ID: 1121337073

View in Genome Browser
Species Human (GRCh38)
Location 14:93083960-93083982
Sequence AGGGAAATTGCCGGCTTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121337073_1121337081 26 Left 1121337073 14:93083960-93083982 CCATCAAAGCCGGCAATTTCCCT 0: 1
1: 0
2: 2
3: 9
4: 117
Right 1121337081 14:93084009-93084031 TCCCTGCCCCCAGTCAGGCATGG 0: 1
1: 0
2: 2
3: 47
4: 314
1121337073_1121337080 21 Left 1121337073 14:93083960-93083982 CCATCAAAGCCGGCAATTTCCCT 0: 1
1: 0
2: 2
3: 9
4: 117
Right 1121337080 14:93084004-93084026 TGTTGTCCCTGCCCCCAGTCAGG 0: 1
1: 0
2: 2
3: 19
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121337073 Original CRISPR AGGGAAATTGCCGGCTTTGA TGG (reversed) Intronic
905903673 1:41600188-41600210 AGGGGAATTGCTGGATTAGATGG - Intronic
916761325 1:167820311-167820333 AGGGGACTAGCCGGCCTTGAGGG + Intronic
919575507 1:199303823-199303845 AGGGAAATTGCAGGTTTTAGGGG + Intergenic
921125626 1:212175220-212175242 GGGGAAATTGCTGGCTTTAAGGG + Intergenic
923060157 1:230464712-230464734 AGGGACATTTCTGACTTTGAAGG - Intergenic
1064840657 10:19587437-19587459 AGGAAAATTGTCTGTTTTGAAGG - Intronic
1065837260 10:29669825-29669847 AGGAAAGTTGCCGGCTGTGGTGG + Intronic
1066207815 10:33207138-33207160 AGGGAAGTTGCCTGCTTTCTGGG + Intronic
1067238884 10:44473757-44473779 AGGGAAATTGCTGGCTCATATGG - Intergenic
1068167087 10:53344312-53344334 AGGGAAGTAGCAGGCTTTGCAGG + Intergenic
1075071494 10:119322775-119322797 AGGGAAATTGCTGGATTATATGG - Intronic
1078353778 11:10618041-10618063 AAGGAAATTGAAGGCTTTGAAGG - Intronic
1078529628 11:12127000-12127022 TGGGGAATTGCCTGCTTTGAAGG + Intronic
1079205412 11:18410597-18410619 AGGGAGATTGCTGGCCTGGATGG - Intergenic
1081611186 11:44564625-44564647 AGGGAGAAAGCCAGCTTTGAGGG + Intronic
1083111159 11:60408823-60408845 AGCGAAATTGCTGGCTTATATGG + Intronic
1087413840 11:97826699-97826721 AGGTAAATTGCCTGTTGTGAGGG - Intergenic
1088873211 11:113910725-113910747 AGAGAAATTGCCGGGTGTGGTGG - Intronic
1092517471 12:9230328-9230350 AGGAAAAATGCAGGGTTTGATGG + Intergenic
1096233504 12:49910541-49910563 AGGGTGATGGCAGGCTTTGAAGG - Intergenic
1101425497 12:104584889-104584911 AGGGAAATTGCTGGATTTGAAGG + Intronic
1102642501 12:114379341-114379363 AGGGAACTTGGGGACTTTGATGG + Intronic
1103313097 12:120028062-120028084 TGGGAAATTGGCTGTTTTGAAGG + Intronic
1108962273 13:56248420-56248442 AGGGAAATTTGCGGCTCTGAGGG - Intergenic
1112559276 13:100497786-100497808 AGAGAAATTGCCAGATTTGTGGG + Intronic
1113037110 13:106062364-106062386 TGGGAAGTGGCCGGCTTAGATGG - Intergenic
1114950409 14:27743955-27743977 TGTGAAGTTGCCGTCTTTGAAGG - Intergenic
1115660976 14:35494165-35494187 AGGGAAATTGCTGCCTTGAAGGG + Intergenic
1118962235 14:70544485-70544507 ATGGAAATTTCTGGCTTTCATGG + Intergenic
1119089207 14:71764891-71764913 AGGGAAAATCCTGGCTCTGAAGG + Intergenic
1119635069 14:76267015-76267037 AGGAAAATTACAGGGTTTGAGGG + Intergenic
1121337073 14:93083960-93083982 AGGGAAATTGCCGGCTTTGATGG - Intronic
1125077229 15:35633531-35633553 AGGGACATTGCCTTCTTTGCAGG - Intergenic
1125783414 15:42292050-42292072 AGGGAAATATCTAGCTTTGAGGG + Intronic
1126313784 15:47346279-47346301 AGGGAAAATGGAGGCTTGGAAGG + Intronic
1127356081 15:58201335-58201357 AGGGAAATAGCAGCCTGTGAAGG + Intronic
