ID: 1121335158

View in Genome Browser
Species Human (GRCh38)
Location 14:93073426-93073448
Sequence TAACCTTCCCGAGGTGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121335158_1121335163 16 Left 1121335158 14:93073426-93073448 CCACACCCACCTCGGGAAGGTTA 0: 1
1: 0
2: 1
3: 5
4: 97
Right 1121335163 14:93073465-93073487 TAAAGTAAACCCATGATGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 135
1121335158_1121335164 24 Left 1121335158 14:93073426-93073448 CCACACCCACCTCGGGAAGGTTA 0: 1
1: 0
2: 1
3: 5
4: 97
Right 1121335164 14:93073473-93073495 ACCCATGATGCCTGGTACACTGG 0: 1
1: 0
2: 1
3: 13
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121335158 Original CRISPR TAACCTTCCCGAGGTGGGTG TGG (reversed) Intronic
900756988 1:4442863-4442885 TAACCTTCTCGAGATATGTGAGG - Intergenic
904492497 1:30869766-30869788 GAACCTGCCTGGGGTGGGTGGGG - Intronic
906688798 1:47779327-47779349 GAACCCTCCAGAGGTGTGTGTGG + Intronic
907538155 1:55184345-55184367 TAACCTTTCCTGGCTGGGTGTGG - Intronic
913105532 1:115610470-115610492 TTACAGTCCTGAGGTGGGTGGGG + Intergenic
918058509 1:181043194-181043216 TTCCCTTCCTGTGGTGGGTGAGG - Intronic
1064614902 10:17142755-17142777 TAACCTTCCTCTGTTGGGTGAGG + Intronic
1064954804 10:20895965-20895987 TAACCTTCCCAAGGTTACTGGGG + Intronic
1069629574 10:69889458-69889480 CTGCCTTCCCGAGATGGGTGGGG + Intronic
1070703153 10:78618050-78618072 TCTCCTTCCTGGGGTGGGTGAGG - Intergenic
1071336606 10:84605521-84605543 TATCCTTTCCCAGGTGGATGCGG - Intergenic
1072825522 10:98602223-98602245 TCACTTTCCCAAGGAGGGTGAGG + Intronic
1073987152 10:109222724-109222746 GAACCTTCCTGAGGTGCTTGGGG - Intergenic
1076168434 10:128300819-128300841 TAACCTGCCCAAGGTGAGTCAGG - Intergenic
1076675935 10:132147748-132147770 TAGCCATCCGGTGGTGGGTGGGG - Intronic
1076882121 10:133244796-133244818 GAACCTTTCTGAGGTGGGGGTGG - Intergenic
1084343235 11:68523529-68523551 AAACCTTCTAGTGGTGGGTGGGG - Intronic
1089901414 11:121989838-121989860 CAACCTACCCCAAGTGGGTGGGG + Intergenic
1090167131 11:124561451-124561473 AAACCTTCCCAAGATGGGTCTGG - Intergenic
1091285690 11:134407508-134407530 TAACCTTGCCCAGGGGGCTGTGG - Intronic
1094587536 12:31791951-31791973 TGCCCTTCCAGAGGTTGGTGAGG - Exonic
1097999432 12:65924074-65924096 TATCCTTCCCAAGGTGGGCTGGG - Intronic
1101994107 12:109512248-109512270 TAACCTGGGCGAGGTGGTTGGGG + Intronic
1102195401 12:111021783-111021805 TGACCTTCCCACTGTGGGTGAGG - Intergenic
1102277937 12:111598044-111598066 TTCCCTTCCCCAGGTGGGGGAGG + Intronic
1103062170 12:117867399-117867421 TAGCCTTCCTCAGGTGGGTGTGG - Intronic
1103405077 12:120669230-120669252 TCACGTTCCCGAGGTCAGTGGGG + Intergenic
