ID: 1121334885

View in Genome Browser
Species Human (GRCh38)
Location 14:93071152-93071174
Sequence CAGGCAGGAAAGGAAGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 516
Summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 460}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121334885_1121334891 27 Left 1121334885 14:93071152-93071174 CCTGCAACTTCCTTTCCTGCCTG 0: 1
1: 0
2: 4
3: 51
4: 460
Right 1121334891 14:93071202-93071224 CTTTCATGATCATCATCACGTGG 0: 1
1: 0
2: 0
3: 7
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121334885 Original CRISPR CAGGCAGGAAAGGAAGTTGC AGG (reversed) Intronic
900580214 1:3405044-3405066 TAGGAAGGAAAGGAAGTCTCAGG + Intronic
900826085 1:4928079-4928101 CAGCCAGGAAAGGGAGTTCTTGG + Intergenic
901354117 1:8627875-8627897 AAGGAAGGAAAGGAACATGCCGG + Intronic
901537087 1:9889512-9889534 CAGGGAGGGAAGGAAGTTCTAGG - Intronic
901658613 1:10784995-10785017 CAGGCAGGCAGAGAAGTTGGAGG - Intronic
901876291 1:12168678-12168700 CAGGAAGGGAAGGAAGTGGGAGG - Intronic
902206720 1:14873718-14873740 TAGGGAGGAAAGGCAGGTGCCGG + Intronic
902222099 1:14972851-14972873 CAGTCAGCAAAGGAGGTAGCAGG + Intronic
902237511 1:15067081-15067103 CAGGGAGGAACAGAAGCTGCTGG - Intronic
902740235 1:18432825-18432847 AAGGAAGGAAAGGAAGTTTCTGG - Intergenic
902779401 1:18694726-18694748 CAGACAGGAAACGAAGTCTCAGG - Intronic
903178801 1:21595279-21595301 CAGGCAGGAGCGGTAGTTGCTGG - Intergenic
903375922 1:22865946-22865968 ACGGCAAAAAAGGAAGTTGCCGG + Intronic
903446462 1:23425324-23425346 CAGCCAGCAAAGGAAGTTTTAGG - Intergenic
904809820 1:33156151-33156173 GATGTAGGAGAGGAAGTTGCAGG - Intronic
905007556 1:34722203-34722225 CTGGCAGGAAAGGAAGAAACAGG - Intronic
905036809 1:34924007-34924029 CAGGCAGGAAGGGATGATGGTGG - Intronic
905463301 1:38135091-38135113 GAGGCAGAAAGGGAAGTGGCAGG + Intergenic
905634491 1:39540513-39540535 CAGGCAGGAGAGAATGATGCAGG + Intergenic
905731216 1:40300643-40300665 GAGGCAGGGAAGGAAGTAGTGGG + Exonic
905954060 1:41977414-41977436 CAGGCAGGCAAGCAAGCAGCTGG - Intronic
907019186 1:51048867-51048889 AAGGCTGGACAGGCAGTTGCTGG - Intergenic
907459374 1:54596248-54596270 CAGACAGGAGGGGAAGTTGAGGG - Intronic
907676474 1:56522093-56522115 GAGGCAGAAAAGGTATTTGCAGG - Intronic
908066440 1:60410625-60410647 CAGACAGGAAAGGCAGGGGCAGG - Intergenic
908356236 1:63327037-63327059 CTGGCTGGAAGGAAAGTTGCCGG - Intergenic
908392919 1:63699576-63699598 CAGGCAGGCAAGGTACTGGCAGG + Intergenic
908427482 1:64021558-64021580 CAGGCAGGAAAACAAGTTCAAGG + Intronic
910872268 1:91845648-91845670 CATGCAGGAAAGGAAGAAACAGG - Intronic
911003096 1:93188464-93188486 CAGGCAGGCAAGGAAGTAACTGG - Intronic
911814761 1:102333148-102333170 CAATCAGGATAGGAAGATGCAGG - Intergenic
912219502 1:107656785-107656807 CAGAGAGGAAAGGACATTGCAGG - Intronic
913251128 1:116912539-116912561 CAGGAAGGAAAGAAAGAAGCTGG - Intronic
915279763 1:154814388-154814410 CAGTCAGAGAAGGGAGTTGCAGG + Intronic
918099604 1:181362163-181362185 GAGGAAGGATTGGAAGTTGCTGG - Intergenic
918437660 1:184533202-184533224 CAGTCAAGAGAGGAAGCTGCAGG - Intronic
918876729 1:190056118-190056140 TAGGGAGGAAAGGAAGCAGCGGG - Intergenic
919843819 1:201628579-201628601 CAGGCAGGAGGGGAAATTGAAGG - Intronic
919960408 1:202461978-202462000 TAGGCAGGAAAGGAATCTGTGGG - Intronic
922779869 1:228243380-228243402 CAGGCAGGCAAGACAGATGCCGG + Exonic
922780243 1:228246725-228246747 CAGGCAGGCCAGGCAGATGCTGG + Exonic
922863989 1:228843124-228843146 AAGGCAGGAAAGGAAATTCATGG - Intergenic
923140633 1:231159611-231159633 AAGGCTGGACAGGTAGTTGCTGG - Intergenic
1062809730 10:453811-453833 CAGGCAGGGAGGGATATTGCTGG + Intronic
1062817381 10:510461-510483 CAGGCGGGAAAGAGCGTTGCTGG - Intronic
1063141806 10:3262497-3262519 GAGGCTGGACAGGCAGTTGCTGG + Intergenic
1063379237 10:5574115-5574137 CAGGCACTGCAGGAAGTTGCTGG - Intergenic
1064304610 10:14153943-14153965 CAGCCAGGAAAGGAGGTTACTGG - Intronic
1066373624 10:34837965-34837987 CAGCCAGGGAAGGCAGTTCCAGG - Intergenic
1066542851 10:36467799-36467821 GAGGCAGGAATGGATGTTGATGG + Intergenic
1067070025 10:43124417-43124439 CAGGCAAGCAAGGACGGTGCAGG + Intronic
1067718683 10:48709867-48709889 CATGCTGGAAAGGAAGTTTCTGG + Exonic
1068046587 10:51893822-51893844 CAGCTAGGAAGGGAAGGTGCTGG + Intronic
1069632889 10:69908146-69908168 CAGGAAGGAAAGGCAGCAGCAGG + Intronic
1069753031 10:70757065-70757087 CTGGAAGGAGAGGAATTTGCAGG - Intronic
1069908742 10:71747282-71747304 CAGGCAGAAAAGGGAGTGGCAGG + Intronic
1069944223 10:71974845-71974867 CAGGCAGGGAAGGGAGTGGTGGG - Intronic
1070398743 10:76034507-76034529 CTGGCAGGAATGGAACATGCCGG + Intronic
