ID: 1121333159

View in Genome Browser
Species Human (GRCh38)
Location 14:93060558-93060580
Sequence GGACCCTGCTCTGCTGCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121333159 Original CRISPR GGACCCTGCTCTGCTGCAAA AGG Intronic
900423613 1:2566441-2566463 TGACCCTGGTTTGCTGCACAAGG - Intergenic
907300534 1:53483937-53483959 TGCCCCTGCTCTGCTGCACCTGG - Intergenic
907300634 1:53484481-53484503 GGACCCTGATCTGCTGGAAGAGG + Intergenic
912457957 1:109811442-109811464 GGAATCTGCTGTGCTGCAAGAGG - Intergenic
913700054 1:121365652-121365674 GGTCCCTGGTTTGCTGCTAACGG - Intronic
914040603 1:144046105-144046127 GGTCCCTGGTTTGCTGCTAACGG - Intergenic
914137484 1:144914374-144914396 GGTCCCTGGTTTGCTGCTAACGG + Intronic
914920437 1:151843514-151843536 GGGCCTTGCTCTGCTGCCCAGGG - Intergenic
915026273 1:152832838-152832860 GGACTCAGCTCTGCACCAAATGG + Intergenic
915195018 1:154182898-154182920 GGACCGTGCTCCACGGCAAAAGG + Intronic
915939920 1:160112525-160112547 GGACGCTGCTCAGCTGCAGATGG - Intergenic
916588231 1:166166415-166166437 GGACCCCGCGCGGCTGCAAGAGG - Exonic
918227016 1:182493231-182493253 GAACCATGCTCTGTTGGAAATGG + Intronic
919480248 1:198079383-198079405 GGACCCCTCTCTGCAGCAAAGGG - Intergenic
919686232 1:200486387-200486409 AGACCCTGCTCTGAGGCACAGGG + Intergenic
920373946 1:205496794-205496816 GGACCCTCTTCTGCTGCTCAGGG + Intergenic
921158440 1:212455833-212455855 GGAACCTGCTCTGCTCTTAAGGG + Intergenic
922218507 1:223539983-223540005 AGAGCCTCCTCTTCTGCAAAGGG + Intronic
1064742723 10:18449848-18449870 GGCCCCTTCTCTGCTGTAACTGG - Intronic
1066388971 10:34963648-34963670 GGACTCTGCCCGGCTGCACATGG + Intergenic
1067829305 10:49601036-49601058 GGACCCCACTCTGCTGGGAAAGG + Intergenic
1068776565 10:60873982-60874004 GGAGATTGCTCTGGTGCAAAAGG - Intronic
1070813857 10:79311465-79311487 GGACCCTCCTGTGCTGCGCAAGG - Intronic
1073666240 10:105537226-105537248 GGAACCTGCACTACTGCAATAGG + Intergenic
1074051954 10:109888231-109888253 GCTCCCTGCCCTGCTGCAATGGG - Intronic
1076670123 10:132115975-132115997 GGGCCAGGCTCTGCTGCCAAGGG - Intronic
1076995672 11:296447-296469 GGACCCAGCTCTGCAGCTGAGGG - Intergenic
1078062219 11:8055616-8055638 GGACTCAGCTCTGCTGCTGATGG + Intronic
1078509774 11:11976685-11976707 GGACCCTGCCCTCCTGCAGCAGG - Intronic
1080857603 11:36125894-36125916 TCAACCTGATCTGCTGCAAAAGG + Intronic
1081127994 11:39342944-39342966 GGCCCCAACTCTGCTGCTAAGGG + Intergenic
1083698030 11:64455646-64455668 GAGCCCTTCTCTGCTGCAGATGG - Intergenic
1083720850 11:64602857-64602879 GGACCCGGCTGGGCAGCAAATGG - Intergenic
1084762522 11:71283081-71283103 GGACACTTCTCTGCTGCAGAGGG + Intergenic
1087108781 11:94440106-94440128 CCATCATGCTCTGCTGCAAAAGG + Intronic
