ID: 1121340232

View in Genome Browser
Species Human (GRCh38)
Location 14:93100627-93100649
Sequence CCTTGGGGCATTCTGGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 264}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121340232 Original CRISPR CCTTGGGGCATTCTGGCTTC AGG (reversed) Intronic
900852116 1:5152311-5152333 CCTTGTGGAGTTCTGCCTTCTGG + Intergenic
901494462 1:9613343-9613365 CCTTGGGGCTCCCTGGCTTCGGG - Exonic
902209375 1:14893687-14893709 CTTTGTGGCTTTCTGGCCTCAGG - Intronic
902246339 1:15123413-15123435 CCTTGGGGACATCTGGCTTCAGG - Intergenic
902489854 1:16773343-16773365 CCTTGCCGCTTTCTGGCTTCTGG + Intronic
904030674 1:27531821-27531843 CCTTGATGCATTCTGGGATCAGG + Intergenic
905000564 1:34664953-34664975 CCATGGGGCTTTCTGACTCCAGG + Intergenic
905563468 1:38945132-38945154 CCTTGGGGCACCTTGGCCTCTGG - Intergenic
906034590 1:42742271-42742293 CCAGGGGTCATTCTGGTTTCAGG + Intergenic
906323428 1:44830198-44830220 CCTTGGGGCTTCCTGTCTGCGGG - Intronic
906616480 1:47236097-47236119 ACCTAGGGCAGTCTGGCTTCAGG + Intergenic
906804265 1:48764893-48764915 GCTTGGGGCAGGCTTGCTTCTGG + Intronic
907300013 1:53481235-53481257 CTTTGGGGCTCTCTGGCTTCTGG - Intergenic
907916966 1:58879984-58880006 CCTTGGGCTTTTCTGGCTCCAGG - Intergenic
910936041 1:92485170-92485192 CCTAGGGGCATTCTGGCGCTTGG - Intronic
912713075 1:111963365-111963387 CCCTGAGGCATTCTGGCTCTAGG - Intronic
913674974 1:121131987-121132009 CCTTGGGACATACTCTCTTCTGG + Intergenic
914026815 1:143919619-143919641 CCTTGGGACATACTCTCTTCTGG + Intergenic
914665199 1:149827052-149827074 CCTTGGGACATACTCTCTTCTGG + Intergenic
914670566 1:149866769-149866791 CCTTGGGACATACTCTCTTCTGG - Intronic
917112464 1:171562899-171562921 TCTTGGGGCTTTCTGACTCCAGG + Intronic
918171744 1:182004122-182004144 CCTAGGGGGATTATGGCTGCAGG - Intergenic
919834720 1:201565820-201565842 CCCAGGGGCCTTGTGGCTTCAGG + Intergenic
922184066 1:223258532-223258554 CCTGGGGGCATTCTGGGTTTGGG + Intronic
922562624 1:226580175-226580197 CCATGGGGAATCCTGGGTTCTGG + Intronic
923530586 1:234809185-234809207 CCTTGCCGCTTTCTGGCTTCTGG - Intergenic
1063444835 10:6105473-6105495 CATTGGGGGATTTTGGCTTAGGG + Intronic
1069248814 10:66243882-66243904 CTTTGAGACATGCTGGCTTCAGG + Intronic
1070666431 10:78348286-78348308 CCCTTTGGCTTTCTGGCTTCAGG - Intergenic
1071819259 10:89264026-89264048 CTTTGGGGCACTGTGGTTTCTGG - Intronic
1071914040 10:90270472-90270494 CCTTAGGGCATTGGAGCTTCAGG + Intergenic
1072155613 10:92721059-92721081 CCTTAGGACATTCTGCCTTTTGG + Intergenic