1105203126 13:18195565-18195587 TAGCCTTCCCGGCGGGGGTGTGG - Intergenic
1111919850 13:94398508-94398530 CAACAATCCCGAGGTGGATGTGG + Exonic
1117108712 14:52426263-52426285 GCACCTTACAGAGGTGGGTGTGG + Intergenic
1120359867 14:83485519-83485541 TAACCTTCCTGAGGTGTCTCTGG + Intergenic
1121335158 14:93073426-93073448 TAACCTTCCCGAGGTGGGTGTGG - Intronic
1124102948 15:26712752-26712774 CCACCTTCCCGAGGTGGCCGTGG - Intronic
1125561306 15:40635642-40635664 ATACATTCCCCAGGTGGGTGTGG - Intronic
1132319776 15:100917761-100917783 GACCCCTCCTGAGGTGGGTGGGG - Intergenic
1135652588 16:24219013-24219035 CCACCTGCCCCAGGTGGGTGTGG + Exonic
1138197647 16:55063494-55063516 GAAACTTCCCGAGGTGGGGAAGG + Intergenic
1138645714 16:58422977-58422999 TTACCTCCCGGAGCTGGGTGTGG - Intergenic
1138984673 16:62314102-62314124 CAACCTTCCCAAGATGGGTCTGG + Intergenic
1139397134 16:66649230-66649252 AAAAGTTCCTGAGGTGGGTGTGG + Intronic
1142183300 16:88682080-88682102 GACCCCTCCAGAGGTGGGTGGGG - Intronic
1142852894 17:2712682-2712704 TCAGCTTCCCGAGGTGGGCTGGG + Intergenic
1147572706 17:41581193-41581215 GAAGATTCCAGAGGTGGGTGGGG - Intergenic
1148124224 17:45228727-45228749 TAAAGTTCCCTGGGTGGGTGAGG + Intronic
1149162556 17:53711542-53711564 TAACCTTGCTGAAGGGGGTGGGG + Intergenic
1151707559 17:75778873-75778895 TGCCCTTCCAGAGGTTGGTGAGG - Exonic
1160762817 19:794159-794181 TAAGCTTCAGGTGGTGGGTGGGG + Intergenic
1163815499 19:19462419-19462441 TGTCCTTCCTGAGGTGGGGGAGG + Intronic
1164540200 19:29116211-29116233 CAACCTTCTGGATGTGGGTGTGG + Intergenic
1164908702 19:31988087-31988109 GACCCTCCCCGACGTGGGTGGGG + Intergenic
1166809449 19:45506930-45506952 TCACCTTCCCGGGGCGGGCGGGG + Intronic
1168492627 19:56823297-56823319 GAACCTTCCTGAGGAGGCTGGGG + Intronic
926249220 2:11144130-11144152 TGGCCTTCCCCAGGTGGGTGTGG + Exonic
926305618 2:11635668-11635690 TCACCTGCCCCAGCTGGGTGAGG + Intronic
928379124 2:30802882-30802904 TCACCTGCCCTAGGTGGGCGTGG - Intronic
928534358 2:32225851-32225873 TAACCCTCCAAAGTTGGGTGAGG - Intronic
931371162 2:61664136-61664158 TAACCTTCTGGAGGATGGTGGGG + Intergenic
939515026 2:143155625-143155647 TGACCTTCCCGACATCGGTGAGG - Exonic
948122960 2:235544468-235544490 GAACCTTCCCGTGGTCCGTGTGG + Intronic
948253332 2:236548521-236548543 TAATCTTCCCAGGGAGGGTGTGG + Intergenic
948872458 2:240810193-240810215 ATACCTTCTCCAGGTGGGTGGGG - Intronic
1174468033 20:50731996-50732018 TAAACTTGCCGAGGAGGGGGTGG + Intronic
1176714832 21:10342440-10342462 TAGCCTTCCCGGCGGGGGTGTGG + Intergenic
1180603513 22:17037498-17037520 TAGCCTTCCCGGCGGGGGTGTGG - Intergenic
1185213824 22:49587287-49587309 CACCCTTCCCGAGGTGGGGCGGG + Intronic
950454368 3:13083967-13083989 TAGCCTTCCCCAGGGAGGTGAGG + Intergenic
