ID: 1121337234

View in Genome Browser
Species Human (GRCh38)
Location 14:93084884-93084906
Sequence TTCCTGCCTCTTGATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 317}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121337234 Original CRISPR TTCCTGCCTCTTGATGAGGA AGG (reversed) Intronic
901199377 1:7457970-7457992 TTTCTGCCTCATGATGGGGTGGG + Intronic
902932832 1:19743438-19743460 TTCCTGGCTCTCGAGGAGGTAGG + Intronic
903464805 1:23544756-23544778 TTACTACCTCTTGGTGAGGGGGG - Intergenic
903523106 1:23969926-23969948 TGCCTGCCTCTTTATGAGGGAGG - Intronic
904203715 1:28838728-28838750 TTCCTGCCTCGTGATGGTGTGGG - Intronic
905904437 1:41608467-41608489 TGCCTGCCTCTTTGTGAAGAAGG + Intronic
906287656 1:44598150-44598172 TTCCTGCCTGGTGATGGGGAGGG + Intronic
906794350 1:48685102-48685124 TTCCTGGCAGTTGCTGAGGAGGG - Intronic
907836552 1:58114352-58114374 TTCCTGCATATGGATGAGAATGG - Intronic
908356699 1:63329816-63329838 TTCTTGCCTCGTGATGTGGGAGG + Intergenic
909538822 1:76768317-76768339 TTCCTGCCCCGTGAGGAGGTAGG + Intergenic
909912585 1:81279083-81279105 GTCCTCCTTCTTGATGAAGATGG + Intergenic
911303610 1:96206304-96206326 TTTCTGCCTGTTAATGATGATGG + Intergenic
911739055 1:101367654-101367676 TTGGTGCTTCTTGGTGAGGAGGG - Intergenic
911773136 1:101773155-101773177 TTCCTGCCACTTTGTGAAGAAGG - Intergenic
912154747 1:106904033-106904055 TTCCTGCCGCCTGGTGAAGAAGG - Intergenic
912712437 1:111959617-111959639 TTCCTGCCCCCTGCTGGGGATGG + Intronic
912863103 1:113232507-113232529 ATCCTGCAGCTGGATGAGGAGGG - Intergenic
914417957 1:147501998-147502020 TTCCTGCCGCCTGGTGAAGAAGG - Intergenic
915473952 1:156141500-156141522 TTCCTAGCTCTTGAGGAGGAGGG + Intergenic
915958140 1:160240368-160240390 TTCCTGCATGTTAGTGAGGAAGG + Exonic
916598154 1:166266228-166266250 TCCCTGCCTCTTGGGAAGGAAGG + Intergenic
917055550 1:170977906-170977928 TCCCTGCCTGGTGATGAGCAGGG + Intronic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
920931775 1:210395350-210395372 TTCCTGACTCCTTATGAAGAAGG + Intronic
923100013 1:230806715-230806737 TTCCTGCCGCTTTGTGAAGAGGG - Intergenic
924665548 1:246067856-246067878 TTCCTGCCACATGATGCTGACGG - Intronic
1063441879 10:6079392-6079414 TTCCTTCCTCCTGGTGGGGAGGG - Intergenic
1064227053 10:13495846-13495868 TTCCTGCCCTTTCATCAGGATGG - Intronic
1065505904 10:26429886-26429908 ATCCTACCTCTTAATGGGGAAGG + Intergenic
1066668596 10:37812724-37812746 ATTCGGCCTCTAGATGAGGAGGG + Intronic
1067290081 10:44933949-44933971 TTCCTGCCATTTGATCAGCATGG - Intronic
1067785378 10:49241985-49242007 TTCCTGACTCTTGACAAGGGAGG - Intergenic
1068264716 10:54631791-54631813 TTCCTGCCTCCTTATGAAAAAGG - Intronic
1071281729 10:84109879-84109901 GCCCTTCCTCTTGATAAGGAGGG - Intergenic
1071789397 10:88938419-88938441 TGCCTGCCTTCTAATGAGGAAGG + Intronic
1073114837 10:101085940-101085962 TGCCCGCACCTTGATGAGGACGG + Intergenic
1073206637 10:101772904-101772926 TAGCTGCCTCTTGCTGTGGAAGG - Intronic
1073468237 10:103706895-103706917 TTCCTGCCTATTTATGAGGACGG + Intronic