1074151476 10:110763280-110763302 GCTTGGGGTATCCTGGCATCAGG - Intronic
1074813436 10:117126840-117126862 CCTTGGGCCCTCCTGCCTTCCGG + Intergenic
1074987886 10:118673543-118673565 CTTTGGGGCCAGCTGGCTTCAGG - Intergenic
1075565600 10:123501671-123501693 CCTTGGGGCATGGTGGGTTTGGG - Intergenic
1075830542 10:125407379-125407401 CATTGGGCCATGCTGACTTCAGG - Intergenic
1075898199 10:126016689-126016711 CCTGGGAGAAATCTGGCTTCTGG - Exonic
1076628052 10:131833958-131833980 CCTTGGGGAAAACTGCCTTCTGG - Intergenic
1078180329 11:9004935-9004957 CCTTCAGGCATCCTGGATTCTGG + Intergenic
1079247737 11:18765430-18765452 CCTTGGCTCATGCTGCCTTCAGG + Intronic
1080777911 11:35403402-35403424 CCTTGAGACAATCTGCCTTCTGG - Intronic
1080823277 11:35826907-35826929 CCTGGGTTCATTCTGGCTTGGGG - Intergenic
1081321444 11:41696425-41696447 CCTTGGCGCAACCTGTCTTCTGG - Intergenic
1083030836 11:59590394-59590416 AGTTGAGGCAATCTGGCTTCAGG - Intronic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1084856397 11:71990490-71990512 CCTTTGGGCCTTCTCGCTTTGGG + Intronic
1085267689 11:75246927-75246949 CCCTGGGGCATCCTGGGCTCGGG - Intergenic
1087377698 11:97365859-97365881 CCTTGAGACTTTCTGGCTTCCGG + Intergenic
1089573986 11:119428484-119428506 ACTTGGAGCATTCTGTCTCCAGG - Intergenic
1090805364 11:130198873-130198895 CATTGGTGGTTTCTGGCTTCTGG + Intronic
1092391103 12:8080246-8080268 TTTTGGAGGATTCTGGCTTCTGG - Intergenic
1092878129 12:12866219-12866241 CCTTGCGTCTTCCTGGCTTCTGG - Intergenic
1094189870 12:27687264-27687286 CCTTGGGGCATATTGGTTTGAGG + Intronic
1098891336 12:76012905-76012927 CCTTGGGGATTACTGGGTTCAGG - Intergenic
1099256551 12:80321674-80321696 CCTTGCAGAATTCTGGCATCTGG - Intronic
1102523581 12:113494713-113494735 CCTTGGTGAATTATGGCTCCTGG + Intergenic
1102641873 12:114374013-114374035 CCTTGGGGCATCCTTTGTTCTGG + Intronic
1102767119 12:115443185-115443207 CCTTGGTGTATTCTGCCTCCTGG - Intergenic
1105284309 13:18992340-18992362 CCTTCGGGCCTTCTGCCTTTTGG - Intergenic
1105284616 13:18994068-18994090 GCTTCTGGCCTTCTGGCTTCTGG - Intergenic
1105284658 13:18994305-18994327 CCTTCTGGCTTTCTGCCTTCTGG - Intergenic
1105284950 13:18996049-18996071 CCTTGTAGCCTTCTGCCTTCTGG - Intergenic
1106765740 13:32911961-32911983 CCTTGACCCATTATGGCTTCGGG + Intergenic
1108070937 13:46627990-46628012 GTTTGGGGCAGTCTGGCTTATGG + Intronic
1108070944 13:46628022-46628044 GTTTGGGGCAGTCTGGCTTATGG + Intronic
1108848236 13:54700207-54700229 CCTTGGGGCTCTGTGGTTTCTGG - Intergenic
1109348561 13:61146126-61146148 CCTTGGGGCTCTGTGGTTTCTGG + Intergenic
