 1:67301764-67301786 GGGGGAGACAAGGGGGCAGGTGG + Intergenic
908768125 1:67572400-67572422 ACAGGAGAGCAGAGGGAAGGAGG + Intergenic
909608700 1:77531835-77531857 GCAGGAGACCAGGGGGAGGTGGG + Intronic
911158459 1:94658898-94658920 GCAGGTCACCTGAGGTCAGGAGG + Intergenic
911231343 1:95364775-95364797 GCAAAAGACCAGAGGGCAGGAGG + Intergenic
911236020 1:95413233-95413255 GCAGGAGACAGAAGGGCAGAAGG - Intergenic
911499379 1:98666458-98666480 GCAGGAGATCCAAAGGCAGGAGG - Intronic
911829796 1:102536386-102536408 TCATGAGAACAGAGGGAAGGGGG + Intergenic
912449126 1:109758777-109758799 GAAGGAGACCAGGGAGCAGGGGG - Intronic
914419670 1:147517842-147517864 GCAGGACACCAGAGGGCAGCGGG + Intergenic
915084841 1:153379121-153379143 GCAGGAGAACAGACATCAGGTGG + Intergenic
915112117 1:153570672-153570694 GCAGGAGGCTAGAGGACAGGAGG - Intergenic
915161055 1:153921287-153921309 GAAGGAGACTAGATGGCTGGAGG + Intronic
915225658 1:154409351-154409373 GGAGGAGAGCAGAAGGCAGAGGG - Intronic
915285074 1:154847208-154847230 GCAGGCTCCCCGAGGGCAGGGGG - Intronic
915737400 1:158093771-158093793 GCAGGAGGCCAGAGAGGAGCAGG - Intronic
916052873 1:161048463-161048485 GAGGGAGACCAGAGGGCTGGAGG - Exonic
916427918 1:164699448-164699470 GCAGGAGTCCAGTGAGGAGGTGG - Intronic
916657835 1:166893116-166893138 GAAGGAGATCAGTGGGCAGGAGG - Intergenic
916723325 1:167501745-167501767 CAAGGAGACCAGAAGGCAGGAGG + Intronic
917652926 1:177096689-177096711 GCAGCAGGCAAGAGGGCATGTGG - Intronic
918003409 1:180519743-180519765 GTGGAAGACAAGAGGGCAGGTGG + Intergenic
918053212 1:180993145-180993167 GAAGAAGACCAGAGGGTAAGAGG + Intronic
918483832 1:185008008-185008030 GCAGGAGAAAAGAGGGATGGAGG - Intergenic
919257448 1:195142354-195142376 AGAGGAGAGCAGAGGGGAGGAGG - Intergenic
919630364 1:199954871-199954893 GCTGGAGAGCAGAGGGAAGAGGG - Intergenic
919888876 1:201955587-201955609 GAAGGAGGGCAGTGGGCAGGGGG - Intronic
920200299 1:204256137-204256159 CCAGGAGGCCAGAGTGGAGGAGG - Intronic
920211791 1:204333753-204333775 GCTGGAGAGCAGGGGCCAGGAGG - Intronic
920415420 1:205796151-205796173 GCAGGCAACCAGAGGGCAGGTGG + Intronic
920499782 1:206478906-206478928 GGTGGGGAGCAGAGGGCAGGGGG - Intronic
920886895 1:209938203-209938225 GCAGCAGACGCGAGGGCTGGCGG - Intronic
921079258 1:211725584-211725606 GGAGGAGACCAGGGGGCAGTGGG - Intergenic
921221421 1:212976756-212976778 GCAGGAGGGCAGAGGGCAAGTGG - Intronic
922013964 1:221623891-221623913 GCAGGTCACCTGAGGTCAGGAGG - Intergenic
923319838 1:232820287-232820309 GCAGGAGATTGGAGGGCAGGAGG + Intergenic
923482959 1:234401920-234401942 GAAGGAGAAAAGAGGACAGGTGG - Intronic
923531961 1:234818808-234818830 GCAGGGGAGCCCAGGGCAGGAGG + Intergenic
923781617 1:237030293-237030315 GAAGCAGAGCAGAGGGTAGGGGG + Intergenic
924455750 1:244217655-244217677 CCAGGACACCAGTGGGCAGGAGG + Intergenic
1063144965 10:3288630-3288652 GAAAGAGCCCAGAGGGGAGGAGG - Intergenic
1063411679 10:5841037-5841059 GCAGGTGACCGGGGGGCAGGAGG + Intronic
1063861432 10:10312084-10312106 GCAGTAGATGAGAGGGTAGGAGG - Intergenic
1064096384 10:12427419-12427441 TCAGGAGAGCAGAGGGCAAAAGG - Intronic
1064349701 10:14565833-14565855 TCAGGCGCTCAGAGGGCAGGGGG + Intronic
1064493281 10:15883000-15883022 CCAGGAAAGCAGAGGCCAGGAGG + Intergenic
1064622162 10:17228175-17228197 AGAGGAGACCAGAGGGACGGGGG + Intergenic
1064673297 10:17737268-17737290 GCAGGAGGCCAAAGGGCAGCAGG - Intergenic
1065053720 10:21821197-21821219 GCAGGTGAAAGGAGGGCAGGAGG + Intronic
1065145455 10:22763648-22763670 GATGGAGCCCAGAGGGCAGATGG + Intergenic
1065773990 10:29102536-29102558 GCAGGAGCCCAGGGGCCATGGGG + Intergenic
1065850370 10:29782603-29782625 GCAGGAGAACAGAGAGGAAGTGG + Intergenic
1067080852 10:43211476-43211498 GCAGCAGGACAGAGGGCAGGCGG + Intronic
1067228615 10:44391531-44391553 GCAGAAGACCACAAGGCGGGGGG - Intergenic
1067451527 10:46384867-46384889 GCCGGAGTCCAGATGGCAGGGGG - Intronic
1067511009 10:46895198-46895220 TCAGGAGACCAGGGGGGTGGGGG - Intergenic
1067585712 10:47474889-47474911 GCCGGAGTCCAGATGGCAGGGGG + Intronic
1067714922 10:48683525-48683547 GTAGGAGACCTGGGTGCAGGTGG + Intergenic
1068709326 10:60116150-60116172 GCAGGAGACTAGAAGGCTAGAGG + Intronic
1069127403 10:64653536-64653558 GCAGAAGATCATAGTGCAGGAGG - Intergenic
1069932133 10:71890029-71890051 GGAGGGGAGCAGAGGGCAGAGGG - Intergenic
1069993947 10:72331442-72331464 GCAGAAGACCCGAGTCCAGGAGG - Intergenic
1070373842 10:75810158-75810180 GCTGGAGTTCAGAGAGCAGGTGG + Intronic
1070726720 10:78796907-78796929 GCAGGAGACAAAAGAGCAAGGGG + Intergenic
1070786693 10:79166191-79166213 GAAGGAGAGCAGAGGTGAGGAGG - Intronic
1071336487 10:84604664-84604686 CCAAGAGAGCAGAGGGGAGGGGG - Intergenic
1071506729 10:86236876-86236898 GCAGGAGAGCAGAGAGCAGGAGG + Intronic
1071556054 10:86602311-86602333 GCAAGAGAGCAGAGGGCAGGAGG - Intergenic
1072045523 10:91650938-91650960 GCAAGAGAGCAGAGGGTAGGAGG + Intergenic
1072125235 10:92439925-92439947 GGAAGAGACAGGAGGGCAGGAGG - Intergenic
1072421298 10:95292002-95292024 GCAGGTGAGGAAAGGGCAGGAGG - Intergenic
1072501302 10:96020593-96020615 ACAGGAGCCCAGAGGGAGGGAGG + Intronic
1072764109 10:98082156-98082178 GCTAGAGAGGAGAGGGCAGGAGG - Intergenic
1073010739 10:100357464-100357486 AGAGGAGACAAGAGGGTAGGTGG - Intronic
1073053941 10:100687202-100687224 CCAGGGGACCAGAGGGCAGTTGG - Intergenic
1073152748 10:101323019-101323041 GCAGGAGGAGGGAGGGCAGGCGG + Intergenic
1074106410 10:110392763-110392785 GCAGAAGCCCACAGGGGAGGAGG - Intergenic
1074719957 10:116256037-116256059 GCAGGAAACCGGTGGGTAGGTGG - Intronic
1075450972 10:122551767-122551789 GCTGTAGGTCAGAGGGCAGGAGG + Intergenic
1076013088 10:127006255-127006277 GCAGGAGAGCAGAAGGCAGGAGG - Intronic
1076014378 10:127015771-127015793 GCAGGAGAACAGAGCACAGTGGG - Intronic
1076258104 10:129044846-129044868 CCAGGAGGCCAGTGGGCAGTCGG + Intergenic
1076357763 10:129865464-129865486 CCAGAAGACCACAGGGGAGGTGG - Intronic
1076542747 10:131224362-131224384 TCAAGAGGCCAGAGTGCAGGAGG - Intronic
1076605340 10:131685703-131685725 GCAGTGGGGCAGAGGGCAGGTGG - Intergenic
1076615437 10:131751526-131751548 CCGGGAGGCCAGAGGTCAGGTGG - Intergenic
1076707600 10:132310122-132310144 GCAGAAGACAAGAGTGCAGGGGG + Intronic
1076714136 10:132354724-132354746 GAAGGAGAGCAGAGGTCGGGTGG + Intronic
1076840671 10:133043756-133043778 CAAGGAGACCTCAGGGCAGGTGG - Intergenic
1076874857 10:133210995-133211017 GGAGGAAAGCGGAGGGCAGGTGG + Intronic
1077009962 11:375325-375347 GCAGGAGAGGAGATGGCAGAGGG - Intronic
1077049418 11:560163-560185 ACAGGAGACAGGCGGGCAGGAGG + Intronic
1077105220 11:839235-839257 GCTGGGGGCCAGAGGGTAGGAGG + Intronic
1077129995 11:966742-966764 GCTGGTGACCAGATGGCTGGTGG + Intronic
1077286632 11:1768959-1768981 ACAGGAGAGCAGAGGCCATGAGG + Intergenic
1077320617 11:1939286-1939308 GCAGGACAGCAGAGCGCACGCGG + Intergenic
1077853608 11:6099782-6099804 GTGGGAGATCAGAGGGCAGCAGG - Intergenic
1078495387 11:11811679-11811701 GCAGGACAGCACAGGACAGGGGG - Intergenic
1078581735 11:12544195-12544217 GCAGGAGACTGGAGGGCGGGAGG - Intergenic
1078810442 11:14756522-14756544 GCAGGAGATGAAAGGGCAGGAGG - Intronic
1078849932 11:15154596-15154618 GCAGGAGAGCACAGTGCAGTGGG + Intronic
1079176740 11:18148972-18148994 GCAGGAGACTGGAGGGCAGGAGG - Intronic
1079259828 11:18867828-18867850 GTAGGAGACTGGAAGGCAGGAGG + Intergenic
1079261921 11:18890765-18890787 GCAGGAGACTGGAAAGCAGGAGG + Intergenic
1079268620 11:18960345-18960367 GCAGGAGACTGGAGGACAGCAGG + Intergenic
1079353999 11:19714958-19714980 GCGGGAAGCCAGAGGGGAGGTGG + Intronic
1079920122 11:26422999-26423021 GCAGGAAAACATAGGGCAGTAGG + Intronic
1080064001 11:27988404-27988426 AGAGGTGACCAGAGGCCAGGTGG + Intergenic
1080676643 11:34434000-34434022 GCAGGAGCCCAGAGGCAAGGAGG + Intergenic
1080745718 11:35106841-35106863 GCAGGATATCAGAGGGTAGAAGG + Intergenic
1081374307 11:42340586-42340608 GCAAGAAATCAGAGGACAGGAGG + Intergenic
1081436037 11:43028336-43028358 ACAGGAGATCAGAGGCCAGCAGG + Intergenic
1081630843 11:44688558-44688580 GCGGGAAACCAGAGGGAAGAAGG + Intergenic
1081805966 11:45890705-45890727 GTGGGAGACCAGAGGGCGGTGGG + Intronic
1082067898 11:47915640-47915662 ACCGGAGATCAAAGGGCAGGAGG + Intergenic
1082799833 11:57406366-57406388 GCAGGAGGAGAGATGGCAGGTGG - Intronic
1082947645 11:58776639-58776661 GCAGGAGACAAGAAAGCAGGAGG - Intergenic
1083202571 11:61129459-61129481 GGAGGAAACCACAGGGCAGGTGG - Intergenic
1083578769 11:63811934-63811956 GCAGGAGAAGAGAAGGCAGGAGG - Intergenic
1083704146 11:64501626-64501648 GCAGGAGGACAGATGGGAGGTGG - Intergenic
1083954842 11:65977567-65977589 GCTGGAGACCACAGTGCAGAAGG + Exonic
1084161314 11:67351958-67351980 GCAAGAGAGCTAAGGGCAGGAGG + Exonic