1073844724 10:107542177-107542199 TTCCTTTCTCTTGAAGAAGATGG + Intergenic
1073906567 10:108287509-108287531 TTCCAGCTTCTCCATGAGGAGGG - Intergenic
1075022280 10:118960646-118960668 TGCCTGCCTCTTCATGGGGCTGG + Intergenic
1075894494 10:125983405-125983427 TTCCTCCCTCATGATGATGAAGG + Intronic
1077104459 11:836141-836163 TTGCTGCTTCTGGGTGAGGAGGG + Exonic
1077318801 11:1931425-1931447 TTCCTGTCCCTGGGTGAGGAGGG - Intronic
1077716383 11:4585196-4585218 ATCCTGCCTCTTGATGATGTAGG + Intergenic
1077755823 11:5026099-5026121 TCCCTGCCTAGTGATGAGCAGGG - Intergenic
1078825073 11:14922073-14922095 ATCCTTCCTCTTGATGGAGAAGG - Intronic
1079594658 11:22227563-22227585 ATTCTGTTTCTTGATGAGGATGG - Exonic
1079802578 11:24888874-24888896 TTCCTGCCTCCTTGTGAAGAAGG + Intronic
1079940343 11:26672614-26672636 TTCCTCCCTCTTGTTGAGGGTGG + Intronic
1081081924 11:38752392-38752414 TGGCTGCTTCATGATGAGGAAGG + Intergenic
1081628889 11:44673942-44673964 TTCCTGCCACCTTGTGAGGAAGG + Intergenic
1082562999 11:54641868-54641890 TTCCTGCCTGGTGCTGAGGTGGG + Intergenic
1083090862 11:60199235-60199257 TTCCTGAATTTTGATTAGGAGGG - Intergenic
1083197149 11:61095142-61095164 GCCCTTCCTCTTGATAAGGAGGG - Intergenic
1085803917 11:79617294-79617316 TTCCTGCATCTGCATGAGGAAGG - Intergenic
1085804897 11:79626631-79626653 TTCCTTCCTGTTGATGAGACGGG + Intergenic
1086769670 11:90745943-90745965 TTCCTGCCACTTTGTGAAGAAGG + Intergenic
1087582690 11:100079000-100079022 TTCCTGCCTCCTTGTGAAGAAGG - Intronic
1088620078 11:111672585-111672607 TTCCTTCCACTAGAAGAGGAAGG + Intronic
1088712366 11:112519951-112519973 TTCCTGCCACCTGGTGAAGAAGG + Intergenic
1092139500 12:6173108-6173130 TTCCTGCCTCCTTGTGAAGAAGG + Intergenic
1093240075 12:16659268-16659290 TCCCTGCCTGGTGATGAGCAGGG + Intergenic
1093371251 12:18367965-18367987 TTCCTGCCACCTGGTGAAGAAGG - Intronic
1093585360 12:20829414-20829436 TTCCTGCTCCATGATGATGAAGG - Intronic
1096887369 12:54731275-54731297 CTCCTGCCTCTCCCTGAGGATGG + Intergenic
1097564180 12:61247934-61247956 TTTCAGCCTCCAGATGAGGAGGG + Intergenic
1097920203 12:65063943-65063965 TTCAAGCCTCTTAATGTGGAAGG + Intronic
1099826802 12:87786124-87786146 TTCCTGCTTCTTTGTGAAGAAGG + Intergenic
1099860982 12:88225927-88225949 TTCCTGCCACTTTGTGAAGAAGG - Intergenic
1101692636 12:107095854-107095876 TTCCTGCCTCTATGTGAAGAAGG + Intergenic
1101788986 12:107911311-107911333 TATCTGCCTGATGATGAGGAGGG + Intergenic
1101828641 12:108240383-108240405 TTCGTGCGTCTTGATGCAGATGG - Exonic
1102666864 12:114581549-114581571 TTCCTGCCACTTTGTGAAGAAGG - Intergenic
1103539972 12:121659238-121659260 TTCCTGTCTGTTGGTCAGGAAGG + Exonic
1104299156 12:127548180-127548202 TTTTTGCCTCTCGGTGAGGAGGG + Intergenic
1105465164 13:20633304-20633326 TTCCTGCCTCCTTGTGAAGAAGG - Intronic
1105542636 13:21328112-21328134 TTCATGCCACTTGAGGAAGAGGG - Intergenic
1105933346 13:25073755-25073777 TTCCTTCCTCTTTTTGAGGGGGG - Intergenic
1106186602 13:27415250-27415272 TTTCTCCCTCTGGATGGGGAGGG + Intergenic
1106900015 13:34345694-34345716 TTCCTGGATCTTCATGAGAATGG - Intergenic