1109689164 13:65863970-65863992 CCTTGCCTCATCCTGGCTTCTGG + Intergenic
1111271134 13:85887503-85887525 CAATGTGGCATTCTGACTTCTGG + Intergenic
1118933207 14:70262235-70262257 CTTTGGGGCATGCAGGGTTCTGG + Intergenic
1119198771 14:72737716-72737738 CCTTGGGGCAGTCTGTCTGTTGG - Intronic
1120859074 14:89238219-89238241 CCTTGAGGCACTGCGGCTTCAGG + Intronic
1121340232 14:93100627-93100649 CCTTGGGGCATTCTGGCTTCAGG - Intronic
1121883074 14:97517725-97517747 CCTTGAGACTTTCTGTCTTCTGG + Intergenic
1122894007 14:104746415-104746437 CCTTGGGGCATCCAGGGTGCAGG - Intronic
1125539030 15:40459196-40459218 CCTTGGGCCACTTTGGCCTCGGG - Exonic
1127971406 15:63965405-63965427 CCCAGGGCCATGCTGGCTTCAGG - Intronic
1128453670 15:67821336-67821358 CCTGGGGGCGTCCTGGCTCCAGG + Intronic
1129069747 15:72940783-72940805 CCCTGGGGCCTTCTTGCTTTGGG + Intergenic
1130015788 15:80185426-80185448 ACCTCAGGCATTCTGGCTTCAGG + Intronic
1130149161 15:81298333-81298355 CCTTGGGGGATGCTTGCTACTGG - Intronic
1130511794 15:84595521-84595543 CTCTGAGGCATGCTGGCTTCGGG + Intergenic
1130986435 15:88847699-88847721 CCTGGGGGATTTCTGGCTTCAGG - Intronic
1131364064 15:91822707-91822729 TCATGGGGCATACTGGCTTCTGG - Intergenic
1133017981 16:2953725-2953747 CCTTGGGTACGTCTGGCTTCTGG - Intergenic
1133463452 16:6007370-6007392 CCTTGGGGGCTTCAGGCTACTGG - Intergenic
1134120405 16:11580073-11580095 CATTGGAGCATTCTGGATTTTGG + Intronic
1135125664 16:19807278-19807300 AGCTGGGGCATTCTGGCTTAGGG - Intronic
1135654127 16:24232935-24232957 CCTTAGGTCTTTCTGGCTTCAGG + Intergenic
1136088506 16:27902443-27902465 CCAAGGGGGAATCTGGCTTCAGG + Intronic
1137743705 16:50805184-50805206 CATTGGGGCATTTTGGATTTTGG - Intergenic
1138229138 16:55324853-55324875 CCATGGGCCCTTCTGTCTTCCGG + Exonic
1140491731 16:75342768-75342790 CCTTGGGTCATTCTGCCCTCAGG + Intronic
1140555570 16:75917072-75917094 CCTTGGTGGACTCTGGCTTATGG + Intergenic
1140890009 16:79276931-79276953 CCTTGACGTACTCTGGCTTCTGG + Intergenic
1141021374 16:80499969-80499991 CAATGGGACATCCTGGCTTCAGG + Intergenic
1141564927 16:84894984-84895006 CCTCGGGGCAGCCTGGCTTGGGG - Intronic
1143031665 17:3971390-3971412 CCTTAGGGCAGCCTGGCCTCAGG + Intergenic
1143462143 17:7110509-7110531 CCTGTGGGCAGTCTGGTTTCAGG - Intronic
1146264917 17:31446424-31446446 CCTTGGTACTTTCTGGCTCCAGG + Intronic
1146575946 17:33991607-33991629 CCTTGGGGAATTCTTCCTGCTGG - Intronic
1147652659 17:42071249-42071271 CCCTGGGGCCTTCTGGGTGCTGG + Intergenic
1148097200 17:45060828-45060850 GCCTGGGGCATTCCGGCTCCAGG + Intronic