1084313119 11:68328072-68328094 TCAGGAGACCAGGAGGCAAGGGG + Intronic
1084767741 11:71323532-71323554 ACAGGAGGCCTGAAGGCAGGTGG + Intergenic
1084893570 11:72249707-72249729 CCAGGGGACCAGAGGGATGGGGG - Intergenic
1085313550 11:75530198-75530220 GTGGAAGACCAGAGAGCAGGAGG - Intergenic
1085402941 11:76245455-76245477 GCTGAAGCCCAGAGGGTAGGAGG + Intergenic
1085624578 11:78062128-78062150 GCAGGAGAGGAGAGAGGAGGAGG - Intronic
1085777981 11:79383174-79383196 GCAGGAGAGGGGAGGGCAGGAGG + Intronic
1085795056 11:79531713-79531735 TCAGGAGACCACAGTGCAGAGGG - Intergenic
1085831283 11:79903964-79903986 CCAGGAGAGCAGAGGTAAGGTGG - Intergenic
1086307146 11:85493720-85493742 GTAGGAGAGAAGAGGGGAGGGGG + Intronic
1087007558 11:93484190-93484212 GCAGGAGACCAGAGGCAGAGAGG + Intronic
1087793325 11:102430174-102430196 TGAGAAGACCAGAGTGCAGGTGG + Intronic
1087872193 11:103309723-103309745 GCATGAGCCATGAGGGCAGGGGG + Intronic
1088568069 11:111194527-111194549 GCAAGAGATAAGAGGGCTGGAGG - Intergenic
1088605645 11:111528248-111528270 GCTTGAGCCCAGGGGGCAGGAGG + Intronic
1088771716 11:113042385-113042407 GAAGGAGGCCAAAGGGCAGAGGG - Intronic
1089153887 11:116385872-116385894 GCTGGACAGCAGAGGGCCGGGGG - Intergenic
1089307935 11:117538451-117538473 GCAGGAGGCCTGACCGCAGGAGG - Intronic
1089649698 11:119904775-119904797 GCAGAAGATCCAAGGGCAGGAGG + Intergenic
1089664847 11:120011846-120011868 GCAATAGACCTGAGGGCTGGTGG - Intergenic
1089786503 11:120911109-120911131 GCATGAAACAAGCGGGCAGGAGG + Intronic
1090182615 11:124714033-124714055 GGAGGAGATCAGAGGGTGGGAGG + Intergenic
1090235261 11:125142255-125142277 GCAGAAGACTGGAGTGCAGGCGG + Intergenic
1090268838 11:125371537-125371559 GAAGGAGACTGGAGGGGAGGAGG - Intronic
1090628374 11:128625371-128625393 ACAGGATCCCAGAGGGCAGGAGG + Intergenic
1090666517 11:128918277-128918299 GCTGGAAACAAGAGGGCAAGCGG + Exonic
1090878489 11:130812796-130812818 GCAGGAGACTGGAGGGCAGGAGG - Intergenic
1091118710 11:133039264-133039286 GAAGGAAACGTGAGGGCAGGAGG - Intronic
1091571635 12:1691496-1691518 GAAGGTGAGCAGAGGGCAGCAGG - Intronic
1091678989 12:2512763-2512785 GCAGGAGAGCACAGAGAAGGAGG - Intronic
1091767885 12:3133739-3133761 GAAGGAAACCAGAGTGCAGAGGG + Intronic
1091931501 12:4399322-4399344 GCAAGAGAGCATGGGGCAGGGGG + Intergenic
1092119944 12:6036755-6036777 GCAGGGCACGAGAGGGCAGAGGG - Intronic
1092228879 12:6766257-6766279 GGAGGAGAGGAGAGGGGAGGGGG - Intronic
1092813710 12:12294752-12294774 GCAGGAAAGCAGAGGGTGGGAGG - Intergenic
1094171262 12:27494817-27494839 GCAGAAGGCCAAAGGGAAGGAGG - Intronic
1095659748 12:44717799-44717821 GCAGGAAACTGGAAGGCAGGAGG - Intronic
1096257491 12:50072334-50072356 GAAGGTGACCCGAGGGGAGGAGG - Intronic
1096521928 12:52189296-52189318 GCAGGAGCCTGGAGAGCAGGTGG - Intronic
1096706615 12:53425874-53425896 GCAGGGGCCCAGAGAGCAGGCGG - Exonic
1099224177 12:79949407-79949429 GAAGGAGGACAGAGGGAAGGAGG - Intergenic
1099975879 12:89545004-89545026 GCAAGAGGCCAGAGGGCAGGAGG - Intergenic
1100563079 12:95768548-95768570 GGATGAGACAAGAGGCCAGGGGG + Intronic
1100635497 12:96431316-96431338 GCAGGGGAGAAGAAGGCAGGAGG + Intergenic
1102400790 12:112627977-112627999 GCAAGAGATCAAAGGGCCGGGGG + Intronic
1102422501 12:112815093-112815115 GCAGGAGACTGGAGGGAGGGAGG - Intronic
1102453474 12:113057423-113057445 CCAGGAGACAAGAGGGGAGAGGG - Intronic
1102620611 12:114191671-114191693 CCAGAAGATCAGAGGGCGGGAGG + Intergenic
1102662048 12:114537746-114537768 GCAGGAGGTCACAGGGTAGGTGG - Intergenic
1102713773 12:114952401-114952423 GCAGGAGACCACACTGCGGGTGG - Intergenic
1102774512 12:115506962-115506984 GCAGGAGATCAAAGGGAAGAAGG + Intergenic
1102924347 12:116815492-116815514 GAAGGGGACCAGAGGCAAGGAGG - Intronic
1102955050 12:117053793-117053815 ACAGGGGACCAGAGCCCAGGGGG - Intronic
1103398902 12:120629054-120629076 GCAGGAGATGGGAGGGCAGGAGG - Intergenic
1103973540 12:124687556-124687578 GCAGGAAGCCTGATGGCAGGGGG - Intergenic
1104034145 12:125086978-125087000 GCAGGAGGCCACAGGCCTGGAGG + Intronic
1104312222 12:127663701-127663723 GAGGGAGACCAAAGGACAGGTGG - Intergenic
1104503698 12:129310509-129310531 GCAGGAGCTCAGAGGGAGGGAGG - Intronic
1104571468 12:129929720-129929742 GCAGGGGACTGGAAGGCAGGAGG + Intergenic
1104747541 12:131219671-131219693 GCAGGAAACCTCAGGGCATGGGG + Intergenic
1105284514 13:18993454-18993476 CCAGGAGGCCAGAAGGCAGAAGG + Intergenic
1105284609 13:18994024-18994046 GCAGAAGGCCAGAAGGCAGAAGG + Intergenic
1105284990 13:18996282-18996304 TCAGAAGACCAGAGGGCAGAAGG + Intergenic
1105285074 13:18996752-18996774 GCAGAAGGCCAGAGGCCAGAAGG + Intergenic
1105307600 13:19180144-19180166 GCAGGAGACCAGGAGGCTGGAGG + Intronic
1105593927 13:21818234-21818256 TCAGGAGCCCACAGGGCAGGGGG - Intergenic
1105732953 13:23237582-23237604 GCAGCATACCTGAGGGGAGGAGG + Intronic
1106017010 13:25879070-25879092 GCAGGAGAGCAGAGGGCATTTGG + Intronic
1106088707 13:26566806-26566828 GCAGGAGAAGAGAGGTCATGGGG + Intronic
1106688634 13:32089800-32089822 GGAGGAGAACAGATGGGAGGTGG + Intronic
1107779031 13:43879269-43879291 GCAGGTCTCCAGAGGGCACGGGG - Exonic
1108683816 13:52802191-52802213 GCACGAACCCAGAAGGCAGGGGG - Intergenic
1108788395 13:53935552-53935574 ACAGGAGACTAGAGGGGAAGAGG - Intergenic
1110640702 13:77820498-77820520 GCAGGAGATCAAAGGACAGAAGG + Intergenic
1110643587 13:77854940-77854962 GCAAGGGACAAGAGGGCAGGAGG + Intergenic
1110756192 13:79177171-79177193 GCAGGAGATGAAAGGGCAGGAGG - Intergenic
1110863304 13:80367478-80367500 GCAAGAGACAGGAGGGCAGAAGG + Intergenic
1113142903 13:107174734-107174756 GCAGAAGGCCAGGGAGCAGGAGG + Intronic
1113432367 13:110261937-110261959 GCAGGTGGGCACAGGGCAGGTGG + Intronic
1113784522 13:112995519-112995541 CCAGGAGAGCAGAGGGGAGCTGG + Intronic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1114402269 14:22420844-22420866 TCAGGAGACTGGAGGGAAGGAGG - Intergenic
1114484969 14:23056949-23056971 GCTGGGGACCAGAGAGAAGGCGG + Intronic
1114731755 14:25000495-25000517 CCAGAAGACAGGAGGGCAGGAGG - Intronic
1115091917 14:29587057-29587079 GCAGGAGAAGAGAAGGCTGGGGG + Intronic
1115165530 14:30444819-30444841 ACAGAAGACCAGAGAGCAGAAGG + Intergenic
1115278289 14:31632401-31632423 GCAGGAGATCAGAAAGAAGGAGG - Intronic
1115426988 14:33271464-33271486 GCCAGAGACAAGAGAGCAGGAGG + Intronic
1115718171 14:36128835-36128857 GCAGGAGATCAGAGGGTGGAAGG + Intergenic
1116481342 14:45394336-45394358 GCAGGAGAACAGAGTGATGGTGG - Intergenic
1116565982 14:46444736-46444758 CCAGGAGACCAGAGGACAGAGGG - Intergenic
1116991951 14:51286305-51286327 GCAGGAGATCAGAGAGAATGAGG + Intergenic
1116996232 14:51328100-51328122 ACAGGAGAGGAGAGGGGAGGTGG - Intergenic
1117289739 14:54320861-54320883 GCAGGAGACCAGAGGGCAAGAGG + Intergenic
1117819803 14:59636346-59636368 GCAAGGGAGCAGAGGGCAAGAGG - Intronic
1118225027 14:63890571-63890593 GAGGGAGACAGGAGGGCAGGTGG + Intronic
1118401534 14:65384050-65384072 GCTGGAGATCAGAGGGCAGGAGG - Intergenic
1118471919 14:66082239-66082261 GCAGGAAGACAGAGGGCGGGTGG - Intergenic
1118718352 14:68576165-68576187 GCAGGAGGCTGGAGGTCAGGAGG - Intronic
1118906965 14:70030262-70030284 GCAGAAAACCCAAGGGCAGGTGG + Exonic
1118974137 14:70663036-70663058 TCAGGTGACCAGAGTGGAGGCGG - Intronic
1119003935 14:70907642-70907664 GGAGGAGACCCGAGAGGAGGAGG - Exonic
1119225267 14:72940398-72940420 GCAGGAGCGGAGAGGACAGGGGG - Intronic
1119327421 14:73769125-73769147 GATGGAGGCCACAGGGCAGGAGG - Intronic
1119386601 14:74261224-74261246 GCAAGAGAACAGAGAGCAAGGGG - Exonic
1119478600 14:74946254-74946276 GGAGGAGACCCAAGGGCAGGGGG - Exonic
1119484949 14:74981088-74981110 ACAGGAGACCAGCAGGCAGCAGG - Intergenic
1119519664 14:75276991-75277013 GCAGGAGCGGGGAGGGCAGGAGG - Intergenic
1119730597 14:76948588-76948610 GCAGGTGACTGGAGGGCAGAAGG + Intergenic
1120182078 14:81354068-81354090 GGAGAAGCCCAGAGGTCAGGTGG - Intronic
1120672697 14:87382512-87382534 GCAGGAGACTAAAGGGAAAGTGG - Intergenic
1121081739 14:91114164-91114186 GCAGGAGAGCAGAAGAAAGGGGG + Intronic
1121321695 14:92995266-92995288 GTGGGTGAGCAGAGGGCAGGGGG - Intronic
1121333071 14:93060044-93060066 GCAGGAGACCAGAGGGCAGGAGG + Intronic
1121538240 14:94706050-94706072 GCAGGAGACTAGACAGCAGGAGG + Intergenic
1121660672 14:95632773-95632795 GCTGTAGAGCAGAGGGCAGAAGG + Intergenic
1121661886 14:95641173-95641195 GCAGGAGAGCTGGGGACAGGAGG + Intergenic
1121738400 14:96234647-96234669 CCCGAAGTCCAGAGGGCAGGCGG - Intronic
1121916431 14:97840272-97840294 CCAGGAGACCAGAAGGCATCTGG - Intergenic
1121981793 14:98460888-98460910 GCAGAGGACCAGAGGGCCTGGGG + Intergenic
1122309434 14:100785244-100785266 GCAGGGGAGCAGAAGGCAGGGGG - Intergenic
1122338229 14:101007592-101007614 GCAGGGGACCAGAGGGCCCCGGG - Intergenic