1110522089 13:76491591-76491613 TGCCTGCCTCTAGGTGGGGAAGG - Intergenic
1110724366 13:78802693-78802715 TTCCTGCCGCCTTATGAAGAAGG - Intergenic
1112265453 13:97919534-97919556 TTCCTGCCGCCTTGTGAGGAAGG + Intergenic
1112494232 13:99893171-99893193 TTCCGGCCTCTGAGTGAGGATGG - Exonic
1113173232 13:107530152-107530174 CTCCTGCCTATTAATGAGGCAGG + Intronic
1114474589 14:22984863-22984885 TTCCTGTGTCCAGATGAGGAAGG + Intergenic
1114967318 14:27979182-27979204 TACCTGGCTCTGGATGATGAAGG - Intergenic
1116759631 14:48995289-48995311 CTCCTGCCTCTTCAAGTGGAAGG + Intergenic
1117110147 14:52444476-52444498 TGCCTTCATCTGGATGAGGAAGG - Intronic
1117393203 14:55282344-55282366 TTTCTGCTTCTTGATAAGGAAGG + Intronic
1117625356 14:57631552-57631574 TGCCTGCCTCGTTATGAGGGAGG + Intronic
1118808118 14:69255301-69255323 TTCCTGCCCCAGGATGAGGGGGG - Intergenic
1118859562 14:69651985-69652007 ATCCTGCCACATGATGAGAAAGG - Intronic
1119839225 14:77778614-77778636 TTCCTGCCACCTTATGAAGAAGG + Intergenic
1121337234 14:93084884-93084906 TTCCTGCCTCTTGATGAGGAAGG - Intronic
1123776368 15:23584508-23584530 TCTCTGCCTCATGCTGAGGAGGG + Intronic
1124436522 15:29653599-29653621 TTCCTGCCACTTTGTGAAGAAGG + Intergenic
1125215775 15:37272610-37272632 TTCCTGCCACTTTGTGAAGAAGG - Intergenic
1128207796 15:65868665-65868687 TTGATGAATCTTGATGAGGAGGG + Intronic
1128576520 15:68779762-68779784 TTCCTGACTCTCAAAGAGGATGG - Exonic
1128605876 15:69036426-69036448 TTTCTGCATCTTGAGGAGGCTGG - Intronic
1131990095 15:98084611-98084633 TTTCTGCATGTTGATGAGGCTGG - Intergenic
1132752936 16:1467164-1467186 CTCCTGGCTTTTGATGGGGATGG - Intronic
1135159760 16:20083259-20083281 TTCCTTCATCTTGGTGGGGATGG + Intergenic
1135355266 16:21763718-21763740 TCCCTGCCTCCAGCTGAGGAGGG - Intergenic
1135453751 16:22579860-22579882 TCCCTGCCTCCAGCTGAGGAGGG - Intergenic
1136057416 16:27700701-27700723 TTCCTGCTCCTTGATCAGGCTGG - Intronic
1137396423 16:48118634-48118656 TTCTTGCCTCTTTATTGGGAAGG - Intronic
1137441451 16:48501934-48501956 TTCCTTCCTCATGATGAGGATGG - Intergenic
1137852364 16:51758611-51758633 TTTCTGCCTCCTGATTTGGAGGG - Intergenic
1137993847 16:53186816-53186838 TTCCTACCTCTACATGAAGAAGG + Intronic
1138177563 16:54915215-54915237 TTCAAGCCTCTTGCTGGGGAGGG + Intergenic
1139500320 16:67358450-67358472 TTCCTGCCTCCTGAGTAGCAGGG + Intronic
1140023603 16:71262896-71262918 TTCCTGCCTCTTTCTGGGGTAGG - Intergenic
1140270345 16:73459761-73459783 TTCCTGCCACCTTGTGAGGAAGG - Intergenic
1141306259 16:82866760-82866782 TTCCTGCCTCCTTGTGAAGAAGG - Intronic
1141741585 16:85896947-85896969 TTCCTGCCTCCTGAGTAGGTGGG + Intergenic
1142960096 17:3547231-3547253 TTCCTGGCTCTTGAGGGAGAGGG + Intronic
1143178310 17:4968954-4968976 GTCCTGCTTCTTGGTGAGAAAGG + Exonic
1143672361 17:8405506-8405528 GTCCTGGCTCCAGATGAGGATGG + Intergenic
1144637050 17:16916742-16916764 TACCTGTCTCTTGATGGTGAGGG + Intergenic
1144702627 17:17348984-17349006 CTCCTGGCCCTTCATGAGGAGGG - Intergenic