1148808154 17:50274490-50274512 GCTTGGGACATCCTGGCTTGGGG - Exonic
1149917441 17:60623696-60623718 CCTTGGGAAGTTCTGGCTTATGG - Exonic
1150295534 17:64005440-64005462 CATTGAGGCAGTCTGGCTCCTGG + Intronic
1151492178 17:74439337-74439359 CCCTGGGACTTTCAGGCTTCAGG - Intronic
1151759334 17:76091640-76091662 GCTGGGGGCCTGCTGGCTTCAGG - Intronic
1152681476 17:81670550-81670572 CCATGGGGCAGCCTGGATTCAGG + Intronic
1153728233 18:7979975-7979997 CCTCTGGGCATGCTGGCTCCTGG + Intronic
1153910636 18:9703616-9703638 CATTGGAGCATTTTGGATTCGGG + Intergenic
1153995767 18:10440233-10440255 CCTGGGGGCTTTCTGCCTTGGGG - Intergenic
1155319977 18:24609449-24609471 CCTTGGGTTGCTCTGGCTTCAGG - Intergenic
1156464275 18:37338927-37338949 CCTTGGGGCAGTGGGGGTTCAGG - Intronic
1157231265 18:45918350-45918372 CATTGGGGCATTTTGGATTTGGG - Intronic
1158184140 18:54752248-54752270 CCTTGGTTCATTCAGGCTTATGG + Intronic
1158307475 18:56122351-56122373 CCTTTGAGCGTTCTGTCTTCTGG + Intergenic
1161308568 19:3580875-3580897 CATTGTGGGATTCTGGCCTCTGG + Intergenic
1164473673 19:28556137-28556159 CCTGGAGGCATGCCGGCTTCAGG + Intergenic
1165092359 19:33393823-33393845 CCTTGGGGTGGTCTGGCCTCTGG - Intronic
1165118637 19:33544967-33544989 CCTTGGGAGTTCCTGGCTTCTGG + Intergenic
1167007383 19:46784790-46784812 CCCTGAGGCATTGTGGGTTCGGG + Intronic
1168158176 19:54490134-54490156 CCTTGTGCAATTCTGACTTCAGG + Intergenic
927650894 2:24913181-24913203 CCTGGGGGCTTTCAGCCTTCAGG - Intronic
928653761 2:33428122-33428144 CCTTCGGGCATTGTGGATTTGGG - Intergenic
929372821 2:41247345-41247367 CCTTGGTATATTCTGGCTGCAGG - Intergenic
929961786 2:46502663-46502685 CTTTGGCACATTCTGGCCTCGGG - Intronic
930422370 2:51169140-51169162 TCTTGTGGAATTCTGGTTTCTGG - Intergenic
931177653 2:59869987-59870009 CCCTGGGGCAGTGTGGCCTCAGG + Intergenic
932997351 2:76871594-76871616 CCTTTTGGCATTCAGACTTCTGG + Intronic
935699183 2:105796186-105796208 CCTCTGGGCACTGTGGCTTCAGG + Intronic
935714267 2:105926225-105926247 CCTTGCCGCATTCTAGTTTCAGG - Intergenic
937062934 2:118993555-118993577 CCATGTGGCATTCTGACTCCAGG - Intronic
938884727 2:135632857-135632879 CCTGGGAGAAATCTGGCTTCAGG - Intronic
940879579 2:158933337-158933359 CTCTGGGGCATTGTGGCGTCTGG - Intergenic
942435679 2:175972392-175972414 CCTTGGAGCATTTTGGATTTTGG - Intronic
942552786 2:177137196-177137218 ATTTGGGGCATTCTGGTCTCGGG - Intergenic
943067629 2:183105552-183105574 CCCAGGGCCATGCTGGCTTCAGG - Intergenic
943302720 2:186223677-186223699 CCTAAGGCCATGCTGGCTTCAGG + Intergenic
943777015 2:191776771-191776793 CCTTGGGTAATTCTGTCTTTAGG - Intergenic