1070901689 10:80035577-80035599 TAGGCAGGAAAGAAATTTGTAGG - Intergenic
1071178687 10:82957664-82957686 AAGGGTGGACAGGAAGTTGCTGG - Intronic
1071343443 10:84668824-84668846 CAGCCATGGAAGGAAGGTGCCGG - Intergenic
1071492341 10:86144406-86144428 CTGCCAGGAAAGGAAGCTGAGGG + Intronic
1071544850 10:86521546-86521568 GAGGCGGGGAGGGAAGTTGCGGG - Exonic
1072378280 10:94839376-94839398 AAGGCAGGAAAAACAGTTGCAGG - Intronic
1072703577 10:97663375-97663397 GAGAAAGGAAAGAAAGTTGCAGG - Intronic
1072954251 10:99874869-99874891 GGGGCAGGGAAGGAAGTGGCAGG - Intergenic
1073206218 10:101770792-101770814 CTGGGAGGACAGGAAGTTGCCGG - Intronic
1073323880 10:102631474-102631496 AAGGCAGGAAAGGGGCTTGCTGG - Exonic
1074882832 10:117671880-117671902 CAGGAGGGAAAGGAGTTTGCTGG + Intergenic
1075173578 10:120138546-120138568 CAGACAGGAATGCAACTTGCTGG + Intergenic
1075444053 10:122501526-122501548 CCAGCAGGGAAGGAAGTTGGAGG - Intronic
1075444476 10:122504155-122504177 CAGGCAGGGATGGAGGCTGCAGG - Intronic
1075769057 10:124917575-124917597 CCGGCAGGAAAAGAAGTTGTGGG - Intergenic
1075880998 10:125850649-125850671 CAGGAAGAAAATAAAGTTGCTGG - Intronic
1075967910 10:126628734-126628756 CAGGCAGGCAAGTGAGTGGCTGG - Intronic
1076736743 10:132462406-132462428 CAGGAGGGAAAGGGAGGTGCTGG + Intergenic
1076888943 10:133274697-133274719 CAGGCAGCAAAGGAGGTGGGTGG + Intronic
1076907371 10:133369776-133369798 GAGGCAGGAAAGGAGGCTGCTGG + Intronic
1076977997 11:189885-189907 CAGGCAGCTAGGGACGTTGCAGG + Intronic
1077181412 11:1218860-1218882 CCGGCAGGAAGTGAAGCTGCAGG - Intergenic
1077484838 11:2833910-2833932 CTGGGAGGGCAGGAAGTTGCTGG - Intronic
1078455423 11:11471000-11471022 AAGGCAGGGAAGGAAGATACAGG - Intronic
1078931839 11:15918607-15918629 CAGGCAGGAGAGGAAAAGGCTGG - Intergenic
1080265263 11:30393503-30393525 TAAGCAGGATAGGAAATTGCAGG - Intronic
1080844433 11:36014542-36014564 CAGGCGGGAAAGGAGGGAGCAGG - Intronic
1081005059 11:37726014-37726036 CAGGCTGAAAAGAAAGCTGCTGG + Intergenic
1081534893 11:43989460-43989482 CAGGCAGGAAAGGAAACAGGAGG - Intergenic
1083351610 11:62033464-62033486 GAGGCTGGAAAGGAAGTTAGGGG - Intergenic
1083402870 11:62436138-62436160 CAGGGTGGGGAGGAAGTTGCAGG + Intronic
1084758912 11:71256078-71256100 CAGGCAGGAGGGAAAGCTGCGGG + Intergenic
1085331143 11:75652397-75652419 CAGGCAGCAAGGGAGGTGGCAGG - Intronic
1085817754 11:79758944-79758966 CAGACTGGAAAGAAAGTTGGGGG - Intergenic
1086069631 11:82786529-82786551 AAGTCAGGAAAGGAAGATGTGGG + Intergenic
1087111786 11:94477818-94477840 CAGGCAGAAAAGGAAGCAGTGGG + Intronic
1087127234 11:94640106-94640128 CAGGCAGGAAGTGCAGTAGCAGG + Intergenic
1088444782 11:109914124-109914146 CAGGATGGAAAGGAGCTTGCTGG + Intergenic
1088544084 11:110942401-110942423 CTGGCAGCACAGGAAGTAGCAGG + Intergenic
1088811109 11:113393258-113393280 CAGGAAGTAAAGGAGTTTGCAGG - Intronic
1089284152 11:117394913-117394935 TGGGCAGGAAAGGAAGCTCCAGG + Exonic
1089818001 11:121193695-121193717 CATCCTGGAATGGAAGTTGCTGG + Intergenic
1091184821 11:133637699-133637721 CAGGCAGGAAAAGCAGGTGCAGG - Intergenic
1091661400 12:2386529-2386551 CAGGCAGACAAGGAAGTGACAGG - Intronic
1092043748 12:5409582-5409604 AGGGCAGGAAAGGAAGGTACAGG - Intergenic
1093231933 12:16555792-16555814 CAGTGAGGAAAGGAATTTTCAGG - Intronic
1093933477 12:24977333-24977355 TAAGGAAGAAAGGAAGTTGCAGG + Intergenic
1095217376 12:39565613-39565635 CAGGCAGGAAAGGAAATAAAGGG - Intronic
1096097023 12:48942217-48942239 GAGGCAGGAAAGGAAAGTGTTGG - Intronic
1096153819 12:49330937-49330959 CAGGCAGGTAAGGAGTTGGCTGG + Exonic
1096256050 12:50063080-50063102 CAGGAAGAAAAGGAGGTGGCCGG - Intronic
1096995687 12:55836756-55836778 CAGACAGGAAATGGAGTTGGGGG + Exonic
1097472012 12:60005211-60005233 AAGGCAGGTAAGGAAGTCTCAGG + Intergenic
1098569634 12:71974118-71974140 CAAGCAAGAAAGCAAGTTCCAGG - Intronic
1098807395 12:75036698-75036720 CAGGCAAGAAAGAACGTGGCTGG + Intergenic
1098813058 12:75120697-75120719 CTCCCAGGAAAGGCAGTTGCTGG + Intronic
1099227270 12:79984215-79984237 CTGGCGGGAGAGGAAGTCGCAGG + Intergenic
1100129985 12:91480188-91480210 TGAGCAGGAAAGGAAGTTGCTGG - Intergenic
1100810804 12:98336248-98336270 CTGGCACGAAAGGAATTAGCAGG - Intergenic
1100909927 12:99347448-99347470 AAAGCAGGAAATGAAGTTGAAGG + Intronic
1100915297 12:99413971-99413993 TGGGCAGGAAAGGCAGGTGCAGG - Intronic
1101315989 12:103629339-103629361 CAGCCAGGAGAGGCAGTTGCTGG - Intronic
1102260206 12:111438696-111438718 CAGGCAGGGAAGGAAGTGAAGGG + Intronic
1102739385 12:115193390-115193412 CAGGCAGGAGAGGATGGTGATGG + Intergenic