1145264207 17:21371762-21371784 TGCCTGCCTCCTGATGGGGCAGG + Intergenic
1145866272 17:28243867-28243889 TTCCTGCCACCTTGTGAGGAGGG + Intergenic
1146951809 17:36912040-36912062 TCACAGCCTCTTGATGAAGATGG + Intergenic
1147660569 17:42114895-42114917 TTTCTGCTTCTTGATGATGTGGG + Exonic
1147723190 17:42551259-42551281 TTTCTCCCTGTTGGTGAGGATGG - Exonic
1148625167 17:49063786-49063808 TTCCTGCCCCTTGCAGAGCAGGG + Intergenic
1149536423 17:57437082-57437104 TTCCATCTTCCTGATGAGGAGGG + Intronic
1150010314 17:61496814-61496836 TGCCTGCCTCTAGATGCTGAAGG - Intergenic
1151028420 17:70706332-70706354 TTCCTGCATCTTGACCAAGATGG - Intergenic
1154050225 18:10948522-10948544 TTCTTGCTTCTTGATTAGAATGG + Intronic
1155031767 18:21991143-21991165 TTCTTGGCTTTTGAAGAGGAGGG + Intergenic
1155040013 18:22057026-22057048 TTCCTGGCTTTTCATGAGAAAGG - Intergenic
1155338590 18:24791317-24791339 ATCCTTTCTCTGGATGAGGAAGG + Intergenic
1156500486 18:37554347-37554369 TTCTTGCCTCTTGATGACCCTGG + Intronic
1156856180 18:41783789-41783811 TTCCTCCCTCTTTGTGATGATGG + Intergenic
1156861499 18:41841850-41841872 ACCCTGCCTCTTGTTGGGGAGGG - Intergenic
1157691195 18:49683190-49683212 TTCCTGCCACCTTGTGAGGAAGG - Intergenic
1157800036 18:50611755-50611777 TTCCTGCATCTTGCTGACGTGGG - Intronic
1157862774 18:51156244-51156266 TGCCTACCTCTTTATGAGGGAGG - Intergenic
1158557990 18:58490911-58490933 TTCCTGCATATTCATGGGGATGG - Intronic
1158984888 18:62804134-62804156 TTCCTGCCCCCTGGTGAAGAAGG - Intronic
1160039332 18:75331805-75331827 TTCCTTCCTCGAGATGTGGATGG - Intergenic
1162003576 19:7763598-7763620 TTCCTGGGTCCTGAAGAGGACGG + Intronic
1163144563 19:15371870-15371892 CTCCTGCCCCTTTGTGAGGAAGG + Intronic
1163510613 19:17733078-17733100 TTCAGGCCTCCTGCTGAGGAGGG + Intronic
1164050296 19:21580382-21580404 TTCCTGCCTTTGGATGAAGCAGG - Intergenic
1164469070 19:28513292-28513314 TCCCTGTCTCTTGGTGAGGCTGG - Intergenic
1165394635 19:35557734-35557756 CTCCTGGCCCTTGATAAGGATGG + Exonic
1166042995 19:40214321-40214343 CTCCTGCTTCTTGTGGAGGAGGG + Intronic
1166862413 19:45817956-45817978 TACCTGCTTCATGATGAGGCGGG + Exonic
1166968684 19:46547395-46547417 TTCCTGCCGCTTTGTGAAGAAGG + Intronic
1168471423 19:56643482-56643504 TTCCAGCCTCCTCGTGAGGAGGG + Intronic
925087583 2:1121644-1121666 TTCCTGCCACCTTATGAAGAAGG - Intronic
925653463 2:6117810-6117832 TTCCTGCCACCTAGTGAGGAAGG - Intergenic
927437788 2:23085018-23085040 TTACTGCATCTTGGTAAGGACGG - Intergenic
927827030 2:26316265-26316287 TTGCTGCCACCTGGTGAGGAAGG - Exonic
928375790 2:30772200-30772222 TTCATGCCTCTGGGTGGGGAGGG + Intronic
930607628 2:53508963-53508985 TTCCTGCCTCCTTGTGAAGAAGG - Intergenic
930891707 2:56396823-56396845 TTCCTGCCACTTTGTGAAGAAGG + Intergenic
935713842 2:105922242-105922264 TTCCTGCCGCTCTGTGAGGAAGG + Intergenic
937513110 2:122620907-122620929 TTCCTGTTTCTTTATGAGAAAGG + Intergenic
938095234 2:128457130-128457152 TGCCTCCCTCTTGCTGAGCATGG + Intergenic
938226986 2:129624843-129624865 TTCCCGCCTCTTGGGGAGGAAGG + Intergenic
939703139 2:145419553-145419575 TTCCTGCCTCCTTGTGAAGAAGG - Intergenic