1122854647 14:104554282-104554304 TGAGGAGACAGGAGGGCAGGAGG + Intronic
1122864890 14:104599280-104599302 GCCGGAAGCCAGAGGGCACGGGG - Intronic
1122870070 14:104634440-104634462 GCTGGAGAGAACAGGGCAGGTGG - Intergenic
1122909585 14:104820861-104820883 GCAGGAGACTGAAAGGCAGGAGG - Intergenic
1122977813 14:105178184-105178206 GGTGGAGACGGGAGGGCAGGAGG + Intronic
1122981908 14:105195881-105195903 GCAGGAGACCCCAGGGCACATGG + Intergenic
1123052903 14:105555567-105555589 GCAGGAGAACAGTGGGGAGGAGG - Intergenic
1123113215 14:105882524-105882546 AGAGGAGAGCAGAGGGGAGGAGG + Intergenic
1123115568 14:105892675-105892697 AGAGGAGAGCAGAGGGGAGGAGG + Intergenic
1123402551 15:20002960-20002982 AGAGGAGAGCAGAGGGGAGGAGG + Intergenic
1123479252 15:20616002-20616024 GCAGGAGCTGAGAGGGCGGGAGG + Intergenic
1123511889 15:21009614-21009636 AGAGGAGAGCAGAGGGGAGGAGG + Intergenic
1123638761 15:22384383-22384405 GCAGGAGCTGAGAGGGCGGGAGG - Intergenic
1124560477 15:30769544-30769566 GCTGGAGACCAGCCGGCAGGTGG + Intronic
1124619938 15:31267930-31267952 TGAAGAGAGCAGAGGGCAGGGGG - Intergenic
1124670736 15:31635898-31635920 GCCGGAGACCAGCTGGCAAGTGG - Intronic
1125126382 15:36227053-36227075 TCGGGATACCAGAGGGCAGAGGG + Intergenic
1125491165 15:40149568-40149590 GCAGGACATCAGAAGGCGGGAGG + Intergenic
1125517460 15:40330409-40330431 GCAGCAGGCCTCAGGGCAGGAGG - Intergenic
1125520563 15:40345837-40345859 GCAGGAGACCTGAAGGGAGGTGG - Intergenic
1125611841 15:40976640-40976662 GCAGGAGAGCAGAGGCCTTGTGG + Intergenic
1125678760 15:41517423-41517445 GCAGGAGACCAAGGAGCAGAAGG - Exonic
1125766737 15:42141403-42141425 CGAGGAGACCAGAAGGCAGAAGG + Exonic
1125841834 15:42809137-42809159 GAGTGAGAACAGAGGGCAGGTGG - Intronic
1125921053 15:43526213-43526235 GCAGGAGAGCCTAGTGCAGGAGG + Exonic
1126269874 15:46802233-46802255 GCAGAAGATCAGAGGGAAAGAGG - Intergenic
1126405471 15:48318302-48318324 GCAGGAGACCAGAGGGAGAAGGG - Intergenic
1127898317 15:63321911-63321933 GAGGGAGACAGGAGGGCAGGAGG - Exonic
1127967407 15:63932731-63932753 GCAGGATGCAAGAGGACAGGAGG - Intronic
1127975358 15:63993086-63993108 GCAGGAGAGGGGAGGGCAAGTGG - Intronic
1128348256 15:66869084-66869106 GCAGGAGAACAGAAGGCAGAGGG - Intergenic
1128414639 15:67433727-67433749 GCAGGACTCAGGAGGGCAGGAGG + Intronic
1128557269 15:68640285-68640307 AAAGGAGAGGAGAGGGCAGGGGG - Intronic
1128759777 15:70208601-70208623 GCAGGAGATGGGAGGGCATGGGG - Intergenic
1129042651 15:72703194-72703216 GCAGGAGATTAGAAGGCAAGAGG + Intronic
1129165299 15:73773811-73773833 GCTGGAGGCTAGAGGCCAGGAGG + Intergenic
1129266459 15:74395992-74396014 GTAGGAGACCGGAGGGCAGGCGG - Intergenic
1129332572 15:74835403-74835425 GCAGTGTCCCAGAGGGCAGGAGG - Intergenic
1129348518 15:74939727-74939749 GCAAGAGACAAGAGGGCAGAAGG - Intergenic
1129394860 15:75238192-75238214 GCATGTGACCAGAGGGATGGGGG - Intergenic
1129644582 15:77419292-77419314 GCATGCGACGAGAGGGGAGGGGG + Intronic
1130017219 15:80196825-80196847 ACAGGAGATTGGAGGGCAGGAGG + Intergenic
1130141688 15:81231268-81231290 TGAGGAGACCAGAGGAGAGGAGG + Intronic
1130232211 15:82105643-82105665 ACAGTACATCAGAGGGCAGGAGG - Intergenic
1130995715 15:88902846-88902868 GCTGGCTCCCAGAGGGCAGGGGG - Intronic
1131549194 15:93342046-93342068 GGATGAGAGAAGAGGGCAGGTGG + Intergenic
1131797381 15:96033520-96033542 TCAGGAGACAAGAGGGCGAGAGG - Intergenic
1132026967 15:98412001-98412023 GCAGGAGTTCAGAGGGCAGTGGG + Intergenic
1132252549 15:100344934-100344956 GCAGGAGATTAGATGGCAGGAGG - Intergenic
1132354432 15:101160645-101160667 GCAGGAAATGAGAGGGAAGGTGG + Intergenic
1132466063 16:77948-77970 CCAGGCGACCAGGGCGCAGGCGG + Intronic
1132667528 16:1089067-1089089 GCTGGAGACCCCAGGGCAGCCGG + Intergenic
1133928943 16:10216569-10216591 GCAAGAGATCAGAGGCGAGGAGG + Intergenic
1134682948 16:16139176-16139198 ACAGGATTCCAGAGGGCAGCAGG + Intronic
1134849505 16:17469446-17469468 GCAGGAGCACATGGGGCAGGAGG - Intronic
1134950926 16:18350771-18350793 GCTGGAGACCAGTGGGAACGAGG + Intergenic
1135118072 16:19740475-19740497 GCAGCAGAACAGAAGGCAGAGGG - Intronic
1135120384 16:19761319-19761341 GCAGGAGACCAGAGAGATGAAGG - Intronic
1135305192 16:21361904-21361926 CCAGGAAGCCTGAGGGCAGGTGG - Intergenic
1135338585 16:21626862-21626884 GCAGGAGATGAAAGAGCAGGGGG + Intronic
1135886274 16:26311337-26311359 CCAGGAGACCACAGGGCATGAGG + Intergenic
1135918134 16:26624404-26624426 CCAGAAAACCAGAGGGGAGGAGG + Intergenic
1135976772 16:27113621-27113643 GCAGGAGGTCAGCGAGCAGGAGG + Intergenic
1135985518 16:27181013-27181035 GATTGAGACCAGAGGGCAGTGGG + Intergenic
1136034837 16:27531276-27531298 GCAGTAATCCAGAGGGCAGCTGG - Intronic
1136301936 16:29341069-29341091 CCAGGAAGCCTGAGGGCAGGTGG - Intergenic
1136996611 16:35195207-35195229 GCAGGAGTGCAGAGGTGAGGAGG - Intergenic
1137567466 16:49542547-49542569 CCAGAAGGCCAGAGGCCAGGAGG + Intronic
1137672033 16:50284629-50284651 GCAGCAGGCCAGGGGTCAGGTGG + Intronic
1138228972 16:55324176-55324198 GGAGGAGAGCAGAGGCCCGGGGG - Exonic
1138454679 16:57114458-57114480 GCAGGAGACGGGAGAGCAGGTGG - Intronic
1138538038 16:57670122-57670144 ACTGGAGGTCAGAGGGCAGGAGG - Intronic
1138542878 16:57699065-57699087 GCTGGAGAGCAGAGGGCACAGGG + Intronic
1138584938 16:57963434-57963456 GCAGGACAGCAGGAGGCAGGAGG - Intronic
1138911068 16:61399478-61399500 GCAGGAGACAGAAAGGCAGGAGG - Intergenic
1139144590 16:64308335-64308357 GGAGGTGAGCAGAGGGCAGCAGG + Intergenic
1139476642 16:67206101-67206123 ACAGGAGGCCAGAAGTCAGGAGG - Intergenic
1140481366 16:75264679-75264701 GCAGATGACCAGAGGGAAGCTGG - Intronic
1141066175 16:80915864-80915886 GCAGGTGACCACAGGGTAGAAGG + Intergenic
1141097444 16:81172840-81172862 GCAGGGGACGAGATGGCAGGAGG + Intergenic
1141132138 16:81444360-81444382 GAAGGATACCCGAGGGCCGGGGG - Intergenic
1141168730 16:81677798-81677820 GCAGGAGAGCAGAGTCCTGGAGG + Intronic
1141620057 16:85232546-85232568 GCAGGAGACCAGGGCTCTGGAGG - Intergenic
1141699054 16:85634119-85634141 GGAGGAGCCCAGAGGTAAGGGGG + Exonic
1141746482 16:85929791-85929813 GCGGGAGACCAGAGGGAGGGAGG + Intergenic
1141762698 16:86039062-86039084 GCAGGAGCCTGGAGGGAAGGGGG + Intergenic
1141857608 16:86694526-86694548 GCAGGGGAGCAGCAGGCAGGAGG + Intergenic
1141997112 16:87642546-87642568 GCTGCAGACCAGAGGCCTGGAGG - Intronic
1142104376 16:88294481-88294503 CTGGGAGCCCAGAGGGCAGGAGG - Intergenic
1142191500 16:88720290-88720312 CCAGGAGAGCACAGGTCAGGGGG + Intronic
1142193338 16:88727883-88727905 GCAGGAGGCCAGAGAGCACGGGG + Intronic
1142252602 16:88999614-88999636 GGAGGAGGGCAGAGGGCGGGGGG + Intergenic
1142355509 16:89599757-89599779 GCAGGAGAAGAGAGGGTGGGAGG - Intergenic
1142711629 17:1726798-1726820 CCAGGAGACCACAGGCCGGGAGG + Exonic
1142980068 17:3666543-3666565 GCAGGTGTCCAGAAGGCAGATGG + Intronic
1143032257 17:3974290-3974312 GATGGAGGCAAGAGGGCAGGAGG - Intergenic
1143514134 17:7411053-7411075 GCTGGAGCCCAGAGGCCTGGGGG - Intronic
1143531483 17:7507239-7507261 GGAGGATACCTGAGGCCAGGAGG + Intronic
1143863673 17:9908875-9908897 GCTCCAGGCCAGAGGGCAGGAGG - Intergenic
1144021130 17:11240960-11240982 GGAGGAGAACCGCGGGCAGGCGG - Intergenic
1144771640 17:17762814-17762836 GCAGGAGTGCAGTGGGGAGGGGG - Intronic
1144827847 17:18116349-18116371 CCAGGAGCTCAGCGGGCAGGAGG + Intronic
1144879752 17:18425240-18425262 CTAGAAGACCAGAGGGGAGGAGG + Intergenic
1144965486 17:19074877-19074899 GCTGGAGAAGAGAGGGCAGGTGG - Intergenic
1144982481 17:19177306-19177328 GCTGGAGAAGAGAGGGCAGGTGG + Intergenic
1144985742 17:19200933-19200955 GCTGGAGAAGAGAGGGCAGGTGG - Intergenic
1145031411 17:19507646-19507668 GAGGAAGCCCAGAGGGCAGGGGG - Intronic
1145112015 17:20172207-20172229 GCAGGAGCCCTGAGGCCAGAAGG - Intronic
1145120506 17:20255311-20255333 GGAGGAGACCAGAGCACAGCAGG + Intronic
1145747063 17:27328245-27328267 GCAGCAGGGCAGGGGGCAGGTGG + Intergenic
1145764338 17:27448005-27448027 GCAGGAGAACTGAAGGCTGGAGG + Intergenic
1145969659 17:28949688-28949710 GCAGGAGCCCCGAGGGCAGCGGG + Intronic
1146054838 17:29575836-29575858 GCAGGACAGCAGCGGGGAGGAGG + Exonic
1146399045 17:32489182-32489204 GCAGCAGACAAGGGGGTAGGGGG - Exonic
1146589453 17:34116112-34116134 GCAGGAGACCAAAGGTCAAACGG - Intronic
1146940810 17:36843202-36843224 GCAGCAGTTCAGAGGGCTGGGGG + Intergenic
1147132143 17:38415777-38415799 GAAGGAGATGAGAGGGAAGGAGG - Intergenic
1147441912 17:40452698-40452720 GCAGCTGCCCAGATGGCAGGAGG - Intronic
1147484724 17:40801630-40801652 GCAGGAGACAGGAGGGAAGTGGG + Intergenic
1147768176 17:42850790-42850812 GCTGGGGGCCAGAGGGCAAGGGG + Intergenic
1147879304 17:43643634-43643656 CCAGGAGAACAGAGGGAAGCCGG - Exonic
1148129708 17:45255482-45255504 GCGGGAGATCTGAGGACAGGAGG + Exonic