1102959821 12:117085225-117085247 CAGGCAGGGAATGAAGCAGCTGG + Intronic
1103036077 12:117657628-117657650 CAGGCAGGAACTGAAGTCTCTGG - Intronic
1103617293 12:122162434-122162456 AAGGAAGGAAAGGAGGTTGGGGG - Intergenic
1104657933 12:130587875-130587897 CAGGCAGGAGGGGAAGTTGGAGG - Intronic
1105061014 12:133151066-133151088 CAGGGAGGAGTGGAAGCTGCTGG + Exonic
1105449823 13:20489477-20489499 CAGAAAGGAGATGAAGTTGCTGG - Exonic
1107357787 13:39586739-39586761 AAAGCAGGAAAGGCAGTTACAGG - Intronic
1107440589 13:40424158-40424180 CAAGCAGGGAAGGAAATGGCTGG + Intergenic
1107750183 13:43557104-43557126 CACGCAGGAAAGACAGTGGCTGG + Intronic
1108099697 13:46941775-46941797 GAGGCAGGAAAGGTATTTACGGG + Intergenic
1108470562 13:50762874-50762896 CATCCAGGAAGGGATGTTGCAGG + Intronic
1108552165 13:51557399-51557421 CAAGCAGAAAAGGAACTTACTGG + Intergenic
1108963024 13:56260699-56260721 GAGGCTGGAAATGAAGTTGGCGG - Intergenic
1109549438 13:63874263-63874285 AAGGCTGGGCAGGAAGTTGCTGG - Intergenic
1110200008 13:72838833-72838855 AAGGAAGGAAAGGAAATTGGGGG + Intronic
1110242687 13:73286436-73286458 CAGGCAGGGAAGGAAATTTCAGG - Intergenic
1112096535 13:96137788-96137810 GAAGCAGATAAGGAAGTTGCAGG + Intronic
1112742273 13:102488520-102488542 AAGGCAGGGAAGGAAGTTGTGGG - Intergenic
1113167881 13:107463427-107463449 GAGGAAGGAAAGGATGTTGCTGG + Intronic
1113431540 13:110255559-110255581 CAGGCAGGAAGGGAGGGGGCAGG + Intronic
1113431557 13:110255602-110255624 CAGGCAGGAAGGGAGGGGGCAGG + Intronic
1113431574 13:110255645-110255667 CAGGCAGGAAGGGAGGGGGCAGG + Intronic
1113877689 13:113604839-113604861 CAGGCAGGAATGGAGGCTGAGGG + Intronic
1114254531 14:20990178-20990200 CTGGCAGAAAGGAAAGTTGCTGG - Intronic
1115794816 14:36922835-36922857 CAGGCAGTTAAGGTAGTTGTGGG - Intronic
1116513549 14:45778075-45778097 AACGCAGTAAAGAAAGTTGCAGG - Intergenic
1117186934 14:53249458-53249480 CAGGGAGGAATGGATGATGCTGG - Intergenic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1120022931 14:79550659-79550681 CAGCCAAGGAAGGAAGATGCTGG + Intronic
1120865767 14:89294100-89294122 CAGAAAGGAAAGGAAAGTGCAGG - Intronic
1120953250 14:90061306-90061328 CAGGGAGCAAAGGAAGTTAGGGG - Intergenic
1121082435 14:91119252-91119274 CAGGCAGGAACAGAAGGTGAAGG - Intronic
1121334885 14:93071152-93071174 CAGGCAGGAAAGGAAGTTGCAGG - Intronic
1122060637 14:99134558-99134580 CAGGCTCGAAAGGAGGTTGAGGG - Intergenic
1122327386 14:100890800-100890822 CAGGCAGCAGAGGGAGCTGCTGG - Intergenic
1122736566 14:103847170-103847192 CGGGCGGGGAAGGAAGTGGCTGG - Intronic
1124905106 15:33861042-33861064 CAGGCAGAAAAGGCATTTGTTGG - Intronic
1125280398 15:38036575-38036597 GAGGCATGAAAGGAAATGGCTGG - Intergenic
1126560728 15:50040853-50040875 CAGGAAAGAAAGGAAGTAGAGGG + Intronic
1126944995 15:53809683-53809705 CAGGCAGGTAAGAAAGTATCAGG + Intergenic
1127794337 15:62425398-62425420 CATGCAGGAAGGGGAGTTACCGG - Intronic
1128793189 15:70448027-70448049 CAGGCTGGAGCAGAAGTTGCTGG + Intergenic
1128840016 15:70842477-70842499 CAGGAAGGAGAGGAAGGTGTGGG - Intronic
1128890708 15:71329477-71329499 GAGGCAGCAAAGGACGTTTCAGG - Intronic
1129190018 15:73931691-73931713 CAGGCAGGAGAGGTGGTAGCAGG - Intronic
1129466462 15:75727041-75727063 CAGGCCTGAAAGGGAGTGGCGGG - Exonic
1129650627 15:77485251-77485273 GAGGCAGTAAATGAAGTTACAGG + Exonic
1129685481 15:77684057-77684079 AAGGCAGGAAAGGACATTCCAGG - Intronic
1129742066 15:77994099-77994121 CACACAGGAAAGCAAGTTGCTGG + Intronic
1129843421 15:78757370-78757392 CACGCAGGAAAGCAAGTTGCTGG - Intergenic
1130258380 15:82336439-82336461 CACGCAGGAAAGCAAGTTGCTGG + Intergenic
1130596545 15:85253521-85253543 CACGCAGGAAAGCAAGTTGCTGG - Intergenic
1131325097 15:91435416-91435438 GAGGAAGGAAAGGAAGTAGTAGG + Intergenic
1131800947 15:96069110-96069132 TAGGCAGAAATGGGAGTTGCCGG + Intergenic
1132196730 15:99919240-99919262 GAGGCAGGCAAGGAAGTAGGAGG - Intergenic
1132902261 16:2263578-2263600 CAGGCTGGGAAGGCAGCTGCTGG + Intronic
1132973429 16:2700128-2700150 CAGGGAGGAGGGGAAGGTGCGGG - Intronic
1133002312 16:2857572-2857594 CAGGCTGGACGGGAAGCTGCGGG - Intronic
1133085078 16:3356071-3356093 CAGGCGGGAAAGCAAGATGATGG - Exonic
1133119457 16:3597258-3597280 CAGGAAGGAAAGGCAGAGGCGGG - Intronic
1133287976 16:4699331-4699353 CAGGCAGGGCAGGATGTTGCAGG + Intronic
1134860282 16:17554626-17554648 CATGAAGGAAAGGGAGTTGCGGG - Intergenic
1135196988 16:20402907-20402929 CAGGCTAGAAAGGCAGGTGCCGG - Intronic
1135553401 16:23415769-23415791 TACGCAGGAAAGGCAGGTGCAGG - Intronic
1137804597 16:51292155-51292177 CAGGAATTAAAGGAAGTTGGAGG - Intergenic
1138086896 16:54141714-54141736 GAGGCAGTAGAGGAAATTGCTGG + Intergenic