941587486 2:167379153-167379175 TTCCTGCCCCCTTATGAAGAAGG - Intergenic
942306787 2:174616362-174616384 TCCCTGTCTCGTGAAGAGGAAGG - Intronic
942591686 2:177553108-177553130 TCCCTGCCTCTTAAAGATGAGGG + Intergenic
943272174 2:185820265-185820287 TTCCTGCCACCTGGTGAAGAAGG + Intronic
943351815 2:186805610-186805632 GCCCTGCCTGTTGATGAGCAGGG + Intergenic
943542760 2:189238679-189238701 TTCCTGCCACCTGGTGAAGAAGG - Intergenic
946539403 2:220667010-220667032 TTCCTGCCTCTTGCTGCAAATGG - Intergenic
947173833 2:227339722-227339744 ATCCTGTCTCTTAATGAAGAAGG + Intronic
947328230 2:229000644-229000666 TTCCTGCCACTTTTTGAAGAAGG + Intronic
947619321 2:231578548-231578570 TTCCAGCATCTTCATGAGGCAGG - Intergenic
948215442 2:236225912-236225934 TTTCTGACTCTTGATGACAATGG - Intronic
948229893 2:236342067-236342089 TTCCTGCCTCTTATTGCGGGAGG + Intronic
1169640580 20:7746267-7746289 TTCCTGCCACCTTATGAAGAAGG - Intergenic
1169742833 20:8913951-8913973 TTCCTGCCTCAGGATTAAGAAGG + Intronic
1171307245 20:24117029-24117051 TTCCTGCCTCATGAGTAGGTGGG + Intergenic
1171414325 20:24967394-24967416 TTCCTGCAGCTGGGTGAGGAGGG - Intronic
1171419625 20:25009119-25009141 TTCCTGGCTGGTGGTGAGGATGG - Intronic
1171750029 20:29039715-29039737 TTCCTGCCACCTCATGAAGAAGG - Intergenic
1173055607 20:39609452-39609474 TTTCTTCCTATTTATGAGGATGG - Intergenic
1173566277 20:44040700-44040722 TCTCTTCCTCCTGATGAGGATGG + Intronic
1173956496 20:47037073-47037095 TTCCTGCCACCTTATGAAGAAGG - Intronic
1174651243 20:52127521-52127543 TTCCTGCCTCTTTGTGAAGAAGG + Intronic
1174661818 20:52220317-52220339 TTCCTGCCACTTTATGAAGAAGG - Intergenic
1175354069 20:58348512-58348534 TTCTTGTCTCTTCATGTGGATGG - Intronic
1175802123 20:61806862-61806884 TTCCTGTCTCCTGCTGGGGAGGG + Intronic
1176315190 21:5236201-5236223 TTCCTGCCACCTCATGAAGAAGG + Intergenic
1177023748 21:15896022-15896044 TTCCTTCCACTTGAGGAGAAGGG + Intergenic
1177151450 21:17459234-17459256 CTCCTGCCACCTCATGAGGAAGG - Intergenic
1177821268 21:26033330-26033352 TTCCTGCCGCCTTATGAAGAAGG + Intronic
1178468399 21:32869901-32869923 TTCCTGCCTCCTTGTGAAGAAGG + Intergenic
1179048811 21:37871072-37871094 TTCCCTCCTCTTGATGTTGAGGG + Intronic
1179731304 21:43369221-43369243 TTTGTGCCACTTGATGTGGATGG + Intergenic
1179925573 21:44532263-44532285 TTCCTTTCTCCTGATGAGGCAGG + Intronic
1181512395 22:23394754-23394776 TTCCTGCGCCTTGAGGTGGATGG + Intergenic
1184875677 22:47273982-47274004 CTCCTGCCTCTATAGGAGGAGGG - Intergenic
950139860 3:10607975-10607997 ATGCTGCCTCTTGATGAGAGAGG - Intronic
950514372 3:13454635-13454657 TACCTGCCTCCTAAGGAGGAAGG + Intergenic
950613596 3:14141507-14141529 CTCCTGTCCCTAGATGAGGATGG - Intronic
950647573 3:14386464-14386486 ATCCTGCCTCTTGACGGGGAGGG + Intergenic
952592368 3:34972248-34972270 TTCCTGCCTCCAGAAGAGGATGG + Intergenic
953159089 3:40401516-40401538 TGCCTGCCTTTTGCTGTGGAGGG + Intronic
955459329 3:59163474-59163496 TTCCTGCTACTTAATGAGTATGG + Intergenic
959030626 3:101295674-101295696 TTTCTTCCTATTCATGAGGATGG + Intronic