1148336966 17:46848445-46848467 TCAGGAGCCCACAGGGCAGAGGG + Intronic
1148480246 17:47955409-47955431 GCAGGAGACCAGAGCACGAGGGG - Intronic
1148653748 17:49268099-49268121 GCAGGAGAGCAGGGGACAGCAGG - Intergenic
1148716607 17:49720285-49720307 GGAGGAGAACAGAGGGGAGAGGG + Intronic
1148760458 17:49997139-49997161 GCAGCAGAACAGAGGGCACCCGG - Intergenic
1148764065 17:50027366-50027388 GCGGCAGAACGGAGGGCAGGGGG - Intergenic
1148764507 17:50029265-50029287 GGAGGTGACCAGAGGGCAGAGGG - Intergenic
1148846189 17:50531574-50531596 GGAGGGGATCTGAGGGCAGGTGG - Intergenic
1149307480 17:55363140-55363162 GCAGGAAATCAAAGGGCAAGAGG - Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150573858 17:66412630-66412652 GAAGGACACCAGAAAGCAGGTGG - Intronic
1150718591 17:67594547-67594569 GCAGGAGGCCACAAGGCAGAGGG - Intronic
1150731464 17:67698722-67698744 GCAGGAGACTAACGAGCAGGGGG - Intergenic
1151405706 17:73884869-73884891 ACAGGAGACCAGAAGGCGGGAGG - Intergenic
1151416364 17:73968569-73968591 GCAGGAGCAGAGAGAGCAGGAGG + Intergenic
1151419983 17:73990856-73990878 GGAGGTGCCCAGGGGGCAGGTGG - Intergenic
1151436440 17:74100485-74100507 GCAGGAGCCCTGGGAGCAGGAGG + Intergenic
1151483327 17:74383266-74383288 GGAGGAGACCTGGGGGCAGAGGG + Intergenic
1151875954 17:76868468-76868490 GCCGGACACCAGAGCGCGGGCGG + Intronic
1151906935 17:77054852-77054874 GCTGGAGAGCAGAGGGGACGCGG + Intergenic
1152178044 17:78800671-78800693 GCACCAGACCCAAGGGCAGGAGG - Intronic
1152558231 17:81065246-81065268 GCAGGTGACCCGAGGGAGGGCGG + Intronic
1152577256 17:81148301-81148323 GACGGAGACCCCAGGGCAGGTGG - Intronic
1152590454 17:81209004-81209026 GCAGGAGGCCACAGGGCCTGGGG - Exonic
1152654756 17:81514460-81514482 GGAGGAGACCAGAGACCCGGAGG - Intronic
1152821629 17:82440520-82440542 GCTGACGGCCAGAGGGCAGGAGG - Intronic
1153095121 18:1392253-1392275 GCAGGAGATCAAAGGGCAGGAGG - Intergenic
1153625514 18:7019158-7019180 GCAGCAGACAAGGGGCCAGGAGG - Intronic
1153872013 18:9330440-9330462 GGAGGAGAGCAGAGGAGAGGAGG + Intergenic
1153914600 18:9734347-9734369 GCTGGAGTCCATAGGCCAGGAGG - Intronic
1154960908 18:21307738-21307760 GCAGGAGACTCGGGGGCGGGGGG + Intronic
1155517546 18:26638651-26638673 GCAGGGCAGCAAAGGGCAGGTGG + Intronic
1155907506 18:31469318-31469340 GCAGGAGACCAAGGAGCAGCAGG - Exonic
1155986816 18:32238797-32238819 GCGGGAGAACAGAGGACAAGAGG - Intronic
1156168888 18:34457852-34457874 GCAGGAGATCGGAGGGCGGTGGG - Intergenic
1156452986 18:37277116-37277138 CCAGCAGGGCAGAGGGCAGGAGG - Intronic
1156541243 18:37912988-37913010 GCAGGAGAAAAGAGTGAAGGGGG - Intergenic
1156721270 18:40072910-40072932 GCAGGAGACAAAAGGGCAAGAGG + Intergenic
1157680560 18:49602262-49602284 GCCAGAGACAGGAGGGCAGGAGG - Intergenic
1158321441 18:56268490-56268512 GCAGGAGATCAGAGGGTGAGAGG + Intergenic
1158395647 18:57076939-57076961 GCAAGAGACTTGAGGGCAGCAGG - Intergenic
1158412695 18:57221930-57221952 CCAGGAGATCAGAGGGTGGGAGG - Intergenic
1158963834 18:62607068-62607090 GCTTGAGACCAGATGGCTGGAGG + Intergenic
1160044122 18:75371056-75371078 GCAGGAGGTCAGAGAGGAGGGGG - Intergenic
1160227964 18:77025905-77025927 GCAGGGGAGCAGTGGGCAGCGGG + Intronic
1160320854 18:77893523-77893545 GAAGGAGAGCAGAAGCCAGGAGG - Intergenic
1160427549 18:78788345-78788367 GCAGCCGGCCAGAGAGCAGGAGG - Intergenic
1160495515 18:79372183-79372205 GCAGGGGACGAGGGGGCAGGAGG - Intronic
1160495524 18:79372205-79372227 GCAGGGGACGAGGGGGCAGGAGG - Intronic
1160495533 18:79372227-79372249 GCAGGGGACGAGGGGGCAGGAGG - Intronic
1160495542 18:79372249-79372271 GCAGGTGACGAGGGGGCAGGAGG - Intronic
1160586537 18:79916396-79916418 GCAGGTGAACAGAGGGCAAAAGG - Intronic
1160591551 18:79947634-79947656 GCAGGAGAGCAGAGGTGGGGCGG - Intronic
1160826126 19:1081365-1081387 AGAGGAGGCCACAGGGCAGGCGG + Intronic
1161026427 19:2039350-2039372 GAAGGTGAGCAGAGGGTAGGTGG - Exonic
1161085419 19:2332902-2332924 GCAGGGGAGCAGAAGGAAGGTGG + Intronic
1161326110 19:3665017-3665039 GCAGGGGTGCACAGGGCAGGGGG + Intronic
1161394779 19:4039058-4039080 GCAGGAGACCGGGGCGCAGGCGG + Exonic
1161580492 19:5078027-5078049 GGAGGAGACCTGAGGCCGGGGGG + Intronic
1161591619 19:5131594-5131616 GCAGGGGAGGAGGGGGCAGGTGG + Intronic
1161635043 19:5382944-5382966 GCTGGAGAGGAGAGGACAGGTGG - Intergenic
1161994813 19:7705690-7705712 GCAGGAACCCAGCAGGCAGGGGG - Intergenic
1162403083 19:10457710-10457732 TCAGGAAACCAGAGGGGATGTGG - Intronic
1162736037 19:12747672-12747694 GCAGGAGGCTAGAGGGCAGAGGG - Intronic
1162804265 19:13128903-13128925 GCAGGAGGCCACAGGGCAGCTGG - Intronic
1162854744 19:13459746-13459768 GCAGGAGACCAGGGAACCGGAGG - Intronic
1162856270 19:13470759-13470781 GCAAGAGATCAGAGAGGAGGGGG + Intronic
1163485047 19:17580529-17580551 GCAGGAGCCCAGGGGTCTGGCGG - Intronic
1163643889 19:18477387-18477409 ACTGGAGTCCTGAGGGCAGGCGG + Intronic
1164431868 19:28196006-28196028 AGAGGAGATCAGAGGGAAGGAGG - Intergenic
1165162235 19:33823582-33823604 TCAGGAGACTGGAGGGCAGAAGG + Intergenic
1165319709 19:35077615-35077637 TCAGGAAACCAGAGGGTGGGCGG - Intergenic
1165490924 19:36122170-36122192 GCAGGTGAGCAGAGCGCAGGAGG + Intronic
1165501725 19:36194776-36194798 GCTGGAGATCAGTGGACAGGAGG + Intronic
1165638234 19:37362136-37362158 GGAGAAAATCAGAGGGCAGGAGG - Exonic
1165932597 19:39369674-39369696 GCAGGAGTCCAAAGAGAAGGTGG + Exonic
1166110417 19:40619318-40619340 GCAGGAGACAACAGGGGAGAGGG - Intronic
1166128632 19:40731862-40731884 GCAGGTGAAAGGAGGGCAGGAGG + Intronic
1166416168 19:42596103-42596125 GAAGGACAGCAGGGGGCAGGTGG + Intronic
1166422579 19:42650422-42650444 GCAGGAGAGGAGAGGAGAGGAGG + Intronic
1166504213 19:43361423-43361445 GCTGGGGAGCAGAGGGAAGGTGG - Exonic
1166506246 19:43373335-43373357 GCTGGGGAGCAGAGGGAAGGTGG + Intergenic
1166656730 19:44617845-44617867 GCAGAAGAGGAGAGGGCAGCGGG - Intronic
1166804501 19:45477303-45477325 GCAGGAGACCAGGGAGGAAGTGG + Intronic
1166811403 19:45516563-45516585 TTAGCAGAGCAGAGGGCAGGAGG - Intronic
1167145026 19:47676258-47676280 CCTGGAGAGCAGAGGGCTGGGGG + Intronic
1167522126 19:49961226-49961248 GCAGCAGGGCAGAGGGCATGAGG + Intergenic
1167523255 19:49969499-49969521 GCAGCAGGGCAGAGGGCATGAGG - Intergenic
1167622173 19:50566515-50566537 GGAGGAGAGCAGAGGTGAGGAGG + Intronic
1167666042 19:50823292-50823314 GCAGGGAACTAGGGGGCAGGAGG + Intronic
1167791990 19:51688992-51689014 GCAGGAGAGAAGAGGGAGGGAGG + Intergenic
1168310979 19:55460822-55460844 GCAAAAGGCCAGAGAGCAGGAGG + Intronic
924976193 2:177907-177929 GCTGGAGAGCAGAGTGAAGGAGG + Intergenic
924976209 2:178021-178043 GCTGGAGAGCAGAGTGCAGAAGG + Intergenic
924976220 2:178078-178100 GCTAGAGAGCAGAGTGCAGGAGG + Intergenic
924991396 2:315809-315831 ACAGGGGACCAGAAGACAGGAGG - Intergenic
925131832 2:1499244-1499266 GCGGAAGGTCAGAGGGCAGGTGG - Intronic
925247706 2:2399137-2399159 GCTGGTGTCCACAGGGCAGGGGG + Intergenic
925303265 2:2831933-2831955 GGAGGAGCCCAGAGGGAGGGGGG + Intergenic
925329675 2:3048816-3048838 GCAGGAGGCCCCAGGGGAGGGGG + Intergenic
925799760 2:7586630-7586652 CCAGAAGACCAGAGGGGAGAAGG - Intergenic
925868125 2:8246579-8246601 GAGGGAGACCAGAGTGCAGTGGG - Intergenic
926010003 2:9400192-9400214 GCAGGAGGGGAGGGGGCAGGAGG - Intronic
926010011 2:9400207-9400229 GCAGGAGGGGAGGGGGCAGGAGG - Intronic
926010019 2:9400222-9400244 GCAGGAGGGGAGGGGGCAGGAGG - Intronic
926054865 2:9768561-9768583 GCAGGTGAGCAGAGCGCTGGAGG + Intergenic
926141502 2:10371074-10371096 AGAGGAGGCCAGTGGGCAGGTGG + Intronic
926206166 2:10835511-10835533 GCTGGAGGCCTGAAGGCAGGTGG + Intronic
926309354 2:11663378-11663400 GCAGGAGACCAGAGAGCTCCAGG + Intronic
926316831 2:11716061-11716083 GCAGGTGACCAGCTGGCAGTTGG + Intronic
926402020 2:12507021-12507043 CCAGGAGACCAGAGAACATGAGG + Intergenic
926439750 2:12875437-12875459 GCAGGAGAGTAGAGGGAGGGAGG + Intergenic
927103093 2:19802762-19802784 GCACTATAGCAGAGGGCAGGAGG + Intergenic
927496819 2:23556688-23556710 CCAGGAGACGGGAGGGGAGGAGG - Intronic
927517259 2:23679764-23679786 GGAGGAGGGCAGAGGGCAGAGGG + Intronic
927698072 2:25251267-25251289 GCAGGAGTGCAGAGGGAAAGGGG - Intronic
927711798 2:25330750-25330772 CCGGGAGAGCAGAGGGCATGGGG - Intronic
928022651 2:27716111-27716133 GAAGGAGGACTGAGGGCAGGGGG - Intergenic
928198846 2:29234066-29234088 GCATGAGCCCAGAGGGAAGTGGG + Intronic
928437835 2:31267172-31267194 CTAGGAGATCTGAGGGCAGGCGG + Exonic
929913632 2:46115235-46115257 GCAGAAGACCAGATGGCAAGAGG - Intronic
931418353 2:62102582-62102604 ACAGGAGAGCAGGGGGCAGAAGG - Intronic
931984773 2:67730863-67730885 GCAGGAGATTGAAGGGCAGGGGG - Intergenic
932409780 2:71538828-71538850 GGAGGAGGCCAGAGGCAAGGAGG - Intronic