1138342524 16:56299517-56299539 CAGGGAAGAAAGGAAGGTGGGGG - Intronic
1138430140 16:56963201-56963223 CAGGGAGGAAAGGCAGCAGCTGG + Intronic
1140187018 16:72783472-72783494 CAGGCATGGCAGGAAGTTGCAGG - Exonic
1141815030 16:86404024-86404046 CAAGGAGGGAAGGAAGGTGCCGG + Intergenic
1142134451 16:88445179-88445201 AGGGCTGGAAAGGATGTTGCTGG - Intergenic
1142205153 16:88779459-88779481 TAGCCAGGAAAGGAGGTTGGGGG - Intronic
1142269338 16:89080945-89080967 TAGGCAGTAAAGGAAGACGCAGG + Intergenic
1142465421 17:134350-134372 CAGGCAGCTAGGGACGTTGCAGG + Intergenic
1142590943 17:1005777-1005799 CAGGCAGAAAAGGTAGTGACCGG - Exonic
1142674520 17:1505497-1505519 CAGGCAGGAAAGGAGGTAAGAGG - Intronic
1143285105 17:5782974-5782996 CAATCAGGAAAGGGAGTTGGGGG + Intronic
1143595266 17:7910131-7910153 CATGGAGGAAAGGAAGATGGGGG - Intronic
1144210674 17:13012498-13012520 CAGGGAGGAGAGGAATGTGCCGG - Intronic
1144672585 17:17141326-17141348 CAGGAAGCTAAGGAAGCTGCTGG - Intronic
1144730842 17:17525401-17525423 CAGGCAGGGAAGGAAGTTCTGGG - Intronic
1146953118 17:36920395-36920417 CAGGCAGGAAGGGAAGTACGAGG - Intergenic
1147481162 17:40764636-40764658 GAGGCAGAAAAGGGAGGTGCTGG + Intergenic
1147977953 17:44258737-44258759 CGGGCAGGAAAAGCAGTTCCTGG - Intronic
1151354580 17:73550827-73550849 CAGGGAGGAAGTGAGGTTGCTGG + Intronic
1153163700 18:2238376-2238398 CAGGCGGGAAAGCAGGTTGGTGG - Intergenic
1156453153 18:37278061-37278083 CCGGCAAAAAAGGAAGTGGCTGG - Intronic
1156841376 18:41614009-41614031 GAGGAAGGACAGGAAGTTGATGG + Intergenic
1157503113 18:48204475-48204497 CATGCAGGAAGGGAAGGTACAGG + Intronic
1157881282 18:51323195-51323217 AAGGCAGAAAAGGAAGTGGAAGG - Intergenic
1158029480 18:52945932-52945954 TAGTCAGGAATGGAAGTTCCAGG - Intronic
1158928244 18:62293347-62293369 CAGGCAGGAATTGATGTTTCAGG + Intronic
1158946340 18:62450214-62450236 AAGGCTGGAGAGGCAGTTGCTGG + Intergenic
1159650647 18:70973813-70973835 CAGCCAGGAAAGGGAGTAGCGGG - Intergenic
1159776017 18:72603637-72603659 GACGAATGAAAGGAAGTTGCAGG - Intronic
1159858338 18:73615903-73615925 CAGACAGGAGAGGAAGAGGCTGG + Intergenic
1160235672 18:77084491-77084513 GAGGCCGGACAGGCAGTTGCTGG - Intronic
1160873779 19:1288112-1288134 CAGGCAGGAGAGGAAGGAGGAGG - Intronic
1162936827 19:13985698-13985720 CAGGAAGGAAAGTAAGCTGGGGG + Intronic
1163352731 19:16788644-16788666 GTGGCTGGACAGGAAGTTGCTGG + Intronic
1163431059 19:17267930-17267952 AAGGAAGAAAAGGAAGTTGGTGG + Intronic
1164529955 19:29041066-29041088 CAGGCAGGGAAGGAAGGTCTGGG + Intergenic
1166648008 19:44547213-44547235 CAAGCCGGAAAGGGAGTTGGAGG + Intergenic
1166962768 19:46508941-46508963 CTGGCTGGAAAGGAACATGCAGG + Intronic
1167017269 19:46849451-46849473 CAGGCAGGAAGGGACGTTGGGGG + Intronic
1167388296 19:49177692-49177714 CAGGCAGGGAAGGGAGATGAAGG - Intronic
1167514358 19:49914478-49914500 CAGGCAGGAAGGGAAGGGACTGG - Intronic
1168443267 19:56390170-56390192 CAAGCAGGAGAGGCAGTTGCAGG + Intronic
925914982 2:8598305-8598327 GAGGCAGGAGAGGAAGCTGGGGG + Intergenic
926013983 2:9432590-9432612 CATGAAGTTAAGGAAGTTGCGGG + Exonic
927887735 2:26728813-26728835 CAGGGAGGAAAGGCAGAAGCTGG + Exonic
927928385 2:27028255-27028277 AAAGCAGGCAAGGAACTTGCTGG - Intergenic
928033121 2:27798173-27798195 GGAGCAGGAAAGGAAGTTGGGGG + Intronic
928057115 2:28067793-28067815 CAGGAAGGAAGGGCAGATGCTGG + Intronic
929560128 2:42951302-42951324 AAGGAAGGAAAGGCAGTGGCTGG + Intergenic
929599871 2:43198331-43198353 CACCCAGGAAAGGAAAGTGCCGG + Intergenic
930225348 2:48786720-48786742 CAGGCAGAAAGGGAAGAGGCAGG - Intergenic
930862008 2:56084280-56084302 CATGCAGGCAGGGAATTTGCTGG + Intergenic
930909205 2:56610598-56610620 CTGGCAGGAAAAGAAGTAGAGGG - Intergenic
931189825 2:59989575-59989597 AAGGAAGGAAAGAAAGTTGGGGG - Intergenic
932420348 2:71597718-71597740 CAGGCTGGAAAGGAGTTTGGGGG + Intronic
932445606 2:71779204-71779226 CAGGCAGGAACTGGAGTTGAGGG - Intergenic
932576196 2:72963648-72963670 CAGGGAGTAAAGGAAGCTGGGGG + Intronic
932617616 2:73244541-73244563 CAGGGAGCAGAGGAAGCTGCTGG + Exonic
932733849 2:74240308-74240330 AAGGCAGGAAAGGAGGCTGCTGG - Intronic
933619939 2:84527161-84527183 CAGGCAGGAAGGAAAGTTGGAGG + Intronic
933628489 2:84629803-84629825 CAGATAGGACAGGATGTTGCAGG - Intronic
934558664 2:95300903-95300925 CAGCCAGGAAAAGCAGCTGCTGG + Intronic
934708619 2:96501578-96501600 CAGGCTGGAGAGGAAGTCCCAGG + Intronic
934916921 2:98307905-98307927 AAGGAAGGAAAGGAGGTTGGGGG - Intronic
935599071 2:104903915-104903937 GAGCAAGGAAAGGAACTTGCTGG - Intergenic
936060859 2:109294903-109294925 CAGGGAGGGAAGGAAGTGGGTGG + Intronic