959086654 3:101857360-101857382 TGTCCGCCTGTTGATGAGGAAGG + Exonic
959302325 3:104618980-104619002 TTCCTGCCGCCTTATGAAGAAGG + Intergenic
960006071 3:112782538-112782560 TTGCTGACTGTAGATGAGGAGGG - Intronic
960229522 3:115208864-115208886 TTCCTCCTTCTTAATGAGTAAGG + Intergenic
961617423 3:128193819-128193841 TTCCTCCCTCCAGAGGAGGAGGG + Intronic
962853967 3:139328103-139328125 TTCCTGCCTCGTGGGGAGGTGGG + Intronic
963073647 3:141326811-141326833 TTCCTCCCTCTTGAGGGGGGTGG + Intronic
963602135 3:147387884-147387906 TTTCTGACTCTTGAGTAGGATGG - Exonic
964903208 3:161686145-161686167 TTCCTGCCGCCTTGTGAGGAAGG + Intergenic
966952639 3:184836486-184836508 CTCCTTCCCCTTGAAGAGGAGGG + Intronic
968812203 4:2805149-2805171 CTGCTTCCTCTAGATGAGGAAGG + Intronic
969308134 4:6336947-6336969 TCCCTGCCTGTGGAGGAGGATGG + Intronic
969375814 4:6762505-6762527 TCCCTGCCTCTTGACCAGGCGGG + Intergenic
969479497 4:7440528-7440550 TTCCTCTCTCTGAATGAGGAGGG + Intronic
969846915 4:9926523-9926545 TATCTGGCTCTTGATGAGCAAGG + Intronic
971470592 4:27021746-27021768 TTCCTGGCTGTTGCAGAGGAAGG + Intronic
974117779 4:57601437-57601459 TTCCTGCCTCTAGAGGAAGGAGG + Intergenic
974125549 4:57691962-57691984 TTCCTGCCTCCTTGTGAAGAAGG + Intergenic
974125822 4:57693958-57693980 TTCCTGCCTCTTTGTGAGGAAGG + Intergenic
974312435 4:60230265-60230287 TTCCTGCCACTTTGTGAAGAAGG - Intergenic
975302191 4:72802896-72802918 TTCCTGCCACCTTATGAAGAAGG - Intergenic
977064063 4:92291185-92291207 TTCCTGCCACTTTGTGAAGAAGG + Intergenic
980338781 4:131513613-131513635 TTCCTGCCACCTTATGAAGAAGG + Intergenic
983824280 4:172238215-172238237 TTTCTGCCTATTCATGAGCATGG + Intronic
984633684 4:182088381-182088403 TTCCTGCCTCTTGATAACACTGG - Intergenic
987644357 5:20649079-20649101 GCCCTGCCTATTGATGAGCAAGG - Intergenic
988493348 5:31723962-31723984 TTCCTGCCTCTTCATGAGAGAGG - Intronic
988650857 5:33149036-33149058 TTACTGCTTTTTGAGGAGGATGG + Intergenic
990509511 5:56477544-56477566 TTCCTGCCTTGTGATGTGGCAGG + Intronic
990849934 5:60191470-60191492 TTCCTGCCTCCTTGTGAAGAAGG + Intronic
991209198 5:64084824-64084846 TTCCTTCTTCTTGACGAGAAAGG - Intergenic
993371182 5:87094004-87094026 TTCATGCCTCTAGATGAGAGGGG + Intergenic
994658271 5:102621378-102621400 TTCCTGCCACTATATGAAGAAGG - Intergenic
995456567 5:112359085-112359107 ATCCTACCTCTTGATCTGGATGG + Intronic
995621534 5:114031191-114031213 CTCCTGCCGCTTTATGAAGAAGG - Intergenic
996001773 5:118372754-118372776 TTCATTCTTCTTAATGAGGAGGG - Intergenic
996365927 5:122701456-122701478 TTCCTGCCACCTTGTGAGGAAGG - Intergenic
997200230 5:132005600-132005622 TTTCTGCCTGTTTATGAGGCAGG + Intronic
997282723 5:132658872-132658894 TACCTGCCTCTTGAGGTGGCTGG - Intronic
997823294 5:137084919-137084941 CTCTTGCCTTCTGATGAGGATGG - Intronic
999664104 5:153894828-153894850 TTCCTGTGTATTGATGAGGCAGG - Intergenic
1000373484 5:160558806-160558828 TTCCTTGCTCTTTAAGAGGAGGG + Intergenic
1000516115 5:162237857-162237879 TTCCTGCCGCCTCATGAAGAAGG - Intergenic