1089095690 11:115918282-115918304 GGACTCTCCTCTGCTGGAATTGG - Intergenic
1089446532 11:118557205-118557227 TGCCCCTGCTCAGCTACAAATGG + Intronic
1090057706 11:123437843-123437865 TCACCCTGCTCTCCTGGAAATGG - Intergenic
1090851655 11:130575957-130575979 TGACCCTACTCTGCTGCACAAGG - Intergenic
1094631351 12:32178445-32178467 CGAGCCTGTTCAGCTGCAAAAGG - Intronic
1094841567 12:34344602-34344624 GAACCCTGCTCTGCTGCGCTGGG + Intergenic
1096148419 12:49294567-49294589 GGCGCCAGCTCTGCTGCTAATGG - Exonic
1096692006 12:53327127-53327149 GGAACCTGCTCTGCAGTCAAGGG + Exonic
1098241773 12:68474592-68474614 GGATCCTGCTTTGCTGCATCCGG + Intergenic
1102052350 12:109871924-109871946 TGCCCCTCCTCTGCTGCACAGGG - Intronic
1102951412 12:117033900-117033922 GAACTCTGCTGTGCTGGAAACGG - Intergenic
1103025149 12:117567700-117567722 GAACCAAGCCCTGCTGCAAAGGG - Intronic
1105577693 13:21669383-21669405 TGACCCTGGACTGCGGCAAAGGG + Intergenic
1105790643 13:23795152-23795174 TGCCCCAGCTCTCCTGCAAATGG - Intronic
1108586556 13:51875056-51875078 GGTCTTTGCTCTGCAGCAAAGGG - Intergenic
1112033436 13:95476949-95476971 GGTCCCTGCTATGCTGCTCATGG - Intronic
1113262015 13:108575400-108575422 GGCCCTTGCTCTGCTGCCAAAGG + Intergenic
1116887093 14:50231862-50231884 GCACTCTGCGCTGCTGCTAAAGG - Intergenic
1119547192 14:75480454-75480476 AGACCCTGCTCTGCTTCAGGTGG + Intergenic
1119942535 14:78656614-78656636 TGACCATGTTCTGCTGCATAAGG - Intronic
1121333159 14:93060558-93060580 GGACCCTGCTCTGCTGCAAAAGG + Intronic
1122904230 14:104794758-104794780 GGCCCCTGCTCTGCAGCCAGAGG - Intronic
1125041736 15:35195762-35195784 GGACCCTGCTCTGCTCTGACTGG + Intergenic
1126104987 15:45141567-45141589 GGACCCTACACAGCTGCAAGTGG - Intronic
1128703625 15:69822216-69822238 GCACCCCGCTCTGCTGCCACAGG - Intergenic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1134375730 16:13671200-13671222 GGACCCTGCTAAGCTGCACCTGG + Intergenic
1136056723 16:27695279-27695301 GGCCCATGCTCTGCGGGAAATGG - Intronic
1136285905 16:29241648-29241670 GGGCCCTGCCCTGATGCAAGGGG + Intergenic
1138272385 16:55704661-55704683 CGACCCTGCTCTAATGCAAAAGG - Intronic
1140864625 16:79049457-79049479 TGTCCCAGCTGTGCTGCAAATGG - Intronic
1141435407 16:83997094-83997116 GGACCCGGCCCTGTTGCACAGGG - Intronic
1141980117 16:87544996-87545018 GGACCCTGCCCTGCAGCACGTGG - Intergenic
1141980127 16:87545034-87545056 GGACCCTGCCCTGCAGCATGTGG - Intergenic
1142091244 16:88211834-88211856 GGGCCCTGCCCTGATGCAAGGGG + Intergenic
1142172200 16:88628649-88628671 GCAACCTGCTCTGCTCCCAAAGG - Intronic
1143175571 17:4953088-4953110 GGGCCCTGCTCTGCTGCAAAAGG + Exonic
1144702372 17:17347974-17347996 GGACCCTGCTCTGAAGCACTGGG - Intergenic