936373256 2:111920322-111920344 CAGGAAGGAAAGGAAGTAAATGG - Intronic
937207609 2:120246513-120246535 GAGGAAGGAAAGGATGTTGGTGG - Intronic
937354788 2:121191461-121191483 CAGGCAGGAAATGAAGTAAAGGG + Intergenic
937942388 2:127296183-127296205 CAGGTAGGAAAGGGATTGGCAGG + Intergenic
938170458 2:129071028-129071050 CAGGCAGGAAAGCCAGTTCCAGG - Intergenic
938815992 2:134904653-134904675 GAGTCAAGAAAGGAAGTTGGAGG + Intergenic
939212290 2:139192113-139192135 TAGGCAGGAAAGAAAATAGCAGG - Intergenic
941210287 2:162629290-162629312 TGGCCAGGAAAGGAAGCTGCTGG - Intronic
942827836 2:180201790-180201812 CAGGCAGAAAATGATTTTGCAGG + Intergenic
942876673 2:180808158-180808180 CAAGCAAGAAAGGAAATTACCGG + Intergenic
943739232 2:191392999-191393021 CATACAGGAAAGGAATTTTCAGG - Intronic
944534597 2:200696609-200696631 GAGGCTGGAAAGGAAGGTGGAGG + Intergenic
945848017 2:214971087-214971109 CAGGAAGCAAAGAAAGTTACAGG - Intronic
945855841 2:215068719-215068741 CAGGGAGGAAAGGCAGCAGCAGG - Intronic
945891651 2:215436384-215436406 CTGGGAGGAAAGGGAGTGGCTGG + Intergenic
946595815 2:221304890-221304912 CATGCAGGAAAGGAATTGCCAGG - Intergenic
947215215 2:227744007-227744029 CAGGCAGGTCTGGAAGTAGCAGG + Intergenic
947444612 2:230154566-230154588 AAGGCAGGAATGGAAGTAGCAGG + Intergenic
947718534 2:232353694-232353716 GAGGCTGGACAGGCAGTTGCTGG - Intergenic
948214177 2:236216343-236216365 CAGGCAGGTGAGGGAGTTCCTGG - Intronic
948292629 2:236837414-236837436 CAGACAGAAAAGGAAGGTGTGGG + Intergenic
948796614 2:240406136-240406158 CAGGCAGGCAAGGGACTTGCCGG + Intergenic
1168758040 20:329391-329413 CAGGCAGGAAAGCAACTTAAAGG + Exonic
1168874200 20:1159460-1159482 AAGGCTAGAAAGGCAGTTGCAGG - Intronic
1169901444 20:10556824-10556846 CAGTCAGGAAAGCCAGTAGCCGG + Intronic
1170429073 20:16260336-16260358 CAGGCAGGAGTGGAAGGTGAAGG - Intergenic
1170874262 20:20235628-20235650 CAGGGAGGAAATAAAGTGGCTGG - Intronic
1171013033 20:21518772-21518794 CAGGCAAGAAAGGAAGATACAGG + Intergenic
1171320281 20:24237138-24237160 GAGGCTGGACAGGCAGTTGCTGG - Intergenic
1171779375 20:29405422-29405444 GAGACTGGAAAGGAGGTTGCAGG - Intergenic
1173123711 20:40317474-40317496 CAGGCAGGACTGCAATTTGCTGG - Intergenic
1173465271 20:43276028-43276050 CTGGAAGGAGAGGAGGTTGCAGG - Intergenic
1173553214 20:43947852-43947874 CTGGCTGGGAAGGAAGGTGCTGG + Intronic
1173873793 20:46357367-46357389 CTGGCAGGAGAGGGAGCTGCGGG + Intronic
1174307854 20:49627261-49627283 CTGCAAGGAAATGAAGTTGCAGG + Intergenic
1174410305 20:50330774-50330796 CAGCCAGGGTGGGAAGTTGCTGG + Intergenic
1175053684 20:56178422-56178444 CAGGGAGTGAAGGAAGCTGCAGG + Intergenic
1175298139 20:57923407-57923429 CCAGCAGGAAAGGAGGTTGAGGG + Intergenic
1175602028 20:60281997-60282019 CAGGCAGGACAAGAAGTTTGTGG + Intergenic
1175619805 20:60433924-60433946 GAGGTTGGACAGGAAGTTGCTGG + Intergenic
1175737500 20:61397300-61397322 GAGGCAGGAAGGGCAGCTGCAGG + Intronic
1175802449 20:61808681-61808703 CACACTGGAAAGGCAGTTGCAGG - Intronic
1176306337 21:5125331-5125353 CAGGCAGGAAAAGAAATCACAGG + Intronic
1176675002 21:9769467-9769489 CTAGCAGGACTGGAAGTTGCTGG + Intergenic
1176742196 21:10615169-10615191 CAGGTATGTAAGGCAGTTGCCGG - Intergenic
1177050858 21:16230833-16230855 CAGGCTGGAAAGGTAGCTCCTGG + Intergenic
1177893686 21:26836787-26836809 TAGGAAAGAAAGGAAGTTGGAGG + Exonic
1178885160 21:36479328-36479350 CCTACAGGAAAGGAAGCTGCAGG - Intronic
1179073762 21:38098704-38098726 CAGACAGGAAAGGGAGTAGGAGG - Intronic
1179519408 21:41932243-41932265 CAGGCAGGGCATGAAGCTGCTGG + Intronic
1179850721 21:44136699-44136721 CAGGCAGGAAAAGAAATCACAGG - Intronic
1180092098 21:45538483-45538505 CAGGCAGGAACGGACGCTGCTGG + Intronic
1181045455 22:20212084-20212106 CAGGCTGGAAAGGCAGGTGCTGG - Intergenic
1181710824 22:24686928-24686950 CAGCCAGGACAGGAAGGTGGTGG + Intergenic
1181821951 22:25483336-25483358 CAGGCAGGAGAGGGAGCAGCAGG - Intergenic
1182190977 22:28460482-28460504 TGGGCAGAAAAGCAAGTTGCAGG - Intronic
1182829479 22:33293137-33293159 CAGTCAGGAAAGGGTGTTCCAGG + Intronic
1183545353 22:38452478-38452500 AAGACAGGAAAGAAAGTTGAGGG + Intronic
1183709463 22:39494245-39494267 GAGGCAGGCAAGGAATTTACTGG + Intergenic
1184281796 22:43441588-43441610 CAGGCAGGGGAGGAAGATGAGGG + Intronic
1184729876 22:46366227-46366249 GGGGCAGGGAGGGAAGTTGCGGG + Intronic
1185083787 22:48724881-48724903 CAGGGAGGAAAGGCAGTGGGTGG + Intronic
1185334672 22:50266184-50266206 CAGCCAGGAGAGGGAGCTGCTGG + Intronic
949100486 3:138365-138387 AAGGCAGGACAGGCAGTTGCTGG + Intergenic
952776408 3:37050602-37050624 CAGGCAGGTTAGCAAGCTGCAGG - Exonic