932528236 2:72496617-72496639 GGAGGGGAACAGAGGGAAGGTGG + Intronic
933267684 2:80199920-80199942 CAGGGAGAGCAGAGGGCAGGAGG + Intronic
933311613 2:80668073-80668095 GTAGGAGATTAGAAGGCAGGAGG - Intergenic
933764366 2:85696951-85696973 GCAGCAGAGGAGAGGGAAGGAGG - Intronic
934067127 2:88350654-88350676 CCAGGAGACCACAGAGCAGAAGG + Intergenic
934161241 2:89251622-89251644 GCAGGTCACCTGAGGTCAGGAGG - Intergenic
934206037 2:89930807-89930829 GCAGGTCACCTGAGGTCAGGAGG + Intergenic
934554069 2:95278242-95278264 GTCTGAGCCCAGAGGGCAGGCGG + Intronic
935107182 2:100055407-100055429 GCTGGAGACCACTGGCCAGGAGG - Intronic
935206566 2:100901588-100901610 GCAGGAGATCAGAGGGTGGGTGG + Intronic
936017899 2:108973445-108973467 GCAGGAGAAATGAAGGCAGGAGG - Intronic
936089998 2:109495346-109495368 GCAGGCATCCAGTGGGCAGGAGG - Intronic
936344197 2:111662866-111662888 AAAGGAAACCAGAGGGCAGGAGG - Intergenic
936370449 2:111898505-111898527 GGAGGAGAGGAGCGGGCAGGGGG - Exonic
936545399 2:113388085-113388107 GCAGGAGACCGAAGGGCAAAAGG + Intergenic
937322065 2:120966821-120966843 GCAGGAGCACCGAGGGCAGGGGG - Intronic
937902672 2:127033771-127033793 GCAGGTGAGCAGATTGCAGGAGG - Intergenic
938152443 2:128899252-128899274 GCAGGAGACATGAGGGCTGGTGG - Intergenic
938245741 2:129776495-129776517 GCAGGAGACTGGAGGCCAGATGG - Intergenic
938341984 2:130541775-130541797 GGAGGAGAGCAGAGAGCAGGAGG + Intronic
938347848 2:130578936-130578958 GGAGGAGAGCAGAGAGCAGGAGG - Intronic
938664052 2:133515796-133515818 GCAGGACAAGACAGGGCAGGGGG - Intronic
938950526 2:136250457-136250479 GCAGGAGATCTGAGGGTGGGAGG + Intergenic
939148781 2:138448381-138448403 GCAGGAGATCAGAAGGTAGGAGG + Intergenic
939162653 2:138608069-138608091 GCAGGAGATTGGAGGGGAGGAGG - Intergenic
939281249 2:140068063-140068085 TCAGGAGACAACAGGGCAGGTGG - Intergenic
940774487 2:157872551-157872573 GCAGGAGAAAATAGGGGAGGAGG + Intronic
940807925 2:158208600-158208622 TCATGAGACCACAGGGGAGGAGG + Intronic
940886991 2:158998849-158998871 CCAAGAGATCAGAGGGGAGGGGG - Intronic
942204962 2:173610944-173610966 GCAGAAGAAGAGAGGGCAGCTGG - Intergenic
943106126 2:183546759-183546781 ACAGGAGCCCAGGGGGGAGGTGG + Intergenic
943157997 2:184209335-184209357 GAATGAGAACAGAGGGAAGGAGG - Intergenic
944107854 2:196098837-196098859 GCAGAAGAGAGGAGGGCAGGAGG - Intergenic
944770691 2:202911624-202911646 AGAGGAGACCGGAGGGCAGAAGG - Exonic
945251004 2:207766937-207766959 GCCGGAGAGCTGAGGGGAGGGGG - Exonic
946024917 2:216665897-216665919 GCAGCAACTCAGAGGGCAGGGGG - Intergenic
946130593 2:217603714-217603736 GCAGGAGATCAGAAGGTAGTAGG - Intronic
946280522 2:218662736-218662758 GCAGAAATCCAGAGGGCTGGTGG + Intronic
946301504 2:218827185-218827207 GCAGGTGATCAGAGGGCCTGAGG - Intronic
946427941 2:219609276-219609298 GCAGCAGGCCTGAGGGCCGGGGG + Intronic
946456782 2:219832936-219832958 GCAGGAGAAAAGGAGGCAGGAGG + Intergenic
946891394 2:224280791-224280813 GCTGGAGAGCAGAGAGCAAGAGG - Intergenic
947046245 2:225989964-225989986 TCAGGAGATCAGAGGGTAGCAGG - Intergenic
947254704 2:228148795-228148817 GCAAGAGAGGAGAGGGTAGGGGG + Intronic
947670653 2:231933600-231933622 GCAGCAGAGCAGTGGGCAGACGG + Intergenic
947735456 2:232452252-232452274 GCAGGGGAGCAGGGGGCAAGAGG - Intergenic
947856751 2:233329247-233329269 GGAGGAGGCCAGGGGTCAGGAGG - Intronic
947996191 2:234529759-234529781 GCAGGAGGACAGAGTGCAGAGGG + Intergenic
948293860 2:236846818-236846840 ACAGGAGGCCTGATGGCAGGAGG + Intergenic
948369959 2:237482603-237482625 GCTGGAGCCCAGAGAGCAAGCGG + Intergenic
948515188 2:238499080-238499102 GCAGGAGCCCAGAGCCCAGTGGG - Intergenic
948659881 2:239500497-239500519 TCAGGGCAACAGAGGGCAGGAGG + Intergenic
948684095 2:239659333-239659355 GAAGGAGAGCAGAGGAGAGGAGG - Intergenic
948808199 2:240461970-240461992 GCAGGGGCCCAGGTGGCAGGGGG - Intronic
948897538 2:240934303-240934325 GCCCCAGACCAGAGGGCGGGAGG - Intronic
1168880057 20:1198827-1198849 GGAGGTGCCCAGAGGGAAGGTGG - Intergenic
1168955023 20:1828685-1828707 CCAGGAGCCCAGAGGGAAGCTGG + Intergenic
1169039931 20:2484604-2484626 GGAGAAGGCCAGAAGGCAGGAGG + Exonic
1169074632 20:2752996-2753018 CCAGGACTCCAGAGGCCAGGTGG + Intronic
1169190983 20:3659299-3659321 GCAGGAAACCAGGGGGAAGATGG + Intronic
1169197891 20:3693176-3693198 GCAGGAGGCCAGTTTGCAGGTGG + Intronic
1170577555 20:17675840-17675862 GCAACAGACTAGAAGGCAGGGGG + Intronic
1170798337 20:19569626-19569648 ACAGGAGAGGGGAGGGCAGGAGG + Intronic
1170822667 20:19767521-19767543 CTGAGAGACCAGAGGGCAGGAGG + Intergenic
1171299279 20:24045553-24045575 GCAGGAGCTCAGAGGGCTGGAGG + Intergenic
1172026656 20:31953253-31953275 GCAGGAGGTCAGAGGGAAGGAGG + Intergenic
1172278430 20:33693972-33693994 CCAGGGGCCCAGTGGGCAGGAGG + Intergenic
1172480863 20:35270585-35270607 GCAGAGAGCCAGAGGGCAGGAGG + Intronic
1172884805 20:38223702-38223724 TCAGGAGCACAGAGGGGAGGTGG + Intronic
1172997708 20:39083390-39083412 GCAGGAGACCTGAAGGAGGGAGG - Intergenic
1173192580 20:40887545-40887567 GCAGGAGACCAGAGAGGAAGGGG - Intergenic
1173260734 20:41432592-41432614 GCAGGGGAACAGAGGTCGGGGGG - Intronic
1173311918 20:41904399-41904421 GCAGGAGATCAGAGGTTTGGAGG + Intergenic
1173337536 20:42124955-42124977 GCAGGAACTCAGAGGCCAGGAGG + Intronic
1173638965 20:44585776-44585798 GCAGGAGACTAGAGGGCACAGGG - Intronic
1173926242 20:46783513-46783535 GCAGAAGACCAGAAGACAGGTGG - Intergenic
1174096888 20:48096802-48096824 GCAGATGACCTGAGGTCAGGAGG + Intergenic
1174339832 20:49888768-49888790 GAGGGAGATCAGATGGCAGGAGG - Exonic
1174340356 20:49891430-49891452 GCAGGAGACTAAATGGAAGGGGG - Exonic
1174367879 20:50067395-50067417 GCAGTAGACCAGAGGGGCAGAGG - Intergenic
1174413862 20:50353911-50353933 GCGGGAGGCCAGAGGGGAGCAGG + Intergenic
1174436534 20:50510805-50510827 GCTGGAGAACAGAAGGGAGGTGG - Intronic
1174447838 20:50602362-50602384 GCAGGAGACCTGGGGGCAGGGGG + Exonic
1174985181 20:55443699-55443721 GCAGGAGATTTGAGGGGAGGAGG + Intergenic
1175160773 20:57005980-57006002 GCAGGAAAAGAGAGGGCTGGGGG - Intergenic
1175366891 20:58461766-58461788 GCAGGAGACCCAAGGCCCGGGGG - Intronic
1175491626 20:59384187-59384209 GGAGGAGATGAGTGGGCAGGAGG + Intergenic
1175625323 20:60484500-60484522 TCAGGAGAGCTGAGGGCTGGAGG + Intergenic
1175766843 20:61598176-61598198 TCAGCAGATCAGAGGGCAGTGGG - Intronic
1175911610 20:62407720-62407742 GAAGGAGGCCAGATGGCACGCGG - Intergenic
1176185207 20:63774646-63774668 GCGCGAGACCAGAAGGCAGCTGG + Intronic
1176292822 21:5055318-5055340 GGAGGGGACCCCAGGGCAGGTGG - Intergenic
1176342628 21:5713005-5713027 GCAGATGAGCAGAGGGTAGGAGG - Intergenic
1176474882 21:7145156-7145178 GCAGATGAGCAGAGGGTAGGAGG - Intergenic
1176502199 21:7611451-7611473 GCAGATGAGCAGAGGGTAGGAGG + Intergenic
1176536949 21:8111074-8111096 GCAGATGAGCAGAGGGTAGGAGG - Intergenic
1178765075 21:35442871-35442893 GGATGAGGCCAAAGGGCAGGGGG - Intronic
1179393768 21:41018449-41018471 GCAGAATACCAGAGGGAAGGAGG + Intergenic
1179461715 21:41539805-41539827 GACGGAGACCAGCAGGCAGGAGG + Intergenic
1179614795 21:42575475-42575497 GCAGGAGCCCAGAGAAAAGGGGG - Intronic
1179640975 21:42747051-42747073 GGATGAGACCAGAGCCCAGGAGG - Intronic
1179864438 21:44208332-44208354 GGAGGGGACCCCAGGGCAGGTGG + Intergenic
1179919053 21:44497452-44497474 GGAGGAGAGGAGAGGGCAGGGGG - Intergenic
1179980169 21:44891524-44891546 GCAGGGGACTTGTGGGCAGGAGG - Intronic
1180657819 22:17438534-17438556 GCAGGCGGCCTGCGGGCAGGTGG - Intronic
1180910532 22:19447163-19447185 GGAGGAGACCAGCGAGGAGGGGG - Intronic
1181000500 22:19985842-19985864 CCAGGCTCCCAGAGGGCAGGAGG + Intronic
1181257097 22:21569679-21569701 GTGGGAAACCAAAGGGCAGGAGG - Intronic
1181327404 22:22060698-22060720 GCCTGTGACCAGAGGCCAGGTGG - Intergenic
1181403491 22:22665879-22665901 TCAGGAGAACAGAGAGCAGTGGG - Intergenic
1181405805 22:22684309-22684331 TCAGGAGAACAGAGAGCAGTGGG - Intergenic
1181413820 22:22745362-22745384 TCAGGAGAACAGAGAGCAGTGGG - Intronic
1181848910 22:25735783-25735805 TCAGGATAACAGAGGGCAAGAGG + Intergenic
1181891356 22:26066484-26066506 ACAGGAGACCAAAAGGCAAGAGG + Intergenic
1181928563 22:26380262-26380284 GCAGGAAACCAGAGAGTATGAGG + Exonic
1182023668 22:27101041-27101063 GGAGGAGGCGCGAGGGCAGGCGG + Intergenic
1182095871 22:27625300-27625322 GCAGGAGACGAGGGACCAGGAGG + Intergenic
1182240387 22:28911370-28911392 GCTGGAGGACACAGGGCAGGCGG - Intronic
1182585382 22:31341736-31341758 GGAGGAGCCCAGAGGGCAGTGGG - Intronic
1182585591 22:31342739-31342761 GGAGGAGAGCAGAGGGAGGGTGG + Intronic
1182787642 22:32920827-32920849 GCAGGAGACTGGAAGGCAGAGGG + Intronic
1182897938 22:33874036-33874058 GCAGGAGAATAGAGGACAGGAGG - Intronic
1183578321 22:38706377-38706399 GCGGGAGACGGGAGGGCGGGAGG - Intronic