945551730 2:211229129-211229151 CCCTGAGCCATGCTGGCTTCAGG + Intergenic
946946598 2:224828537-224828559 CCATGGTGCATGCTGTCTTCTGG - Intronic
947308719 2:228776813-228776835 CCTTTGGGCATTGTGTCATCTGG - Intergenic
948776229 2:240290332-240290354 CCATGGGGCGTGCTGGATTCGGG - Intergenic
948868990 2:240788944-240788966 GCTTTGGGCATTCTGACTTTGGG + Intronic
1168742075 20:200506-200528 CCATGAGACTTTCTGGCTTCAGG - Intergenic
1169792986 20:9431148-9431170 CCTTGCCTCTTTCTGGCTTCTGG + Intronic
1170221652 20:13947711-13947733 CTTTGGGGCACTGTGGTTTCTGG + Intronic
1171012667 20:21517044-21517066 CCTAGGGGAATCCTGGCTCCTGG + Intergenic
1171345075 20:24459816-24459838 CCTTGGAGCACTCAGGCTGCTGG + Intergenic
1172787714 20:37480139-37480161 CCTTTGGGACTTGTGGCTTCTGG - Intergenic
1179231570 21:39508254-39508276 AATTGTGGCACTCTGGCTTCAGG + Intronic
1179984647 21:44913726-44913748 CCGTGGGCCATCCTGGCTGCTGG - Intronic
1180968173 22:19801263-19801285 CCTGGGTACATCCTGGCTTCTGG - Intronic
1181859554 22:25807609-25807631 CCTTATGGCATGGTGGCTTCAGG + Intronic
1182508697 22:30803397-30803419 CCTTGTGACTGTCTGGCTTCTGG - Intronic
1183708674 22:39489914-39489936 CCTTGGGGCAGGCTGGCTGGGGG + Exonic
949307667 3:2661255-2661277 CCTTGGGGCTGCCTGGCTTTGGG - Intronic
952094391 3:29931348-29931370 TCTAGGGGCAGTGTGGCTTCTGG + Intronic
952229994 3:31419663-31419685 ATTTGGGAAATTCTGGCTTCAGG - Intergenic
953407633 3:42667298-42667320 CCTTGGGGCTCTCTGGTCTCAGG + Intergenic
953457810 3:43056473-43056495 CCTTGTGCCCCTCTGGCTTCTGG - Exonic
954716264 3:52528411-52528433 CCATGGGGCAGGCTGGCTGCTGG + Intronic
956587691 3:70881962-70881984 CCTTGGAGCATGTTAGCTTCTGG + Intergenic
958043750 3:88257780-88257802 CCTTGCCCCTTTCTGGCTTCTGG + Intergenic
961061868 3:123835439-123835461 CCCTGGGGTCTTCTGTCTTCAGG - Intronic
961624578 3:128253032-128253054 CATTAGGGCACCCTGGCTTCTGG - Intronic
962686833 3:137856056-137856078 CCTTGCCTCTTTCTGGCTTCTGG + Intergenic
962866756 3:139453560-139453582 CCTGTGGGCTTTCTGGCCTCTGG + Intronic
963349379 3:144134141-144134163 CCTTGGGCCTCTCTGGCTGCAGG - Intergenic
968649764 4:1755869-1755891 GCCTGGGCCATTGTGGCTTCAGG - Intergenic
970503220 4:16700092-16700114 CATTGGAGCATTCTGGATTTTGG - Intronic
973967789 4:56181667-56181689 CCTTGGCTCTTCCTGGCTTCTGG + Intronic
974875816 4:67701258-67701280 CCTAGGGGCGTCCTGGTTTCCGG + Intergenic
975409386 4:74031757-74031779 CCTTGGGGAATTGTGCCTTGGGG + Intergenic
980123905 4:128755102-128755124 CCTTCTGGCATTGTTGCTTCAGG - Intergenic
982494793 4:156077426-156077448 CCTTGGGGCTTCGTGGCTGCTGG - Intergenic