952827914 3:37539342-37539364 CAGGAAAGGAAGGCAGTTGCAGG + Intronic
953724843 3:45388764-45388786 AGGGCAGGAAGGGAAGGTGCGGG + Intronic
954287756 3:49630833-49630855 GAGGCAGGAAAGGGAGGTGATGG + Intronic
954310200 3:49760730-49760752 GAGTCAGGAAAGGAAGTTGAGGG - Intronic
954660328 3:52223650-52223672 CAGGCTGGAAGGCAGGTTGCGGG + Exonic
954882066 3:53843249-53843271 CAGATAGGAAAGCAAGTTGAAGG - Intronic
955617650 3:60825903-60825925 CAGGCAGCAAAGAAAGTGGAGGG + Intronic
957145395 3:76416780-76416802 GAGGCAAGAAAGAAAGTTGACGG - Intronic
957479289 3:80770736-80770758 CAGGCAGGCACAGAAGTGGCTGG - Intergenic
960612657 3:119569350-119569372 AAGGCAGCCAAGGAAGTTGGGGG - Intergenic
961400807 3:126641036-126641058 GAGGCTGGACAGGCAGTTGCTGG - Intronic
962312822 3:134338090-134338112 CAGGCTGAAAAGGAAATTGCTGG - Intergenic
963024626 3:140906918-140906940 CAGGTTGGACAGGCAGTTGCTGG + Intergenic
964256185 3:154776982-154777004 CAGGCAGGAGAAGAATCTGCAGG - Intergenic
966684769 3:182682399-182682421 CAGGCAGGAAGCGGCGTTGCGGG - Intergenic
968502423 4:957118-957140 CAGCAAGGGCAGGAAGTTGCTGG - Intronic
969289994 4:6232735-6232757 CAGTGGGGAAAGGGAGTTGCAGG + Intergenic
969506424 4:7590980-7591002 CAGTCAGGAAAGGGATTTGCAGG + Intronic
969585257 4:8087851-8087873 CAGCCAGGGATGGAAGTTTCTGG - Intronic
969938021 4:10702257-10702279 AAGGGAAGAAAGGACGTTGCAGG + Intergenic
970386606 4:15562984-15563006 TAGGCAGACAAGGAAGATGCAGG + Intronic
971458124 4:26862896-26862918 CATGCAGGAAGGGAAGGAGCAGG + Intronic
973334741 4:48944639-48944661 CGGGAACAAAAGGAAGTTGCTGG + Intergenic
975348110 4:73316940-73316962 CAGGCAGGAAAGCAATTTCTTGG + Intergenic
975813084 4:78190023-78190045 CGGCCAGGAAAGGATGTAGCTGG - Intronic
976207913 4:82639802-82639824 GAGGAAGGAGAGGAAGCTGCTGG - Intronic
976291989 4:83428645-83428667 CAGGAAAAAAAGCAAGTTGCAGG + Intronic
976727731 4:88231141-88231163 CAGGCAGGAAGGAAAGTTCCTGG - Intronic
977554137 4:98471511-98471533 CTGGCAGGAAAGGGAGATGATGG + Exonic
977764388 4:100779444-100779466 AAGGTTGGACAGGAAGTTGCTGG - Intronic
979168804 4:117573001-117573023 CAGGGAGAAAGGGAAGTGGCAGG + Intergenic
980105007 4:128579271-128579293 CAGGCAGGAGAGTAAGTTACAGG - Intergenic
980378512 4:131978269-131978291 CAGGCAGGCCCTGAAGTTGCCGG + Intergenic
983869856 4:172812581-172812603 CACACAGGAAAGGAAGGTGTTGG + Intronic
984488776 4:180405790-180405812 CAGGCACGAAAGAAAGCTGGGGG - Intergenic
985400551 4:189589227-189589249 CTAGCAGGACTGGAAGTTGCTGG - Intergenic
985509280 5:303058-303080 GAGGAAGGAAAGGAAGGAGCTGG + Intronic
985738993 5:1603834-1603856 GAGGAAGGAAAGGAAGGAGCTGG - Intergenic
986401495 5:7385942-7385964 TAGGGAGGAGAGGAAGTTGTTGG - Intergenic
986584102 5:9296823-9296845 CAGGCAGGAAAGGAGGGTAAGGG + Intronic
987154052 5:15070077-15070099 AAGGCTGGACAGGAAGTTGCTGG + Intergenic
987370791 5:17191180-17191202 CAGGCAGGAAAGCAACAAGCAGG - Intronic
988921575 5:35947178-35947200 AAGGTAGGATAGGCAGTTGCTGG + Intergenic
989519458 5:42383614-42383636 CAGCCAAGAAAGGAAGTGGGGGG + Intergenic
990169183 5:53028914-53028936 CTGGCAGGAAGGGAAGCTGAAGG - Intronic
990504452 5:56430772-56430794 CAGGCAAGAAAGGAAGGGTCAGG - Intergenic
991193776 5:63907446-63907468 CAGGCAAGAAAGGAACTTAGTGG - Intergenic
991668937 5:69027619-69027641 GATGGAGGAAAGGAAGTTGGCGG + Intergenic
993100899 5:83538584-83538606 CAAGCCGAAAAGGAAGTAGCTGG + Exonic
997369725 5:133350811-133350833 CAGGGAGGAAAGGAAGAAGGAGG + Intronic
997834486 5:137181226-137181248 GAGGCAGGAGAGGAAGGTGGAGG + Intronic
998386900 5:141762411-141762433 CTGGAAGGAAAGGAAGTTCGAGG + Intergenic
998583743 5:143404716-143404738 CAGGCTTAAAAGCAAGTTGCAGG + Intronic
998690385 5:144581141-144581163 CAGGCAGGAATGGCAGCAGCTGG + Intergenic
999459390 5:151744893-151744915 AAGGCAGGAAAGCAGGTTGGAGG + Intronic
999623088 5:153491611-153491633 AAGGCAGGCGAGGAAGTTCCAGG - Intronic
1000168816 5:158681567-158681589 AAGAAAAGAAAGGAAGTTGCCGG + Intergenic
1001190920 5:169630396-169630418 GAGGCAGGAAATGAAGCTGTCGG + Intergenic
1001305761 5:170571388-170571410 AAGGCAGGAGAGAAAGGTGCTGG - Intronic
1001541900 5:172545480-172545502 CCGAGAGGAAAGGAACTTGCAGG - Intergenic
1001871288 5:175158109-175158131 AAGGCAGGAGAGGGAGTTGTTGG - Intergenic
1002088142 5:176788706-176788728 CTGGCAGGAAAGCAAGATCCTGG + Intergenic
1002196684 5:177504999-177505021 CTGGCAGGAAGGTAAGTTGGAGG - Exonic
1002698894 5:181108889-181108911 CAGGCAGGGTAGGAAGTGGGAGG + Intergenic
1003950473 6:11111204-11111226 AAGGCAGAGAAGAAAGTTGCAGG + Intronic
1004785639 6:18964635-18964657 AAGGCAGAAAAGGAGGTTGGAGG + Intergenic
1006865148 6:37203382-37203404 GAGGCTGGAGAGGAAGATGCCGG + Intergenic