951443730 3:22752308-22752330 TAACCTCACCGAAGTGGGTGGGG + Intergenic
952504062 3:33991683-33991705 TAAACATCCAGAGTTGGGTGAGG + Intergenic
952861227 3:37814273-37814295 TAACCTTCCCAGGCTGGGCGCGG + Intronic
954046661 3:47937336-47937358 GAACCTTCCCGAGGATGCTGTGG - Intronic
956746146 3:72312347-72312369 GAGCCTTCCCAAGGTGGGTGAGG - Intergenic
972276543 4:37563434-37563456 TAATCTTCCCGAGGTTGCTCAGG + Intronic
986772751 5:10988536-10988558 TGACCTGCCCAAGGTGTGTGGGG + Intronic
996753490 5:126912812-126912834 AAACCTTCCCAAGCTGGGGGAGG - Intronic
997436065 5:133876564-133876586 TCACGTTACCCAGGTGGGTGTGG - Intergenic
999467142 5:151818055-151818077 GAACCTTCCCTGGCTGGGTGAGG - Intergenic
1002299042 5:178247351-178247373 TAACCTCCCCGATGTCGTTGAGG - Intronic
1006370968 6:33643341-33643363 ATTCCTTCCCGAGGTGGGGGTGG - Intronic
1006737474 6:36284738-36284760 CTACCTTCCTAAGGTGGGTGGGG + Intronic
1007196520 6:40066320-40066342 TCACCTTCCCAAGGTGGGTGGGG - Intergenic
1010579398 6:77575401-77575423 TAGTGTGCCCGAGGTGGGTGGGG - Intergenic
1018438765 6:163788836-163788858 TTTCCTTCTCGAGGTTGGTGCGG + Intergenic
1019902130 7:4029086-4029108 GACCTTTTCCGAGGTGGGTGGGG + Intronic
1022076669 7:26977964-26977986 TAAACTTCCTGAGCTGGGTGTGG - Intronic
1024715158 7:52071250-52071272 TGCCCTTCCCAATGTGGGTGGGG + Intergenic
1027423578 7:78040496-78040518 CAACCTTCCCTGGGTGGGTAAGG + Intronic
1029664504 7:101986515-101986537 TAATCTTCCCAAGGAGGATGAGG + Intronic
1031537475 7:122953208-122953230 TAACCATCACAAGATGGGTGCGG + Intergenic
1035933184 8:3807082-3807104 TAACCTTCCCCCAGTGCGTGGGG - Intronic
1037418784 8:18679562-18679584 AAATCTTGCCGAGGTTGGTGGGG - Intronic
1042152292 8:65800703-65800725 TAACCTTACTGAGGTGTGAGAGG - Intronic
1042254687 8:66790866-66790888 AAACCTTCCTGTGGAGGGTGGGG - Intronic
1044300454 8:90577397-90577419 TAACCTCCCAGAGATGGTTGTGG + Intergenic
1049341169 8:142113415-142113437 TAACCTTCCCGTGGGTGATGTGG + Intergenic
1057696405 9:97325939-97325961 TCACATTCCCAAGGTGAGTGGGG + Intronic
1059494630 9:114699461-114699483 TGACTTGCCCAAGGTGGGTGTGG + Intergenic
1059780521 9:117521590-117521612 AAACCTACCCAGGGTGGGTGTGG - Intergenic
1061783603 9:133009913-133009935 TAAATTTCCCCATGTGGGTGTGG + Intergenic
1061844928 9:133382176-133382198 CAACCTTCCCCATGTGGGTAAGG + Intronic
1188216154 X:27479871-27479893 TGACCCTCTCTAGGTGGGTGTGG - Intergenic
1189356086 X:40310778-40310800 TAGCCTTGGCAAGGTGGGTGGGG - Intergenic
1190257007 X:48770965-48770987 TAACCTCCACGAGGTGGGAAAGG + Exonic
1190436771 X:50433398-50433420 TCACCTTACGGAGGTTGGTGAGG - Intronic
1200133006 X:153861824-153861846 TTACATTCCCAAGGTGGGGGCGG + Exonic