983078472 4:163355172-163355194 CCTTGCCCCTTTCTGGCTTCTGG + Intergenic
983421655 4:167526451-167526473 CCCAGTGCCATTCTGGCTTCAGG - Intergenic
985192897 4:187396336-187396358 CCTGGGGGCGATCTGCCTTCAGG - Intergenic
987012279 5:13779759-13779781 GCTTGGTGCATCCTGGTTTCTGG - Intronic
987696931 5:21344353-21344375 GCTTTGGCCATTCTGGCTTTTGG + Intergenic
988590606 5:32545604-32545626 CTTTAGGGCATTCGGGCTACAGG - Intronic
988755273 5:34242188-34242210 GCTTTGGCCATTCTGGCTTTTGG - Intergenic
990194688 5:53301443-53301465 CCTTGAGTCATCCTAGCTTCTGG + Intergenic
991743509 5:69707916-69707938 GCTTTGGCCATTCTGGCTTTTGG - Intergenic
991754200 5:69847316-69847338 GCTTTGGCCATTCTGGCTTTTGG + Intergenic
991795082 5:70287648-70287670 GCTTTGGCCATTCTGGCTTTTGG - Intergenic
991803825 5:70404075-70404097 GCTTTGGCCATTCTGGCTTTTGG + Intergenic
991822880 5:70583194-70583216 GCTTTGGCCATTCTGGCTTTTGG - Intergenic
991833516 5:70722439-70722461 GCTTTGGCCATTCTGGCTTTTGG + Intergenic
991887447 5:71287170-71287192 GCTTTGGCCATTCTGGCTTTTGG - Intergenic
991905913 5:71510454-71510476 CCTTGGGGAAATCTCCCTTCCGG - Exonic
992060508 5:73040288-73040310 CATTGGAACATTCTGGCTTTGGG - Intronic
992217848 5:74543331-74543353 GCTTGGAGCATTGTGGCTTGTGG - Intergenic
992502686 5:77357694-77357716 CCTTGGGTCCTTGTGGGTTCAGG - Intronic
993567164 5:89490051-89490073 CCTTGGCTCTTTCTAGCTTCTGG - Intergenic
997695279 5:135856550-135856572 CCTTGGGGCAGCCAGGCCTCAGG - Intronic
999919528 5:156303587-156303609 CCTAGGGCTATGCTGGCTTCAGG - Intronic
1000100528 5:158012098-158012120 CCTTGGGGGAAGCTGTCTTCTGG + Intergenic
1001210419 5:169805802-169805824 CCGTGGGGGATTGTGGCATCTGG + Intronic
1002913549 6:1510205-1510227 CCTTGAGCCTTTCTGGCTCCAGG - Intergenic
1005553905 6:26953952-26953974 GCTTTGGCCATTCTGGCTTTTGG - Intergenic
1009893780 6:69721599-69721621 CTCTGGGACATGCTGGCTTCAGG + Intronic
1010139832 6:72601738-72601760 CCCAGTGCCATTCTGGCTTCAGG - Intergenic
1010334871 6:74668808-74668830 CTTTGGAGCATTTTGGATTCTGG - Intergenic
1012091454 6:94902817-94902839 CCTTGAGACTTGCTGGCTTCAGG + Intergenic
1012667100 6:101985420-101985442 CCTGGTGACATTCTGGCTTTTGG + Intronic
1013624971 6:111927620-111927642 CCTGAGGGCAAACTGGCTTCAGG + Intergenic
1014222547 6:118812431-118812453 CACTGGGGCATTCTGGATTTTGG + Intergenic
1015611470 6:135025317-135025339 CTTTGGAGAACTCTGGCTTCTGG - Intronic
1018316560 6:162562329-162562351 CTCTGGGACATGCTGGCTTCAGG + Intronic
1019135360 6:169904454-169904476 CCCTGGGGCCTTTTGGGTTCAGG + Intergenic