1183676397 22:39301228-39301250 GCAGGAGGCCAGAGGGGATTGGG + Intergenic
1183710754 22:39502067-39502089 GCAGAAGTTCAGAGGGCAGGAGG - Intronic
1183725170 22:39584549-39584571 ATGGGAGACCAGAGGGCTGGGGG + Intronic
1183902662 22:41018248-41018270 ACCAGAGACCAGCGGGCAGGTGG - Intergenic
1183928217 22:41220980-41221002 GCAGGAAGCCAGGGGGCAAGTGG - Intronic
1183987880 22:41579283-41579305 GCAGGAGACCTGTGAGGAGGTGG + Intronic
1184172763 22:42769384-42769406 GCAGGAGACCCCGTGGCAGGAGG + Intergenic
1184259292 22:43305531-43305553 GCAGAGGCCCAGAGGGCATGAGG + Intronic
1184767447 22:46578973-46578995 GCAGCAGAGCAGAGGGCTGGTGG - Intronic
1184925448 22:47633247-47633269 GGAGGAGACATGGGGGCAGGGGG + Intergenic
1185027751 22:48425285-48425307 GCAGGAGAGCAGAGGACGTGGGG + Intergenic
1185110206 22:48896404-48896426 GGTGGAGAGCAGAGGGCATGAGG + Intergenic
1185116004 22:48938627-48938649 GCAGGAGAAGTGAGGGAAGGAGG - Intergenic
1185280059 22:49966169-49966191 GCAGGAGCCCAGACAGCTGGGGG - Intergenic
1185418282 22:50721487-50721509 GCAGGAGCCCAGCAGGCTGGGGG + Intergenic
1203241899 22_KI270733v1_random:27478-27500 GCAGATGAGCAGAGGGTAGGAGG - Intergenic
949230737 3:1746919-1746941 GTAGGAGAGCAGGGGACAGGGGG + Intergenic
949518504 3:4828506-4828528 TGAGGAAACCAGAGGACAGGAGG - Intronic
949758247 3:7438688-7438710 GCAGAAGACTGAAGGGCAGGAGG - Intronic
949809548 3:7991565-7991587 GCAGGAGACCAGAGGGGTGGAGG + Intergenic
949828202 3:8185270-8185292 TCAGGAGACCAGAGGGCAGGAGG + Intergenic
950121518 3:10485109-10485131 GCAGGGGACAAGAGGTGAGGGGG + Intronic
950189251 3:10965312-10965334 GCAGGGGACCGGAGAGCAGGAGG + Intergenic
950212335 3:11133105-11133127 GGAGGGGGCCAGAGGTCAGGGGG + Intergenic
950442198 3:13016554-13016576 GCAGGAGTCGAGAGGGCGGGAGG - Intronic
950574514 3:13823807-13823829 GCAGGAAATCGGAGGGCAGGAGG + Intronic
950700906 3:14745308-14745330 GCAGGAGATCAGAGGGAAAGAGG - Intronic
951366467 3:21788925-21788947 GCAGGAGGTCAGAGAGCATGAGG + Intronic
951948688 3:28173226-28173248 GCAGAAAATCAGAGGGCAGGAGG - Intergenic
952314686 3:32222361-32222383 GCAGTAGGCAAGGGGGCAGGAGG - Intergenic
952382854 3:32818037-32818059 GGAGGAGACCAGAGAGGAAGAGG - Exonic
952655266 3:35778368-35778390 GCAAGAGATCAAAGGGCAGAGGG + Intronic
952849679 3:37717572-37717594 GCAGGAGAGAAGGGGGCTGGTGG + Intronic
952907438 3:38151331-38151353 ACAGGAAACCAGTGGGCAAGGGG - Intergenic
953017115 3:39088138-39088160 GCAGGAGAACCGAGTGCAGAAGG + Exonic
953246754 3:41199937-41199959 ACAGGAGCCCGGATGGCAGGCGG + Intronic
953759164 3:45673332-45673354 GGAGGAGAGCAAGGGGCAGGAGG + Intronic
954126672 3:48535255-48535277 GCAGGAGGCCACAGGGAGGGAGG + Intronic
955771127 3:62385686-62385708 CCAGGAGTCCACAGGCCAGGGGG - Intergenic
956260057 3:67329484-67329506 ACAGGAGATCAGAGGGCGGCAGG + Intergenic
957199839 3:77119100-77119122 GCAGGAGAAGAGAGAGCAAGGGG - Intronic
959742966 3:109742274-109742296 GCAAGAAACCAGACGGCAGCTGG - Intergenic
959902331 3:111674718-111674740 TCAGGAAGCCACAGGGCAGGGGG + Intronic
959983781 3:112549582-112549604 GCAGGTCACCTGAGGTCAGGAGG + Intronic
960674417 3:120180822-120180844 GCAGCAGACCAGAGGGTGGATGG + Intronic
961168426 3:124779428-124779450 GCCTGAGACCACAGGGTAGGGGG - Intronic
961509436 3:127391965-127391987 GCTGGAGGGCAGAGGGCGGGCGG + Intergenic
961556044 3:127697214-127697236 CCAGGAGCCCTGAGGGAAGGAGG + Intronic
961816047 3:129550943-129550965 CCAGGGGACCAGAGAGAAGGTGG - Intronic
961819302 3:129567097-129567119 GCAGGAGTCCAGTGGACAGGAGG + Intronic
961945478 3:130682528-130682550 GCAGGAGATCAAAGGGAGGGAGG + Intronic
962043559 3:131732487-131732509 GTAGGAGACTAGAAGACAGGAGG + Intronic
962740919 3:138362087-138362109 GTAGGACCCCAGAGGCCAGGTGG + Intronic
963265191 3:143233172-143233194 GGAGGAGTCCAGATGGCAGTTGG - Intergenic
963549514 3:146702424-146702446 GAAGGAGGCCACAGAGCAGGAGG + Intergenic
964145045 3:153449894-153449916 GCAGGTCACCTGAGGTCAGGAGG - Intergenic
964304719 3:155327584-155327606 GCAGGGGACCAGGGAGCAGGAGG - Intergenic
964621521 3:158724094-158724116 GCTAGAGAGGAGAGGGCAGGTGG + Intronic
964675024 3:159268238-159268260 GCAGAACACCTGAGGTCAGGAGG + Intronic
964833091 3:160907891-160907913 GCAAGAGATCAGAGGGTAAGAGG - Intronic
966532088 3:180992464-180992486 TCAGGAGATCAGAAGGCAGGAGG + Intergenic
966642966 3:182210748-182210770 GCAGGAGTTCAGAGGGCAGGAGG + Intergenic
966954697 3:184863583-184863605 GCAGGAGCCTAGAGAGAAGGAGG + Intronic
967109951 3:186284325-186284347 GCAGGAGTCCTGAGGCCAAGAGG - Intronic
967153072 3:186667405-186667427 GTAGGAGAACAAAGGGCAGAAGG + Intronic
967813922 3:193783149-193783171 CCGGGAGACCAGAGGGCTCGAGG - Intergenic
967946486 3:194807994-194808016 GCAGGAGACCCGGGAGCAGAAGG + Intergenic
967980646 3:195063135-195063157 GCTGGAGACAGGAGGGCAGCCGG + Intergenic
968029927 3:195474911-195474933 GGAGGAGAGGAGAGGGGAGGAGG + Intergenic
968035404 3:195543859-195543881 GCAGGAGACGGGAGGGCGGCAGG + Intergenic
968054977 3:195684305-195684327 GCAGGGGAGCAGAGGGGATGTGG + Intergenic
968100936 3:195964971-195964993 GCAGGGGAGCAGAGGGGATGAGG - Intergenic
968423879 4:508179-508201 GCAGAAACTCAGAGGGCAGGAGG + Intronic
968434052 4:576003-576025 GCAGGCGAGCAGGAGGCAGGAGG + Intergenic
968465771 4:749898-749920 GCAGGAGCCCAGGAGGCAGAGGG - Intronic
968492425 4:897206-897228 ACAGGAGAGCAGGGGGCAAGTGG + Intronic
968535459 4:1125000-1125022 GCAAAAGTCCTGAGGGCAGGAGG + Intergenic
969315568 4:6379753-6379775 GGAGGAGCCCAGAGTGCAGAGGG - Intronic
969352120 4:6603992-6604014 GGAGGTGAGCAGAGGCCAGGAGG + Intronic
969405603 4:6989510-6989532 GCAGGATGCCTGAGGCCAGGGGG - Intronic
969447497 4:7253552-7253574 GGAGGTGTCCAGGGGGCAGGTGG + Intronic
969627553 4:8315402-8315424 GCAACAGGCCAGAGGGGAGGAGG - Intergenic
970655704 4:18228270-18228292 GCTGGAGGCCAGTGGGCAGAGGG + Intergenic
971053284 4:22885271-22885293 GCAAGAGAATAGAGAGCAGGAGG - Intergenic
971142258 4:23937028-23937050 GAAGAAGACCAGAGACCAGGAGG + Intergenic
971309741 4:25515051-25515073 GGAGGAGAGCAGAGGGAAGCGGG + Intergenic
972174429 4:36386142-36386164 GCAGGAGATCAAAAGGCAGAAGG - Intergenic
972340442 4:38148375-38148397 ATAGCAGTCCAGAGGGCAGGTGG + Intergenic
972563710 4:40250907-40250929 GCAGGAAATCAGAGGGTAGCAGG + Intergenic
972577378 4:40364346-40364368 GGAGGAGACTGGAGGGAAGGAGG - Intergenic
975811616 4:78175784-78175806 GCAGAAGATCAGAGGGAGGGTGG - Intronic
977354984 4:95934084-95934106 GCAGGAGGGCAGAGGGCAAAAGG + Intergenic
977709986 4:100113901-100113923 GCAGGAGACAGGAGGGCAGGAGG - Intergenic
979205639 4:118033864-118033886 GCCGAAGACCCGAGGGAAGGAGG + Intronic
979351445 4:119648575-119648597 GCAGAAGATCAGAGGACAAGAGG - Intergenic
979831743 4:125314233-125314255 CCAGGTGACTAGGGGGCAGGAGG - Intergenic
980486390 4:133462423-133462445 ACAGGAAACCAGAGGGCATGGGG - Intergenic
981315041 4:143333805-143333827 GCAGGTCACCTGAGGCCAGGAGG - Intergenic
981413412 4:144459240-144459262 GCAGGAGACAAGTGAGAAGGAGG + Intergenic
982053937 4:151528960-151528982 GGAAGCAACCAGAGGGCAGGTGG - Intronic
982134018 4:152256808-152256830 GCAGGAGACCCGCAGGGAGGCGG - Intergenic
983028049 4:162761315-162761337 AAAGGAGACCAGATGACAGGGGG + Intergenic
984140830 4:176002148-176002170 TCCGGAGACAAGAGGGCGGGGGG + Intronic
984156664 4:176202976-176202998 CCAGGAAAGCAGAGGGCACGTGG + Intergenic
984709097 4:182869976-182869998 CCAGGAAGCCAGAGGGCACGGGG + Intergenic
984883324 4:184429177-184429199 GCTGGGGACCAGGGGGCTGGGGG + Intronic
985471261 5:48327-48349 GCTGGAGAGCAGAGTGCAGGAGG + Intergenic
985471279 5:48442-48464 GCTGGAGAGCAGGGTGCAGGAGG + Intergenic
985471301 5:48556-48578 GCTGGAGAGCAGAGTCCAGGAGG + Intergenic
985652202 5:1112360-1112382 GAAGGGGACAAGAGGGGAGGCGG - Intergenic
985669869 5:1201710-1201732 GCTGGAGACCATCGAGCAGGAGG + Exonic
985812893 5:2103271-2103293 GCAGGAGAGCAGGGGGGTGGCGG - Intergenic
985860426 5:2466319-2466341 GCAGGAGGCCACAGAGAAGGCGG - Intergenic
986075312 5:4330827-4330849 GGAGTAGAGCAGAGGGCAGAGGG + Intergenic
986288401 5:6378228-6378250 GGACCAGACCAGAGGGCTGGCGG + Intronic
987021079 5:13872147-13872169 GGAGGAGATCTGAGGGGAGGGGG - Intronic
987373812 5:17217174-17217196 GGAGGAGAGGAGAGGGGAGGCGG + Intronic
988781017 5:34521906-34521928 TCAGGAGAATGGAGGGCAGGAGG - Intergenic
989365497 5:40651383-40651405 TCAGGTGAAAAGAGGGCAGGAGG - Intergenic
990316624 5:54589149-54589171 GAAGGTGACCGCAGGGCAGGGGG - Intergenic
990601633 5:57364702-57364724 GCAGCAGGCCAGAGGGTGGGTGG + Intergenic
991994698 5:72375686-72375708 GCAGGAGAACTGAGGACAGGAGG - Intergenic
992385931 5:76284696-76284718 GCAAGAGAACAGAGTGAAGGAGG - Intronic
992579053 5:78151987-78152009 GCAGGAGAAGGGAGGGAAGGGGG - Intronic
992623449 5:78616042-78616064 GGAGAAGAACAGAGGGCAGAAGG - Intronic