1001027117 5:168233557-168233579 TTCCTGTCTCTTGCAGTGGAAGG - Intronic
1001158872 5:169296917-169296939 TGCCTGCCTCTAGACAAGGACGG + Intronic
1002942812 6:1733093-1733115 ACCCTGCCTCTGGATGGGGAGGG + Intronic
1002958084 6:1888364-1888386 TTCCTGCCGCCTTATGAAGAAGG - Intronic
1003409377 6:5849724-5849746 CTCATGCCACTTGAGGAGGAGGG + Intergenic
1006361334 6:33588976-33588998 TGCCTGCTTCTTGAGGAGAAAGG + Intergenic
1006682523 6:35807355-35807377 TTCCTGCTTCTAGCTCAGGAAGG + Intronic
1007742491 6:44021460-44021482 TTCCAGCTTCTTTCTGAGGAGGG + Intergenic
1007745381 6:44040128-44040150 TTCCTCCCTCTTGAAGTGGTGGG - Intergenic
1009710083 6:67307249-67307271 TTCCTGCCACTTTGTGAAGAAGG + Intergenic
1012541433 6:100366431-100366453 TTCCTGCCACCTTGTGAGGAAGG + Intergenic
1012828359 6:104175918-104175940 TTTATACTTCTTGATGAGGATGG - Intergenic
1013858999 6:114610791-114610813 TTCCTGCCTCCATATGAAGAGGG + Intergenic
1015214838 6:130737659-130737681 TTCCTGCCACCTTATGAAGAAGG - Intergenic
1015488205 6:133795785-133795807 TTCTTGCCTATTCATGAGCATGG + Intergenic
1016040744 6:139429660-139429682 TTTCTGCCTCTTCCTGCGGACGG - Intergenic
1016814930 6:148294485-148294507 TTCCTACCTCCTGGTGAGAAAGG - Intronic
1019019331 6:168904314-168904336 ATACTGCCGCTTGCTGAGGAAGG - Intergenic
1019551208 7:1603588-1603610 ATCCTGCCTCCTGGTGGGGAAGG + Intergenic
1019768590 7:2869495-2869517 CTCCTGCCACTTTATGAAGAAGG - Intergenic
1019883748 7:3885583-3885605 TTCCTCCCTCTTGATGGTGTGGG + Intronic
1020334155 7:7048859-7048881 TTCCTGCCACCTTATGAAGAAGG + Intergenic
1027382647 7:77627252-77627274 CGCTTGCCTCTTGATGAGAAAGG + Exonic
1028041630 7:86060975-86060997 TTCCTGCCTCCTTGTGAAGAAGG - Intergenic
1028238510 7:88389997-88390019 TTCCTGCCACTAAATGAAGAAGG - Intergenic
1028910878 7:96206157-96206179 TACCTGTCACATGATGAGGAAGG - Intronic
1029061341 7:97801136-97801158 TTCCTGCCTCCAGGTGAAGAAGG - Intergenic
1033492351 7:141855723-141855745 TTCCTGCCTCTGTGTGGGGAAGG - Intergenic
1033959300 7:146893891-146893913 ATCCTGCCTCTTGTGGAAGATGG + Intronic
1034342010 7:150363532-150363554 TGCCTGACTCATGATGAGGCCGG + Intergenic
1035194422 7:157204677-157204699 TTCCTTCTTCTTGAAGATGAGGG + Intronic
1035218218 7:157387319-157387341 TTCCTGTCTCTGGATAAGGTAGG + Intronic
1035448730 7:158960518-158960540 TTAAGGCCTCTTGATGATGATGG + Intergenic
1038581598 8:28753168-28753190 TTGCTGCCTCTCGCTGAGGAGGG - Exonic
1039378113 8:37057795-37057817 CTCCTGCCTCCTTATGAAGAAGG + Intergenic
1039430194 8:37519787-37519809 TCCCTGCCTCTTTCTCAGGACGG - Intergenic
1041964385 8:63658198-63658220 ATCCTGCCTCCTGATAAGCAGGG + Intergenic
1042203093 8:66300785-66300807 TTTCAGCCTCTTGGTCAGGATGG - Intergenic
1043321197 8:78988870-78988892 TTCCTGCCTCCTTGTGAAGAAGG - Intergenic
1043908003 8:85829937-85829959 TTCCTGAATTTTTATGAGGAAGG - Intergenic
1044881623 8:96728934-96728956 TTTTTTCCTCTTGATGATGAAGG - Intronic
1050268661 9:3918397-3918419 TGCTTGCCTTTTGATCAGGAGGG - Intronic
1051108733 9:13610610-13610632 TTCAGGCATCCTGATGAGGAAGG + Intergenic