1144767088 17:17738733-17738755 GGACCCTGATGGGCTGCAGAGGG + Intronic
1146062641 17:29615201-29615223 GGGTCCGGCTCTGCAGCAAACGG + Exonic
1146961149 17:36980740-36980762 GGACAATCCTTTGCTGCAAATGG - Intronic
1147591312 17:41685298-41685320 GGACATTGTTCTGCTGGAAAGGG - Intergenic
1147649090 17:42051729-42051751 GTACGCTGCTCTTCTGCAAAAGG + Intronic
1147659935 17:42112037-42112059 GGACCCTGCTCTGCCCAAAAGGG + Intronic
1150183856 17:63158782-63158804 GAACCCTGCTATGCTGCATTTGG - Intronic
1150980013 17:70130621-70130643 AGCACCTTCTCTGCTGCAAAAGG - Intronic
1152037691 17:77883471-77883493 GGACCCGGCTCTGATGCAGGTGG - Intergenic
1152678852 17:81655488-81655510 TGTCCCTGCACTGCTGCACAGGG + Intronic
1152825647 17:82463020-82463042 GGATCTTGTTCTGCTGCAGATGG - Intronic
1153505047 18:5788430-5788452 GGAACCTGATTAGCTGCAAAAGG - Intergenic
1153614726 18:6923865-6923887 GGACCCTGCTGTGCAGCAATGGG - Intergenic
1153682456 18:7513376-7513398 GGACAGTGCACTGCAGCAAAGGG - Intergenic
1154221193 18:12455690-12455712 GGACCCTGCCAGGCTGCAAGGGG + Intronic
1155466673 18:26143394-26143416 GTACCCTGAACTGCTGCAATAGG + Intronic
1157563560 18:48664622-48664644 GGAGGCTGCTCTGCTGCACAGGG + Intronic
1164294050 19:23893946-23893968 GAACTCAGCTCTGCTCCAAACGG - Intergenic
1166163454 19:40968997-40969019 GAACTCAGCTCTGCTCCAAATGG - Intergenic
925018783 2:552566-552588 CGAGCCTGCTCTTCTGCACATGG + Intergenic
925409991 2:3634462-3634484 GGGCCCTGCTTTGCTGCAGGAGG - Intronic
925910393 2:8569900-8569922 TCACCCTGCTCTGCTAGAAAAGG - Intergenic
926235951 2:11043942-11043964 GGAACATACTCTGGTGCAAATGG + Intergenic
927822341 2:26278862-26278884 GGACTCTGCTATGCTGTAATAGG + Intronic
927934677 2:27069684-27069706 GGATCCTGCTCTGCTACACCAGG + Exonic
928326011 2:30320098-30320120 TTACCTTCCTCTGCTGCAAAGGG + Intronic
929920483 2:46167904-46167926 GGAGCCTGCTGTGCTGGAACAGG - Intronic
931055177 2:58461469-58461491 GGATTTTGCTCTGCTTCAAAAGG - Intergenic
931345321 2:61440439-61440461 GGAACTTGCTCTGCTGCAGAGGG + Intronic
936508067 2:113123988-113124010 GGACACTGCACTGCTGTAAGGGG - Intronic
936840170 2:116758746-116758768 AGACTCTTCCCTGCTGCAAATGG - Intergenic
937445387 2:121952995-121953017 GGATGCAGCTCTGCTGCAACAGG + Intergenic
937915549 2:127097144-127097166 TGACCCAGCTCTGCAACAAAAGG + Intronic
941883222 2:170502565-170502587 TCACTCTGCTCTTCTGCAAATGG + Intronic
944615395 2:201453798-201453820 GGAGTTTGCTGTGCTGCAAAAGG - Intronic
944928344 2:204489507-204489529 GCACCATGCTCTGCAGCACATGG - Intergenic
946885383 2:224217395-224217417 AGACCCTTCCCTGCTGCAAATGG - Intergenic
948470405 2:238173850-238173872 GGACCCTGCCCAGCTGCACATGG + Intronic
948721463 2:239903569-239903591 GGACGCTGCCCTGTTGAAAAGGG + Intronic
948886755 2:240888645-240888667 TGACCCTGCTGTCCTGCAGATGG - Exonic