1132312521 15:100867448-100867470 AGGGAACTCTCAGGCTTTGAGGG - Intergenic
1133805081 16:9120274-9120296 TGGAAAGTTGTCGGCTTTGATGG + Exonic
1135224948 16:20647613-20647635 AAGGCAATTGCAGGCTGTGAAGG - Intronic
1135579901 16:23616538-23616560 ACTGAAATTGTAGGCTTTGATGG + Intronic
1143241214 17:5444723-5444745 AGGGAAACTACCGCCTGTGAAGG + Intronic
1148460809 17:47838121-47838143 AAGGCAGTTGCTGGCTTTGAAGG + Intronic
1153837794 18:8979638-8979660 AGAAAAATTGAGGGCTTTGAGGG + Intergenic
1153935503 18:9916626-9916648 AGGTAAATTGTTGGCTTTGATGG + Intronic
1157543366 18:48529202-48529224 AGGGAAATTGCTGGATTATATGG - Intergenic
1161841442 19:6683736-6683758 AGGGAAATGGCCGGGTGTGGCGG - Intronic
1165169999 19:33885397-33885419 AGGGAAATTGCTGGGTTTCACGG + Intergenic
1167518478 19:49937882-49937904 AAGGAAATCACCGGCTTGGACGG - Intronic
925131326 2:1496105-1496127 GGGGAATTTGCCGACTTGGAAGG - Exonic
925870812 2:8268693-8268715 AGGGAAAGTGCAGGCATTGCTGG - Intergenic
930754411 2:54960390-54960412 AGAGAAAGTGCCGGCTGGGAGGG - Intronic
931067231 2:58600349-58600371 AGGGAATTTGCAGTCTGTGATGG + Intergenic
936754322 2:115687452-115687474 TGGCAAATTGCTGGCTTTGTAGG + Intronic
936836619 2:116718016-116718038 AGGGAATTTCCCGGCATGGATGG + Intergenic
942272041 2:174286099-174286121 AGTGAAATTGCTGGCTTATATGG - Intergenic
942298221 2:174537626-174537648 AGAGGAATTGCCTGCTTTCATGG + Intergenic
942388263 2:175464440-175464462 GGGGAAATTGCCGGCTGCCATGG - Intergenic
944078720 2:195760339-195760361 AGGGAAACTGACTGCTGTGAAGG + Intronic
946032241 2:216714451-216714473 AAGGAAATTGCCCTCATTGATGG - Intergenic
947729154 2:232418659-232418681 AGGGAAAGTGCAGGCTTTCAGGG - Intergenic
948398510 2:237664814-237664836 AGGGAAATTGCTGGGTTCAAAGG + Intronic
948999614 2:241605514-241605536 GGAGAAATTGCCTGCTTTTAGGG - Intronic
948999791 2:241606741-241606763 GGAGAAATTGCCTGCTTTTAGGG - Intronic
1170721801 20:18887728-18887750 AGTGAAATTGCTGGGTCTGAGGG + Intergenic
1173733630 20:45344906-45344928 AGGAAATTTGCTGGGTTTGAAGG - Intronic
1177942214 21:27424910-27424932 GGGAAAATTCCCTGCTTTGAAGG + Intergenic
1178708870 21:34896705-34896727 AAGGAAAATGCCAGCTTTGGAGG + Intronic
1183481908 22:38069880-38069902 AGGGAAATTGCAAGGTTTGGGGG - Intronic
950335485 3:12189519-12189541 AGGGAAATTGCCGGGTGCGGTGG + Intronic
953779315 3:45852294-45852316 AGGCAAATTGCTGGCTTAAAGGG - Intronic
955233019 3:57115571-57115593 AGGAAACTTGCCGATTTTGAAGG - Intronic
956138017 3:66117956-66117978 AGTGAAATTGCCGGGTTGGCTGG - Intergenic
956998129 3:74851468-74851490 AGAGAAATTGCCAGCAATGAGGG + Intergenic
957017291 3:75082700-75082722 AATGAAATTGCTGGCTCTGAGGG - Intergenic
958041009 3:88226709-88226731 AGGGAAATTGCTGAATTTCATGG - Intergenic
971002552 4:22339118-22339140 AGGGAATTTCCCGGCATAGATGG - Intergenic
971061196 4:22972148-22972170 AGGGAAATTGCTGGGTTGTATGG + Intergenic
974395738 4:61332851-61332873 AAGGAATTTGCTGTCTTTGAAGG + Intronic
974564699 4:63567618-63567640 AGGTATATTGCTGGCCTTGAAGG - Intergenic
976722027 4:88178316-88178338 AGGGAAATTGCTGCCTTGAAGGG + Intronic
980938020 4:139244674-139244696 AGTGAATTGGCCGGCTGTGATGG + Intergenic
982719824 4:158848055-158848077 GGGGAACTTGCCACCTTTGAGGG + Intronic
985297500 4:188451030-188451052 AGGGAAATGGCAGGTTTGGAGGG + Intergenic