1007261386 6:40566222-40566244 AAGTCAGGAAACAAAGTTGCTGG + Intronic
1007419535 6:41711501-41711523 CAGGCAGGGAAGAGAGATGCTGG - Intronic
1007659337 6:43473650-43473672 CAGGTATTAAAGGAAATTGCTGG - Intergenic
1007738130 6:43994509-43994531 CAGGAAGGGAGGGAAGCTGCAGG + Intergenic
1007938591 6:45755555-45755577 GAGGCAGGAAATGAAGGAGCAGG - Intergenic
1008072480 6:47111883-47111905 CAGAAAGGAAAGGAAGTCTCAGG - Intergenic
1008138657 6:47806699-47806721 GAGGCAGGAAAGAAAGATTCAGG - Intronic
1009701782 6:67193647-67193669 AAGTCAGGAAACAAAGTTGCTGG - Intergenic
1010249689 6:73694994-73695016 AAGGGAGGAAAGCAAGTTTCTGG + Intergenic
1010773230 6:79856885-79856907 GAGGCAGGAATTGAGGTTGCTGG - Intergenic
1011134559 6:84086303-84086325 CAGGTTGGACAGGCAGTTGCTGG + Intronic
1011480141 6:87785728-87785750 GAGGCAGGAAGGGAAATTGCTGG - Intergenic
1013349534 6:109292612-109292634 CAGGCAGGACTGGAAATGGCAGG + Intergenic
1014524911 6:122490970-122490992 GAGGCAGGAACTGAGGTTGCTGG - Intronic
1014871722 6:126604069-126604091 CAGGTAGAAAAGGTAGATGCAGG - Intergenic
1016116777 6:140296160-140296182 GAGGCAGGGAAGGATGTAGCAGG + Intergenic
1017166024 6:151409169-151409191 CAGGTGGGAAAGGAAGATGAGGG + Intronic
1017644679 6:156527838-156527860 CAGGCAGGAGAGCAAGATTCAGG - Intergenic
1017823540 6:158065302-158065324 CAGGCAGCTGAGGAAGTTTCTGG - Intronic
1017955992 6:159178170-159178192 GAGGATGGACAGGAAGTTGCTGG - Intronic
1018199280 6:161380179-161380201 CAGGCAGGGAAGGAACTTATGGG - Intronic
1018238470 6:161749441-161749463 GAGGAAGGAAAGTAATTTGCAGG + Intronic
1018370057 6:163159894-163159916 GAGGCAGGAGAGGAAGTCACGGG - Intronic
1018763867 6:166914242-166914264 GAGACTGGAAAGGCAGTTGCTGG - Intronic
1019124170 6:169828227-169828249 CAGGCAGGAAAGGAGGTGCATGG - Intergenic
1019316226 7:388216-388238 CACACAGGAAAGGAAGTCGGTGG - Intergenic
1020149863 7:5673541-5673563 CAGGGAAGAGAGCAAGTTGCAGG + Intronic
1020917302 7:14210800-14210822 CAGAGAGGAAAGGTAGGTGCTGG - Intronic
1021199303 7:17710502-17710524 CAGGGATGAAAGGCTGTTGCTGG - Intergenic
1021442621 7:20694622-20694644 CAGGTAGGAAAGGAACATGTAGG + Intronic
1021618156 7:22523755-22523777 CTGGCAGGAAAAAGAGTTGCTGG + Intronic
1022315001 7:29237638-29237660 CAGACAGGAAAGGAGGTTGCAGG + Intronic
1022565264 7:31393387-31393409 GAGGTTGGAAAGGCAGTTGCTGG - Intergenic
1022694572 7:32691719-32691741 CTGGCAGGAAAAAGAGTTGCTGG + Intergenic
1022826170 7:34016562-34016584 CAGGAACAAAAAGAAGTTGCAGG - Intronic
1022927752 7:35073230-35073252 CTGGCAGGAAAAAGAGTTGCTGG + Intergenic
1023435202 7:40134824-40134846 CAGACTGGAAAGGTTGTTGCTGG - Intergenic
1023876770 7:44290482-44290504 CAGGCAAGAAAGGACGTAGGTGG - Intronic
1024470223 7:49761789-49761811 GAGGCTGGACAGGCAGTTGCTGG + Intergenic
1026805738 7:73428995-73429017 GAGGCAGGAAAGGAAGGGGAGGG + Intergenic
1027428775 7:78088601-78088623 CAGGGAGGAAAAGAAGTTACAGG + Intronic
1028374524 7:90132354-90132376 CTGGCAGGAAAAAGAGTTGCTGG - Intergenic
1028467003 7:91163739-91163761 GAGGGAGGAAAGGAAGTTGTTGG - Intronic
1028891619 7:95994403-95994425 CAGGCAAGGAAGGAAGTGGTTGG + Intronic
1029344227 7:99966945-99966967 CAGGCAGGAAGGGCAGCTACTGG + Exonic
1029347267 7:99987577-99987599 CAGGCAGGAAGGGCAGCTACTGG - Intergenic
1029978030 7:104852377-104852399 TAGGCAGGAAAGGGAGGTGGAGG + Intronic
1030412348 7:109197362-109197384 AAGGCTGGACAGGCAGTTGCTGG + Intergenic
1031596492 7:123655879-123655901 CAGGCAGGGAGGCAAGTGGCAGG - Exonic
1031850544 7:126857903-126857925 CAGGCTGGAAATGTAGTGGCAGG - Intronic
1032012199 7:128353975-128353997 CAGGCAGCAAGGGAAGATGCTGG + Intronic
1032414380 7:131725139-131725161 AAGGAATGGAAGGAAGTTGCTGG + Intergenic
1033344380 7:140515906-140515928 GAGGCTGGACAGGCAGTTGCTGG + Intergenic
1034024540 7:147685878-147685900 CAGGTATAAAAGGAATTTGCTGG + Intronic
1034064382 7:148122447-148122469 CAGGGAAAAAAGGAAGTTTCAGG + Intronic
1034700314 7:153089579-153089601 GAGGCTGGACAGGCAGTTGCAGG + Intergenic
1034849763 7:154482754-154482776 GTGACAGGAAAGGAAGTGGCAGG + Intronic
1034869148 7:154668061-154668083 CAGGAAGGGAAGGAAGGTGAAGG - Intronic
1035330422 7:158093252-158093274 GAGTCAGGAAAGGACGGTGCAGG - Intronic
1035330436 7:158093316-158093338 GAGTCAGGAAAGGACGGTGCAGG - Intronic
1035679423 8:1477164-1477186 CAGATGGGAGAGGAAGTTGCGGG + Intergenic
1036824375 8:11964929-11964951 GAGGCTGGACAGGAAGCTGCCGG + Intergenic
1037525859 8:19723548-19723570 CACTAAGGAACGGAAGTTGCTGG + Intronic
1037604465 8:20425727-20425749 CTGGGAAGAAAGGAAGTTGCTGG + Intergenic
1037962468 8:23108157-23108179 CAGGAAGGAAAGGAAGGAACAGG + Intronic