1169198972 20:3698430-3698452 GCACCCTGCTCAGCAGCAGATGG - Intronic
1171034498 20:21704877-21704899 GGATCCCGATCTGCTGCTAAGGG - Intergenic
1172675788 20:36670821-36670843 GGAACCTGGTCTTCTTCAAAGGG - Intronic
1172760490 20:37317914-37317936 GGGTCCTGCTCTGCTGCAGAGGG + Intergenic
1176189208 20:63799844-63799866 GGAGCCTGCTCAGCTGCTGAGGG + Intronic
1179615644 21:42581576-42581598 GGCCCCTTTTCTGCTGGAAATGG - Intergenic
1181129372 22:20721415-20721437 GGACCTTGCTCTCCTGCAGATGG - Exonic
1181275195 22:21683615-21683637 GGCCACTGCTCTGCAGCACAAGG - Intronic
950191095 3:10976651-10976673 GGACCTTGCTCTGGTGCCCAGGG - Intergenic
951731244 3:25812768-25812790 GGTCTCAGCTCTGCTGCATATGG - Intergenic
958042050 3:88238459-88238481 TGACTTTGGTCTGCTGCAAATGG + Intergenic
961970246 3:130956115-130956137 GGTCCATGCTCTTCTGCAGAGGG - Exonic
962851002 3:139308347-139308369 GGACCTGGCTCTGCAGGAAAAGG + Intronic
963811751 3:149784335-149784357 TGTCCATGCTCTACTGCAAAGGG - Intronic
964667489 3:159190161-159190183 GCACCCTGCTCAGCTGCAGTGGG + Intronic
968062149 3:195733704-195733726 GGTCCCTGCCCTGCTGCAGCGGG - Intronic
968195238 3:196700904-196700926 GAACCCTGATATGCTGCACATGG - Intronic
969116435 4:4873220-4873242 GGCCCCTGCTGTGCTGGGAAAGG + Intergenic
969263719 4:6050504-6050526 GTGCCCGGCTCAGCTGCAAAGGG - Intronic
969563369 4:7963263-7963285 TGACCCTGCCCAGCTGCAAAAGG - Intergenic
976164518 4:82240070-82240092 GCACATTGCTGTGCTGCAAATGG - Intergenic
977716724 4:100190959-100190981 GTATCCTCCTCTGCTGCAAGCGG + Intergenic
980033429 4:127856654-127856676 GGTCCCTGCTCTGTCTCAAAGGG + Intergenic
980649558 4:135694951-135694973 AGAGCCTTCTCTGGTGCAAAAGG - Intergenic
980826718 4:138082106-138082128 GGATCCTTCCCTGCTGCAAATGG + Intergenic
982754392 4:159201630-159201652 GGACCCTGAACTGTAGCAAAGGG + Intronic
986559364 5:9045286-9045308 GGACACAGCCCTGCTGCACAGGG - Intronic
986737786 5:10681007-10681029 GGCCCCGGCTCTGCTGCACTTGG - Exonic
996539266 5:124612086-124612108 GGCCCTAGCTCTTCTGCAAAAGG + Intergenic
998264093 5:140654031-140654053 GGATTTTGCTCTGCTTCAAAAGG + Exonic
999370026 5:151049200-151049222 GGACTCAGCTCTGCAGCAAGGGG + Intronic
1000719538 5:164690045-164690067 GGACCCTCCTCTACTGTTAATGG + Intergenic
1002668957 5:180849580-180849602 GGACCCTTCTGTGCTGAGAAAGG + Exonic
1006020331 6:31114137-31114159 GGCCCCTGATCTGCAGCCAATGG - Intergenic
1006520616 6:34568947-34568969 GGCCCCTGCTCATCTGCAAGTGG - Intergenic
1012247638 6:96943595-96943617 GGTCCCGGCTCTGCTACTAAGGG - Intronic
1014520694 6:122438996-122439018 GGACACTGCTCAGCTCTAAAGGG + Intergenic
1016509410 6:144824278-144824300 TTACCCTGCTCTGGAGCAAATGG + Intronic