987349274 5:17007183-17007205 AGGGACATGGCCGGGTTTGGTGG + Intergenic
988391860 5:30644306-30644328 AGGGAATTTGCCAGCTCTGTAGG - Intergenic
988722664 5:33893401-33893423 AGGGCCATTGCTAGCTTTGATGG - Intergenic
992539457 5:77749684-77749706 AGTGCAATTGCCGGCTTAAAGGG - Intronic
995135561 5:108676045-108676067 AGGGGAATGGCAGGCTCTGAGGG + Intergenic
995442909 5:112211689-112211711 AGGAAACTTGCCAACTTTGAGGG - Intronic
995702988 5:114956331-114956353 AGTGATGTTGCTGGCTTTGAAGG + Intergenic
996559182 5:124810275-124810297 AGGGAAATAGCTGGCTATAAAGG - Intergenic
997695190 5:135856053-135856075 AGAGAGAGTGCCGGCTTTGGAGG + Intronic
999202148 5:149824081-149824103 AGGGAAAATGCTGGCATGGAAGG + Intronic
999868727 5:155728731-155728753 AGGGAAGTTGGCGGCTCTGGGGG - Intergenic
999990073 5:157041689-157041711 AGGGAAACAGCATGCTTTGATGG - Intronic
1002062880 5:176636759-176636781 AATGAAAATGCCTGCTTTGAAGG - Intronic
1003892139 6:10572973-10572995 AGGCAAATGGCCGGCTCTGTGGG + Intronic
1008239507 6:49091901-49091923 AGGGAAATTGCTGGATTGTATGG + Intergenic
1010979568 6:82355904-82355926 AGGGAAATTGCTGGCTTTGGAGG + Intergenic
1011561719 6:88625199-88625221 AGTAAAATTGCCGGCTCTTATGG - Intronic
1011571033 6:88735697-88735719 AGGGAAATTTACAGCATTGAAGG + Intronic
1014222148 6:118808534-118808556 AGGGATCTTGCTGCCTTTGAGGG - Intergenic
1021180723 7:17502352-17502374 AGGGAAATTGCTGGCCCTGGGGG + Intergenic
1021639431 7:22723355-22723377 TGGGAAATGTCCTGCTTTGATGG - Intergenic
1022636624 7:32142361-32142383 AGGGAAATTGACACCCTTGAGGG - Intronic
1024875670 7:54020129-54020151 AGGGAAATTGGAGGCTTGGTGGG + Intergenic
1027690329 7:81337189-81337211 AGGAGAATTGCAGGCTCTGAGGG + Intergenic
1028521922 7:91741837-91741859 AGGGAACTTGCCATCTTTAAGGG - Intronic
1028984205 7:96997223-96997245 AGGAAAAGTGCCTGCTATGATGG + Intergenic
1032355352 7:131205808-131205830 AGGGTGATTGCTGGCTTTGAAGG - Intronic
1033085762 7:138340279-138340301 TGGGAAATTGCCGTGTTTCAAGG - Intergenic
1035670414 8:1412748-1412770 AAGGCAATTGCCAGCTGTGATGG + Intergenic
1044255550 8:90056352-90056374 AGTGAAATTGCTGGGTTTTAGGG + Intergenic
1045427132 8:102078215-102078237 AGGGATATTGCAGGATTTGTAGG - Intronic
1046389922 8:113557235-113557257 AGAGAAATTGAAGCCTTTGATGG + Intergenic
1047411579 8:124628630-124628652 AGGGAAATTGCTGTCATCGATGG - Intronic
1048802614 8:138207800-138207822 ATGGAGATTGACGCCTTTGAGGG - Intronic
1049859451 8:144888627-144888649 AGGGAAATTACCAGTTTTGCTGG - Intronic
1050670607 9:7992448-7992470 AGGGAAGTTGCTGGTTTTTATGG - Intergenic
1051966681 9:22836418-22836440 AAGGAAACTGCCTGTTTTGAAGG - Intergenic
1054950261 9:70842706-70842728 AGAGTAATTGCAGGATTTGATGG + Intronic
1058940757 9:109810669-109810691 AGGGAGATTGTGGGCTTGGAAGG + Intronic
1059920225 9:119151999-119152021 AGGTAAAGTGCCTTCTTTGATGG - Intergenic
1060728754 9:126023774-126023796 AGGGACATTGAGGGCTTTTAAGG - Intergenic
1062307221 9:135914827-135914849 AGGGAAGATGCTGGCTTTGAAGG + Intergenic
1187732360 X:22268652-22268674 AGGCAAATTGCCCTGTTTGAAGG - Intergenic
1192098859 X:68242541-68242563 AGGGAAATTGCCTGGTTATATGG - Intronic
1197306274 X:124845737-124845759 AGGGAAATTACAGGGTGTGATGG + Intronic
1198797404 X:140413464-140413486 AGGGAAATTGATAGCTTTAAAGG + Intergenic