1038289833 8:26239206-26239228 CAGGCAAGAGAGCATGTTGCAGG + Intergenic
1038680122 8:29659030-29659052 AAGGCAGGACAGGAATGTGCTGG + Intergenic
1038882218 8:31627616-31627638 GAGGAAGGAAAAGAAGTTGTAGG - Intergenic
1039057936 8:33551302-33551324 CAGGCAGAGAAGGAAGCTTCTGG + Intronic
1039111572 8:34045965-34045987 CATGCAGCAAAGGAAGTTCAGGG - Intergenic
1039848779 8:41344625-41344647 AAGGCAGGAAAGGAAGCAGATGG - Intergenic
1041550677 8:59097240-59097262 CAGACAGGTATGGAAGTTGGTGG - Intronic
1042173069 8:66010962-66010984 TAGGTAGGAAAGAAAGTTGAAGG + Intergenic
1042735184 8:71979521-71979543 CAAGCAGGAAAGGAAGTCACTGG - Intronic
1043159725 8:76830881-76830903 AAGGCCGGAAACCAAGTTGCGGG - Intronic
1043537954 8:81226746-81226768 CAGGCAAGGAAGGAAGATGGTGG - Intergenic
1044334488 8:90963064-90963086 CAAGCAGGAAATGAAGGTGAAGG + Intronic
1045412596 8:101933604-101933626 CAGCATGGAAAGGCAGTTGCAGG - Intronic
1047208668 8:122822978-122823000 TAGACAGGAAAGGACGTTGCAGG + Intronic
1047536974 8:125728910-125728932 CAGGAGGGAAAGGAAGCCGCTGG - Intergenic
1048144363 8:131825729-131825751 CAGGCAGCAAAGGAGACTGCAGG + Intergenic
1048192383 8:132301641-132301663 CAGGAAGGTAAGGAAGATGAAGG + Intronic
1048296134 8:133215563-133215585 CAGGCAGGACAGGCAGTTTCTGG - Intronic
1048617635 8:136095255-136095277 CAGGCAGGAGAGGAAAATGGGGG + Intergenic
1049218308 8:141417718-141417740 CAGCCAGGAAAGGGAAGTGCGGG - Intronic
1049689616 8:143952898-143952920 CAGGCGGGAAGGGAAGCCGCAGG + Intronic
1049696615 8:143987013-143987035 CAGGCAGGACAGAAAGCTGCAGG - Intronic
1049893484 9:92748-92770 CAGGCTGGACAGGCAGTTGTTGG + Intergenic
1050943622 9:11490320-11490342 TAGACATGAAAGGAAGTAGCTGG + Intergenic
1053147092 9:35719120-35719142 CAGGCAGCAAAGGGCCTTGCGGG - Exonic
1053213416 9:36251136-36251158 CAAGGAGGAAAGGAAGTTTTAGG - Intronic
1055879244 9:80978957-80978979 CAGGTTGGATAGGTAGTTGCTGG - Intergenic
1056213060 9:84382929-84382951 CAGGCTGGACAAGCAGTTGCTGG - Intergenic
1056214202 9:84392866-84392888 CAGGCTGCAAAGGCAGTTGGTGG - Intergenic
1056376826 9:86022803-86022825 CAAGCAGGAAAGGAAGGGGAGGG - Intergenic
1056666884 9:88588284-88588306 CAGGCAGGAAATGGGGTTGCGGG + Intergenic
1057930473 9:99188924-99188946 TAGCTAGGAAAGGAAGGTGCAGG + Intergenic
1059336893 9:113574765-113574787 CAGGCAGAAAAGCAGGGTGCCGG + Intronic
1059703789 9:116801149-116801171 GAGGGAGGAAAGGAAGTAGTAGG + Intronic
1060763650 9:126276652-126276674 CAGGAAGGAGAGGAGGCTGCTGG + Intergenic
1061835237 9:133324258-133324280 CAGGCAGGAGAGGCGGTGGCGGG + Intergenic
1062062476 9:134503861-134503883 AAGGCAGGGAAGGCAGTTGAAGG - Intergenic
1062521524 9:136959861-136959883 CAGGCGGGAATGGAATTTTCGGG + Intergenic
1062587640 9:137256517-137256539 CAGGCAGCACAGGAAGCTCCCGG - Intronic
1186423464 X:9444722-9444744 CAGGCAGGAAGTGAAGTAGGTGG + Intergenic
1187581948 X:20616583-20616605 AAGGCAGCCAAGGGAGTTGCAGG + Intergenic
1188395839 X:29682392-29682414 AAGGCAGGAGAGGAAATTTCAGG - Intronic
1189255703 X:39637296-39637318 CAGCCAAGCAAGGAAGCTGCGGG + Intergenic
1190739420 X:53279700-53279722 CAGGGAGGGAGGGAAGTGGCAGG + Intronic
1191174230 X:57482497-57482519 CAGGAAGTACAGGAAGTTGGGGG - Intronic
1192529386 X:71872274-71872296 CAGGCAGGAAAGGCTCTTCCCGG + Intergenic
1192938976 X:75893006-75893028 CAGGCAAGAAAGGATGTCCCAGG + Intergenic
1195701195 X:107706993-107707015 AAGGAAGGAAAGGAAGGAGCCGG + Intergenic
1196798189 X:119519211-119519233 GAGGCTGGACAGGCAGTTGCTGG + Intergenic
1199052354 X:143251819-143251841 CAGCCAGGGAATGAAGATGCAGG + Intergenic
1199478123 X:148268661-148268683 CATGGAGGAAAGGAAGAGGCTGG + Intergenic
1200145076 X:153922181-153922203 CCGGCGGGAAAGGAAGTCGCAGG - Intronic
1201600233 Y:15720400-15720422 CAGGCACGAAGAGCAGTTGCAGG + Intergenic
1201724924 Y:17140847-17140869 CAGGCAGGAAAGGAAGAAGAAGG + Intergenic
1201791560 Y:17846604-17846626 CAGGGAGGAAAGGTAATTGTTGG + Intergenic
1201799468 Y:17939282-17939304 CAGGGAGGAAAGGTAATTGTTGG + Intergenic
1201802085 Y:17966674-17966696 CAGGGAGGAAAGGTAATTGTTGG - Intergenic
1201809994 Y:18059385-18059407 CAGGGAGGAAAGGTAATTGTTGG - Intergenic
1202353168 Y:24016256-24016278 CAGGGAGGAAAGGCAATTGTTGG + Intergenic
1202362072 Y:24121329-24121351 CAGGGAGGAAAGGTAATTGTTGG - Intergenic
1202363001 Y:24131767-24131789 CAGGGAGGAAAGGTAATTGTTGG + Intergenic
1202507777 Y:25538349-25538371 CAGGGAGGAAAGGTAATTGTTGG - Intergenic
1202508707 Y:25548785-25548807 CAGGGAGGAAAGGTAATTGTTGG + Intergenic
1202517611 Y:25653859-25653881 CAGGGAGGAAAGGCAATTGTTGG - Intergenic
1202575313 Y:26317959-26317981 TAGGCAGGAAAGGAATCTGTGGG + Intergenic