1017870152 6:158480078-158480100 GGATCCTGCACAGCTGCACATGG - Intronic
1018055933 6:160052175-160052197 GGATCTTGCTCTGTTGCCAAGGG - Intronic
1018402688 6:163441286-163441308 GCACAGTGCTCTTCTGCAAATGG - Intronic
1019004210 6:168782704-168782726 GGCCCCTGCTGAGCTGCACATGG + Intergenic
1019367952 7:644852-644874 GGACTCAGCTCTGCAGCACACGG - Intronic
1025220651 7:57104737-57104759 GGACCCTGCCCTTTTCCAAAAGG + Intergenic
1025631466 7:63276549-63276571 GGACCCTGCCCTTTTCCAAAAGG + Intergenic
1027346307 7:77263197-77263219 TGACTCTGCTCAACTGCAAAGGG - Intronic
1029362158 7:100095642-100095664 GGACCAGCCCCTGCTGCAAAGGG + Intronic
1029693566 7:102198597-102198619 GGCCGTGGCTCTGCTGCAAAAGG - Intronic
1034860210 7:154588232-154588254 GGACCCTCCACTGGTTCAAATGG + Intronic
1035369249 7:158368612-158368634 GGCCACTGCTTTGCTGCACAGGG + Intronic
1036061917 8:5332275-5332297 GGACTCAGGTCTGCTGCACATGG - Intergenic
1038781913 8:30575394-30575416 GGATCCTGCTCTTCAGCAGATGG - Intergenic
1040006786 8:42627887-42627909 GGTCTCTTCTGTGCTGCAAAGGG - Intergenic
1041690969 8:60686631-60686653 GGTCCCTGCTCAGCAGCAGATGG - Intronic
1042961708 8:74310399-74310421 GGCCTCTGCTCTGCTCCAAAAGG - Intronic
1044992203 8:97806271-97806293 GTACCCTACTCAGCAGCAAAAGG - Intronic
1049154526 8:141058757-141058779 GGAACCTGCTAGGCTGCAAAGGG + Intergenic
1049671902 8:143873674-143873696 GGGCCCAGCCCTGCTCCAAAAGG + Intronic
1049690959 8:143958689-143958711 GGCACCTGCTCTGCTGCAGCAGG + Intronic
1052557585 9:30037091-30037113 GGATCATGCTCTGCAGCATAAGG - Intergenic
1052772030 9:32698784-32698806 GGACACTGCTCTGGTGGAACCGG + Intergenic
1059038057 9:110780994-110781016 GGACTATGCCCTGCAGCAAATGG - Intronic
1059612550 9:115914949-115914971 AGCCCCTGCTCTGCTGCAGTAGG - Intergenic
1061218241 9:129234375-129234397 GGCCACTGCTCTGCTCCACATGG - Intergenic
1061953680 9:133950471-133950493 GGACCCACCTCTGCTGCCGACGG + Intronic
1062306369 9:135908981-135909003 GGCCCCTTCTCTGCAGGAAATGG + Intergenic
1186206217 X:7203809-7203831 GGGTCCTGCTCTGCTGCCCAGGG + Intergenic
1186379528 X:9043353-9043375 GGACCCTCCTATTCAGCAAATGG + Intronic
1188304503 X:28546121-28546143 GAACCCTGAACTGCTGTAAAAGG + Intergenic
1189221646 X:39377301-39377323 GGCCCCTGCTCTCCTGAGAATGG + Intergenic
1191049429 X:56175614-56175636 GAACTCTGCTCTGCACCAAATGG - Intergenic
1193269378 X:79511423-79511445 GGACCCTACTTTACTGGAAAAGG + Intergenic
1193469010 X:81876645-81876667 GGGTCCTGCTCAGCTGCACAAGG + Intergenic
1195799150 X:108687544-108687566 GGAACCTCCTCTGTTGCACATGG + Exonic
1197848260 X:130828038-130828060 TGAACCTGCTCAACTGCAAATGG + Intronic
1198174333 X:134140760-134140782 GGACCCTGATCTGTAGCAAATGG - Intergenic
1199786538 X:151111646-151111668 GGACCCTGCTGTGCTTGAAGGGG + Intergenic