992626316 5:78638619-78638641 GCAGGCGGCCGGAGGGCAGAGGG - Intronic
993109057 5:83632973-83632995 ACAGGAGACAGGAGGGCAGGAGG - Intergenic
994076680 5:95659728-95659750 GCAGGAGGCAGGAGGGCAAGAGG - Intronic
994276876 5:97849367-97849389 ACAGGAGACCTGAAGGCAGGTGG + Intergenic
995156186 5:108915976-108915998 GCAGGAGAGAAGAGGGAAGTGGG - Intronic
995934017 5:117486444-117486466 GCAAGAAATCAGAGGGCAGGAGG + Intergenic
997416115 5:133730014-133730036 GCAGTCTACCAGATGGCAGGTGG - Intergenic
997621899 5:135304564-135304586 GCAGGAGAAGCGCGGGCAGGCGG + Intronic
997676224 5:135715068-135715090 GCAGGAGACAGGAGGCCTGGAGG + Intergenic
997697671 5:135874244-135874266 TCAGGAGACCAGGGGGCTGCTGG + Intronic
997745684 5:136298334-136298356 GCTGGAGATCAGTGAGCAGGAGG + Intronic
997796620 5:136817235-136817257 GCAGGAGACCAGATGACAAAAGG - Intergenic
997997206 5:138596449-138596471 CCAGGAAACCAGGGGGCAAGTGG + Intergenic
998446551 5:142203288-142203310 GAAGGAGGACACAGGGCAGGTGG + Intergenic
998453144 5:142250094-142250116 GCAGGAGAAGAAGGGGCAGGAGG - Intergenic
998601831 5:143592602-143592624 ACAGGAGCCCAGTGGGCTGGTGG - Intergenic
999246093 5:150155566-150155588 TCAGGAGAACAGAGGGATGGAGG + Exonic
999265804 5:150266137-150266159 ACAGCAGTCCAGAAGGCAGGAGG - Intronic
999272156 5:150302834-150302856 GCAGGACCCCAGAGGGGAAGGGG + Exonic
999466412 5:151810300-151810322 GCAAGAGATCAGAGGAAAGGGGG - Exonic
999809607 5:155115083-155115105 ACAGGAGCCCAGAGTGGAGGAGG - Intergenic
1000334161 5:160229524-160229546 GCTGGAGGCCAGAGAGCAGAGGG - Exonic
1000736656 5:164910895-164910917 GCATGAGAAAAGATGGCAGGAGG + Intergenic
1000903321 5:166934782-166934804 GAAGCAGCCCAGAGGGAAGGTGG + Intergenic
1001137248 5:169112744-169112766 GCAGGAGATCAGAGGGCAAGAGG + Intronic
1001314558 5:170633079-170633101 GGGGGAGAGCAGAGGGAAGGGGG + Intronic
1001423039 5:171601300-171601322 GCAGGAGACAAGAGGGGTTGAGG - Intergenic
1001429408 5:171647533-171647555 GCAGGAGACTGGATAGCAGGAGG - Intergenic
1001933888 5:175691273-175691295 GAAGGAGAGCAGAGAGGAGGTGG + Intergenic
1002401492 5:178993838-178993860 GCAGGAGACCAGAGCTCAGAAGG + Intronic
1002596796 5:180328960-180328982 GCTGAGGCCCAGAGGGCAGGTGG - Intronic
1002644816 5:180647969-180647991 GGAGGGGCCCAGAGGGCAAGGGG - Intronic
1002784621 6:392035-392057 GCAGGAGCGCGGAGGGCAGGCGG - Intronic
1002928918 6:1620330-1620352 GGAGGAGCCCCGACGGCAGGTGG - Intergenic
1003019164 6:2495436-2495458 GCAGCCAACCAGAGGGCAGCAGG - Intergenic
1003556723 6:7146370-7146392 GCAGGAGATGGGAGGGGAGGAGG + Intronic
1003708233 6:8559481-8559503 GCAGAATATCAGAGGGAAGGAGG - Intergenic
1004275625 6:14233000-14233022 GCAGGAGATAAGAGGGTGGGAGG + Intergenic
1004403959 6:15314199-15314221 GCAGGAGACCACAGGAGTGGGGG - Intronic
1005372685 6:25152528-25152550 GCATGAGACTGAAGGGCAGGCGG - Intergenic
1005479791 6:26244756-26244778 GCAGGAGACTGGAGGAAAGGAGG + Intergenic
1005995022 6:30925716-30925738 GCAGGTGACCAGAGGGGATGGGG + Exonic
1006405736 6:33843709-33843731 GCAGGAGATCAGAGGGTAGGGGG + Intergenic
1006410349 6:33870109-33870131 GAGAGAGAACAGAGGGCAGGTGG + Intergenic
1006921935 6:37633031-37633053 GCAGGCAACAAGAGGGCAAGGGG + Exonic
1007085299 6:39140134-39140156 GCAGGAAATCAGAGGGGAGAAGG + Intergenic
1007150731 6:39688231-39688253 CTGGGAGGCCAGAGGGCAGGAGG + Intronic
1007182212 6:39937531-39937553 GCAGGAGATCAGAGAGCAGGAGG + Intergenic
1007414153 6:41682439-41682461 GCAGGAAAGCAGCAGGCAGGTGG + Intergenic
1007636954 6:43305429-43305451 GCATGAGACCAGTGGGTTGGAGG - Exonic
1007679207 6:43622804-43622826 ACTGCAGCCCAGAGGGCAGGTGG + Exonic
1007702162 6:43771697-43771719 GCCAGAGACCAGTGGGCAGGGGG + Intronic
1008010795 6:46465706-46465728 GCTGGAAACCAGAGGGCCAGGGG + Intronic
1008933773 6:56967458-56967480 GCATGAGATCAGAGGGAGGGAGG - Intronic
1009461589 6:63920347-63920369 GCAAGAGACCAGAGGGTAGGAGG + Intronic
1010249185 6:73691068-73691090 GCAGGAAAGCAGAGAGCAGGTGG - Intergenic
1010487716 6:76435321-76435343 GCAGGAGATAAGAGAGCAAGAGG - Intergenic
1010504571 6:76641462-76641484 GCAGGAGATAAGAGGACAGGAGG - Intergenic
1010514355 6:76754732-76754754 GCAGGTCACCTGAGGTCAGGAGG + Intergenic
1011129468 6:84038364-84038386 GCAGGAGACCAGCATGCAGCAGG + Intronic
1011195982 6:84779722-84779744 GCAGGAGAACCCAGAGCAGGAGG - Intergenic
1011256066 6:85422338-85422360 CCAGGAAACCAGAGGAAAGGAGG - Intergenic
1011518604 6:88179909-88179931 GCAGGTGATCAGAGGGCAGGAGG - Intergenic
1011661903 6:89602095-89602117 GCACGAGACAAGGGGTCAGGAGG - Intronic
1012744635 6:103069970-103069992 GCTTGAGGCAAGAGGGCAGGAGG - Intergenic
1012896588 6:104956243-104956265 GCTGGAGGACATAGGGCAGGAGG - Intergenic
1013538759 6:111087582-111087604 GCAGGCGGCCAGCGCGCAGGCGG - Exonic
1013860124 6:114625655-114625677 GAAGGTGACCAGATGGCTGGAGG - Intergenic
1013967129 6:115968294-115968316 AACGGAGACCATAGGGCAGGTGG - Intronic
1015910303 6:138162351-138162373 GAAAGAGACCGGAGGGGAGGCGG - Intronic
1016559935 6:145384586-145384608 GCAGGCTACCTCAGGGCAGGTGG + Intergenic
1016825900 6:148388250-148388272 GCAGCACAGCAGAGGCCAGGAGG + Intronic
1016919976 6:149283146-149283168 GCGGGAGAGCAGAGGGGAGCTGG - Intronic
1017242215 6:152183139-152183161 GCAGAAGATCAGAGTGCACGCGG - Intronic
1017306217 6:152921739-152921761 ACAGGAGATCAGAGGGTGGGAGG - Intergenic
1018199676 6:161383503-161383525 GCAAGAGATCGGATGGCAGGAGG + Intronic
1018978339 6:168582556-168582578 GCAGGAAACCAGACAGCTGGAGG + Intronic
1019194048 6:170271095-170271117 GCAGATGGCCAGGGGGCAGGCGG + Intergenic
1019315134 7:380668-380690 GCAGGAGGACAGAGGGAGGGAGG + Intergenic
1019521644 7:1463395-1463417 GGAGGAGACAGGAGGGGAGGAGG + Intergenic
1019557750 7:1641103-1641125 GAGGGGGACCAGTGGGCAGGTGG - Intergenic
1019564253 7:1671714-1671736 GCAGGGACCCAGGGGGCAGGAGG - Intergenic
1019640202 7:2099261-2099283 GCCGGAGTGCACAGGGCAGGCGG - Intronic
1019660172 7:2219697-2219719 GCAGGGGAGCAGAGGGCCAGGGG + Intronic
1019664792 7:2246434-2246456 GCAGAAGCACAGAGGGCTGGAGG + Intronic
1019812442 7:3174683-3174705 CCAGCAGGCCAGAGGGAAGGTGG - Intergenic
1020163954 7:5793774-5793796 GCAGGAGCCCACAGTGCCGGTGG - Intergenic
1021433031 7:20583142-20583164 GCAGTAGACAAGAGGGCTGCTGG + Intergenic
1021444690 7:20719701-20719723 GCAGGAGACATGAGAGCAGATGG + Intronic
1022170040 7:27817968-27817990 ACAGGAGGCCAAAAGGCAGGAGG - Intronic
1022793706 7:33714848-33714870 GCAGGAGAACAAGGGTCAGGAGG - Intergenic
1023414414 7:39918703-39918725 GAAGGAGACCAGAGAGAGGGGGG - Intergenic
1023515600 7:40998140-40998162 GCAGAACACCTGAGGCCAGGAGG + Intergenic
1024219170 7:47274259-47274281 GGAGCAGAAGAGAGGGCAGGTGG - Intergenic
1024252183 7:47514530-47514552 AAAGGAGACCAGAGGGAAAGTGG - Intronic
1025256675 7:57388660-57388682 GCAGGAGGCCAGAGGGGAGCAGG - Intergenic
1025959062 7:66205006-66205028 GCAGGGGAGCCGCGGGCAGGTGG - Intergenic
1026111919 7:67465283-67465305 GCAGAAGACCATGGGGTAGGTGG - Intergenic
1026877268 7:73886846-73886868 TCCGGAGACCAGAGGGCACCTGG + Intergenic
1026987985 7:74566896-74566918 GGATGAGACCAGAGGGGTGGTGG - Intronic
1027357713 7:77375469-77375491 GAAGGAGAGCAGAGGGCAGGAGG + Intronic
1027817853 7:83000657-83000679 GCAGCAGACCAGTGAGCAAGTGG - Intronic
1028018047 7:85739477-85739499 GAAGGAGAAGAGAGGGAAGGGGG + Intergenic
1028795284 7:94895378-94895400 GCAGGAGACAAGAGAACAGCTGG + Intergenic
1029356849 7:100058404-100058426 GCAGGAGATTTAAGGGCAGGAGG - Intronic
1029416511 7:100446500-100446522 GCAGGAGGAGAGAGGTCAGGTGG + Intergenic
1029435666 7:100562709-100562731 GGAGGGGACCTGAGGCCAGGAGG + Intronic
1029503685 7:100949606-100949628 GCATGGGCCCAGCGGGCAGGGGG - Exonic
1029542339 7:101191243-101191265 GCAGGAGAGAGGAGGCCAGGAGG + Intergenic
1029633459 7:101768022-101768044 AGAGTAGAACAGAGGGCAGGAGG - Intergenic
1031144090 7:117978738-117978760 GCAGGAGGCTAGAGGACAGAAGG + Intergenic
1031309479 7:120177668-120177690 GGAGGTGGCCAGAGGGCTGGAGG - Intergenic
1031469081 7:122147522-122147544 GCAGGAGATGAAGGGGCAGGAGG - Intergenic
1031734451 7:125340239-125340261 GCAGGAGAACAGAGGGAACCCGG + Intergenic
1031979569 7:128116000-128116022 GCAGGAGTCCAGGGAGCTGGGGG - Intergenic
1032003615 7:128282737-128282759 GTTTGAGACCAGAAGGCAGGGGG + Intergenic
1032056961 7:128691338-128691360 GCAGGAGATCAGAGAGGATGAGG + Intergenic
1032092897 7:128920532-128920554 GCAGGGGATGAGGGGGCAGGAGG + Intergenic
1032575177 7:133045886-133045908 GCAGGAGATGAAAGGGAAGGGGG - Intronic
1032845162 7:135745777-135745799 GCTGGGGGCCAAAGGGCAGGGGG + Intronic
1033568610 7:142604739-142604761 GCAGGAGACTAGAGAGAAGAGGG - Intergenic
1034326978 7:150245465-150245487 GCTGGAGAACAGAAGGCCGGAGG + Intronic
1034412335 7:150947911-150947933 GGAGGAGAACAGAGAGGAGGGGG + Intronic