1051162212 9:14221286-14221308 TTCCTGCCACTTAATCAGTATGG - Intronic
1051344149 9:16137391-16137413 TTGCTGCCTCTTCATGACAAAGG - Intergenic
1053149784 9:35736120-35736142 CACCTGCATCTTGGTGAGGATGG + Exonic
1055506384 9:76953936-76953958 TTCCTGGCTATTGATGACAATGG + Intergenic
1058408989 9:104709494-104709516 TTCCTGCCTCTTGAAGTGTAAGG + Intergenic
1059613835 9:115927452-115927474 TTCCTGCCACCTTTTGAGGAAGG + Intergenic
1060191696 9:121598171-121598193 TTCCTGCCTCTCGAGGCGGGAGG - Intronic
1060264935 9:122106190-122106212 TTCCTGCCACCTTATGAAGAAGG - Intergenic
1061130554 9:128705638-128705660 TTCCTGCCTATAGATCAGTAGGG + Intronic
1061329522 9:129883738-129883760 TTTCTGCTCCTTGATGAGGAAGG + Intergenic
1061626876 9:131845763-131845785 TTTCTGCCTCATGAAGAGAAAGG - Intergenic
1062037358 9:134388725-134388747 TTCCTGCACCTGGATGGGGAGGG + Intronic
1186004724 X:5056753-5056775 TTCCTGCCGCCTTATGAAGAAGG + Intergenic
1186024457 X:5293666-5293688 TTCCTGCCACCTTGTGAGGAAGG + Intergenic
1186109420 X:6240171-6240193 TTCCTGGCACTTGATGATAATGG + Intergenic
1187735885 X:22303365-22303387 TTCCCGACTCTTGAGGAAGAGGG - Intergenic
1187868437 X:23744266-23744288 GGCTTGCCTCTTGATAAGGAAGG + Intronic
1188655337 X:32687417-32687439 TTTCTGCCCCTTGACTAGGATGG + Intronic
1189798717 X:44672482-44672504 CTGCTGACTCTTGATGGGGATGG + Intergenic
1189995442 X:46633010-46633032 ATCCTGCCTCAGAATGAGGAAGG - Intronic
1190325577 X:49205072-49205094 TGCCTGCCTCCTGCTGGGGAGGG + Exonic
1190909233 X:54756964-54756986 TTCCTCACTCCTGATGAAGATGG - Exonic
1190916114 X:54812330-54812352 TTCCTGACTCTCTAAGAGGATGG - Intronic
1190927983 X:54925763-54925785 TTCCTGACTCTCTAAGAGGATGG - Intronic
1191870654 X:65742298-65742320 GTCCTGCCTCTTTGTCAGGAAGG + Intergenic
1193036936 X:76961408-76961430 TTCTTTCCTCATTATGAGGATGG + Intergenic
1193572943 X:83166393-83166415 TTCCTACCTCTACGTGAGGAAGG + Intergenic
1195124906 X:101798519-101798541 TTCCTGCCACCTGGTGAAGAAGG + Intergenic
1195242969 X:102971539-102971561 TTCCTGCCACCTTGTGAGGAAGG + Intergenic
1196306431 X:114108408-114108430 TTCCTGCCTCCTTGTGAAGAAGG + Intergenic
1197039120 X:121913891-121913913 TTCCAGCCTCTTGCTGAGCTGGG + Intergenic
1198382985 X:136101546-136101568 TTGCAGCCTGTGGATGAGGATGG + Intergenic
1198712217 X:139517414-139517436 TTCCTGCGTCTTGATATGAAAGG - Intergenic
1198984828 X:142438616-142438638 TTCCTGCATCTTGGTCAGGCTGG - Intergenic
1199002844 X:142660331-142660353 TTCCTTCCTCTTGGAGACGATGG + Intergenic
1199571303 X:149269712-149269734 CTCCTGCCTCATGACCAGGATGG - Intergenic
1200019870 X:153194059-153194081 TTCCTGCCCTTAGATGAGAATGG + Intergenic
1200701174 Y:6403763-6403785 TCCCTGCCTCTTGCTGGAGACGG - Intergenic
1200704288 Y:6428440-6428462 TTCCTGCCTCTTGAGGGAGAAGG - Intergenic
1201029823 Y:9736268-9736290 TTCCTGCCTCTTGAGGGAGAAGG + Intergenic
1201032938 Y:9760935-9760957 TCCCTGCCTCTTGCTGGAGACGG + Intergenic
1201486694 Y:14502430-14502452 TTCCTGGCACTTGATGATAATGG - Intergenic
1201554685 Y:15255835-15255857 GCCCTCCCTCTTGATAAGGACGG - Intergenic