1034449635 7:151130345-151130367 GCTGGAGAGCAGAGCTCAGGGGG + Intronic
1034700844 7:153094489-153094511 CTAGGACACCAGAGGGCTGGAGG - Intergenic
1034766230 7:153723986-153724008 GCTGGAGAACAGAAGGCTGGAGG - Intergenic
1035088160 7:156279130-156279152 GCAGGAGATCAGAGGGCAAGAGG - Intergenic
1035391607 7:158508178-158508200 GCAGGAGACCACAGGCATGGAGG + Intronic
1035613935 8:988713-988735 GCCAGGAACCAGAGGGCAGGTGG - Intergenic
1035741108 8:1929518-1929540 GCAGGAGGCCGGTGGGGAGGTGG - Intronic
1036612567 8:10362857-10362879 GCAGGAGAGCTGGGGCCAGGAGG - Intronic
1036635758 8:10548627-10548649 GCAGGAGACTTGCAGGCAGGGGG - Intronic
1036761021 8:11508617-11508639 CCAGGAGACCCGAAGGCAGAGGG - Intronic
1037573534 8:20179379-20179401 GCAGGAGAGGCGAGGGCATGTGG + Exonic
1037664357 8:20955376-20955398 GCAGGAAACTGCAGGGCAGGAGG + Intergenic
1037749108 8:21668459-21668481 GAATGAGACCGGAAGGCAGGAGG - Intergenic
1037794285 8:21978841-21978863 GCAGGAGATTAGAGGGCAGAGGG - Intronic
1038730963 8:30127374-30127396 GTGGGAGGCCAGAGGTCAGGAGG + Intronic
1039350511 8:36759026-36759048 GAAGGGGACAAGAGTGCAGGTGG - Intergenic
1039396013 8:37225818-37225840 GCAGGAGATGAGGGGGCAGGGGG - Intergenic
1039481215 8:37874838-37874860 GCAAGAAGCCAGAGAGCAGGAGG - Exonic
1039498663 8:38000154-38000176 GCGGGATATCTGAGGGCAGGAGG + Intergenic
1039797033 8:40924517-40924539 GGAGCAGAACAGAGGGCAGGTGG + Intergenic
1040383942 8:46900666-46900688 GGAGGAGACCAGGAGGAAGGTGG + Intergenic
1040983384 8:53268348-53268370 GCTGGAGACCAGAGGGCCCTTGG + Intergenic
1041044915 8:53880184-53880206 GGAGTAGACCAGGGGGCAGCGGG - Intronic
1041108696 8:54466395-54466417 GCCCGGGACCCGAGGGCAGGAGG - Intergenic
1041939107 8:63367180-63367202 GAAGAAGACAAGAGGGCAGGTGG + Intergenic
1041952343 8:63517630-63517652 GTAGGAGGTGAGAGGGCAGGGGG + Intergenic
1042213502 8:66405093-66405115 GCAGGAGTCCAGAGAGGAGCCGG - Intergenic
1044117730 8:88354982-88355004 GCAGAAGACAAAAGGGGAGGAGG + Intergenic
1044629708 8:94266527-94266549 GCAGCAAAACCGAGGGCAGGTGG - Intergenic
1044653253 8:94521197-94521219 GAAGGAGAACAGAGGGTTGGGGG - Intronic
1045413623 8:101944649-101944671 GCAGGAGATGAAAGAGCAGGAGG + Intronic
1045430952 8:102114687-102114709 GCAGGAGACGGGAGGGTGGGAGG - Intronic
1045651571 8:104346353-104346375 GCAGGAGGACTGCGGGCAGGTGG - Intronic
1047011026 8:120672908-120672930 GAAGGAGACTGGAGGGCAGGAGG + Intronic
1047243948 8:123121586-123121608 GAACGAGAGCACAGGGCAGGTGG - Intronic
1047523661 8:125614936-125614958 GCAGGAGACCAAAGGGCAAAGGG + Intergenic
1047902869 8:129442874-129442896 GCAGGAGATCAGAGGAAGGGAGG - Intergenic
1048361780 8:133703643-133703665 GCAGGAAACCAGTGGCCAGGTGG - Intergenic
1048380371 8:133860204-133860226 AGAGGAGACCAGAGCGGAGGTGG + Intergenic
1049178309 8:141207115-141207137 CCAGGAAGGCAGAGGGCAGGAGG + Intergenic
1049214690 8:141402292-141402314 GCAGGGCGCCAGAGGGCTGGAGG - Intronic
1049218033 8:141416729-141416751 GCTGGGGAGCAGAGGACAGGAGG - Intronic
1049337099 8:142092388-142092410 CCAGGAGGCTAGAGGGCAGTGGG - Intergenic
1049371913 8:142272008-142272030 CGGGTAGACCAGAGGGCAGGCGG - Intronic
1049421683 8:142519415-142519437 GCTGGAGAGCAGAGGGCACAGGG - Intronic
1049497699 8:142944176-142944198 GCTGGAAAACAGAGGGCAGAGGG + Intergenic
1049568371 8:143355481-143355503 GCAGGAGAGAAGAGAGCAGAGGG + Intronic
1049687469 8:143944675-143944697 GCAGGAGCCCACGGGGCAGACGG + Intronic
1049689160 8:143951211-143951233 GCAGGGGGGCTGAGGGCAGGAGG + Intronic
1051634112 9:19166137-19166159 ACAGGGGGCCAGGGGGCAGGTGG - Intergenic
1051686002 9:19658742-19658764 CCAGGAGACCAGAGGTTGGGAGG + Intronic
1052050918 9:23849266-23849288 GGAGGAGAGGAGAGGGCAGTGGG + Intergenic
1052975351 9:34406045-34406067 ACAGAAGCCCAGAGGGCAGGTGG - Intronic
1053025253 9:34723983-34724005 GCTGAAGACCAGAGGCCAGCAGG - Exonic
1053036782 9:34833045-34833067 GCTGAAGACCAGAGGCCAGCAGG - Intergenic
1053900866 9:42794300-42794322 TCAGCAGACTAGAGGGCAGGAGG - Intergenic
1054804787 9:69387294-69387316 GCAGGGGGCGAGAGAGCAGGTGG - Intronic
1054915880 9:70494863-70494885 GAAGGAAACCAGAGGGCAAGGGG + Intergenic
1055429392 9:76228228-76228250 GCAGATCACCTGAGGGCAGGAGG - Intronic
1055796805 9:79983302-79983324 GCAGGAGCCCAGGGGGTAGCAGG + Intergenic
1056134764 9:83621214-83621236 GCAGGAGATCACAGGGCAAGAGG + Intergenic
1056277522 9:85007530-85007552 GCAGTAGCCCAGGGGACAGGGGG + Intronic
1056516102 9:87351878-87351900 GCAGAAGAGCAAAGGGCAGTAGG - Intergenic
1056699408 9:88889588-88889610 GCAAGAGACAAGTGGGCGGGCGG + Intergenic
1056831426 9:89920286-89920308 GCAGGAGAAGAGAAGGCAGCTGG + Intergenic
1057167857 9:92942460-92942482 GATGCAGTCCAGAGGGCAGGAGG + Intergenic
1057300734 9:93880184-93880206 GCAGGAGCCCACCGCGCAGGGGG - Intergenic
1057518147 9:95738669-95738691 GCAGTAGATCAAAGGGCAGGAGG - Intergenic
1057610679 9:96540772-96540794 TCAGGAGACCAAAGGGCAACAGG - Intronic
1057819942 9:98322777-98322799 GGAGGAGCCCAGAGGCCTGGAGG - Intronic
1057882344 9:98802041-98802063 GCAGGAGATCAGAGGGCAGGAGG - Intergenic
1059341304 9:113599016-113599038 GCCGGGGAGCAGAGGGAAGGGGG - Intergenic
1059395605 9:114032353-114032375 GCAGGAGAGCAGATGGCAAATGG - Intronic
1060198803 9:121640039-121640061 ACAGGGGCCCAGAGGGCATGGGG + Intronic
1060333925 9:122703942-122703964 GCAGGAGGCCACATAGCAGGAGG + Intergenic
1061118668 9:128629924-128629946 ACAGGAGACCTCAGGGCAGAGGG - Intronic
1061136875 9:128739817-128739839 ACAGAAGACCAGAAGGAAGGTGG + Intronic
1061242270 9:129381630-129381652 GCAGAGGAGCAGAGGCCAGGAGG - Intergenic
1061761410 9:132854465-132854487 GCAGGAGATCAAAGGATAGGAGG + Intronic
1061835645 9:133327708-133327730 GCAGAAGATCAGAGGCAAGGGGG - Intergenic
1061902135 9:133678363-133678385 GCGGGAGACAAGAGGGGATGAGG - Intronic
1062087488 9:134656279-134656301 GCAGAAGGACAGAGGGCTGGAGG - Intronic
1062271889 9:135713651-135713673 GCAGGAGAGCAGAGGGGGGATGG - Intronic
1062381807 9:136290393-136290415 GGAGGACACCAGGGGGCTGGAGG + Intronic
1062404975 9:136391892-136391914 CCAGGAGACCTGAGGGCGTGTGG - Intronic
1062428639 9:136517233-136517255 GCAGACGACCCGGGGGCAGGGGG + Intronic
1062585828 9:137249531-137249553 GCAGGTGAAAGGAGGGCAGGAGG - Intergenic
1062598026 9:137307785-137307807 GCAGACGGGCAGAGGGCAGGGGG + Intronic
1062616373 9:137398364-137398386 ACAGGGGACAAGAGGGAAGGGGG - Intronic
1203778531 EBV:87837-87859 GCAGGAGGCCCCACGGCAGGAGG - Intergenic
1203458217 Un_GL000220v1:10555-10577 GCAGATGAGCAGAGGGTAGGAGG - Intergenic
1186565304 X:10655867-10655889 GCAGGTGATGAGAGGGCTGGTGG - Intronic
1186868656 X:13747568-13747590 GAAGCAGAGGAGAGGGCAGGTGG + Intronic
1187338668 X:18402340-18402362 GCAGGACTCCAGCGGGCAGAGGG - Intergenic
1188023781 X:25187124-25187146 GCAGAAGATCGGAGGGGAGGAGG + Intergenic
1188184072 X:27091826-27091848 GCAGGAAACCATAGGTCAGGAGG + Intergenic
1188370004 X:29358187-29358209 ATAGGAGACAAGAGGGCAGGAGG + Intronic
1188540838 X:31248739-31248761 GCAGAAGCCTAGAGGGCAGGCGG + Intronic
1189352965 X:40290829-40290851 GAAGGAGACTGGAGGACAGGAGG - Intergenic
1189717676 X:43882386-43882408 GCAGCAGGCCGGCGGGCAGGCGG - Exonic
1189861159 X:45273841-45273863 GGATGAGACAGGAGGGCAGGAGG + Intergenic
1190106779 X:47566802-47566824 GCCGGGGACCACAGGGCAGAGGG + Intronic
1191715955 X:64193653-64193675 TCAGGGGACCACTGGGCAGGGGG + Intronic
1192424203 X:71060981-71061003 GCAGGAAAGTAGAGGGCAGGTGG + Exonic
1192573057 X:72222032-72222054 GCTGGAGGCTTGAGGGCAGGAGG - Intronic
1194944190 X:100048613-100048635 GCAGGTGAACAGAAGGCAGAAGG + Intergenic
1194984070 X:100471142-100471164 GTAGGAGAGCTGAGGGTAGGAGG + Intergenic
1195034738 X:100962003-100962025 GCTGGAGTCCAGTGGGCATGGGG + Intergenic
1195923268 X:110002916-110002938 GGAGGAAGCCAGAGGGAAGGCGG - Intronic
1197413889 X:126150970-126150992 GCAGGAGATCCGTGGGAAGGGGG - Intergenic
1197757114 X:130003089-130003111 CCAGGAGACCAGTGTGGAGGTGG - Intronic
1197812233 X:130455516-130455538 GCAGGAGCAAAGGGGGCAGGGGG - Intergenic
1198411925 X:136379437-136379459 GAAGGGGAGGAGAGGGCAGGGGG - Intronic
1198646955 X:138818893-138818915 GCAGTAGACCAGGTGTCAGGAGG + Intronic
1199151320 X:144490279-144490301 GCAGGAGATCACTGGGCAGTTGG - Intergenic
1199429615 X:147744203-147744225 GCAGGAGACTAGAAGGTAAGCGG + Intergenic
1199661259 X:150053106-150053128 GCAGAAGACCAGAGGACATCTGG + Intergenic
1199772208 X:150982496-150982518 TCAGGAGAGCAGAGGGAATGAGG + Intronic
1200213166 X:154355894-154355916 GCAGGAGGCCAGGCTGCAGGGGG - Intronic
1200425216 Y:3013044-3013066 GCAGGACAACTGAGAGCAGGGGG + Intergenic
1200965442 Y:9031866-9031888 GAAGCAGAGGAGAGGGCAGGTGG + Intergenic
1202098074 Y:21274329-21274351 GCAGCAGTACAGAGAGCAGGGGG + Intergenic