1019267429 7:125918-125940 TCTTGAGGCATCATGGCTTCTGG + Intergenic
1020010121 7:4802645-4802667 CCTCGGGGCACTCTGGCTGGGGG + Intronic
1020010216 7:4802867-4802889 CCTCGGGGCACTCTGGCTGGGGG + Intronic
1020809018 7:12828504-12828526 CCTTTGAGCATTGTGTCTTCAGG - Intergenic
1021234840 7:18130168-18130190 CGTTGGAGCATTCTGGGTTGTGG - Intronic
1022565228 7:31392700-31392722 CCTTGAGGCTGTGTGGCTTCTGG + Intergenic
1022630108 7:32076774-32076796 TCAATGGGCATTCTGGCTTCAGG - Intronic
1023908180 7:44536721-44536743 CCTGGGGGTAGCCTGGCTTCTGG - Intronic
1024050766 7:45621750-45621772 GCTGGGGGCGTTCTGGGTTCAGG + Intronic
1026152251 7:67798068-67798090 CCTGGGGGCATTAAGCCTTCTGG + Intergenic
1028181482 7:87730114-87730136 CCCAGGGCCATGCTGGCTTCAGG + Intronic
1028841494 7:95434306-95434328 CTGTCTGGCATTCTGGCTTCAGG + Intronic
1029172935 7:98643652-98643674 CCCTGAGGCATTCTAGGTTCTGG - Intergenic
1030952817 7:115813107-115813129 CCTTGCTGGAATCTGGCTTCAGG - Intergenic
1032464646 7:132136366-132136388 CCTGTGGGCATTCTGCCTTCAGG + Intronic
1033691315 7:143740310-143740332 CTTTGAGGCTTGCTGGCTTCAGG + Intergenic
1034974207 7:155438483-155438505 CCATGGGGGATCCAGGCTTCAGG + Intergenic
1035305074 7:157926900-157926922 CCCTGGGGCTTCCTGTCTTCAGG - Intronic
1035305117 7:157927080-157927102 CCCTGGGGCTTCCTGTCTTCGGG - Intronic
1035305132 7:157927140-157927162 CCCTGGGGCTTCCTGTCTTCGGG - Intronic
1035305190 7:157927379-157927401 CCCTGGGGCTTCCTGTCTTCAGG - Intronic
1035305218 7:157927498-157927520 CCCTGGGGCTTCCTGTCTTCGGG - Intronic
1035305247 7:157927617-157927639 CCCTGGGGCTTCCTGTCTTCGGG - Intronic
1035991069 8:4490727-4490749 CCCTGGGTTATCCTGGCTTCTGG - Intronic
1036015822 8:4783308-4783330 TCTTGGGGCACTCTGGCTGGAGG - Intronic
1036665337 8:10733744-10733766 AATTGGGGATTTCTGGCTTCGGG - Intronic
1037681322 8:21100019-21100041 ACTTGGAGGATCCTGGCTTCAGG + Intergenic
1038491318 8:27973937-27973959 CTTTGGGGTATTCTTGCTCCCGG - Intronic
1038952339 8:32429266-32429288 CCTGAGGGCATTGTTGCTTCTGG - Intronic
1040549205 8:48425428-48425450 ACTTGGGGCATCCTGGATGCTGG + Intergenic
1042162618 8:65912514-65912536 CCCTGAGACATGCTGGCTTCAGG + Intergenic
1045263552 8:100598619-100598641 CCTTGTAGAATTCTGTCTTCTGG - Intronic
1045387632 8:101686875-101686897 CCTTGAGGCATGCAGTCTTCTGG + Exonic
1047800221 8:128301376-128301398 ACTGGCAGCATTCTGGCTTCTGG + Intergenic
1047938186 8:129802176-129802198 CCTTGGAGGATTCTTGCTGCAGG + Intergenic
1048422139 8:134287595-134287617 CCTTAGAGCATCCTGTCTTCAGG + Intergenic
1049693695 8:143973589-143973611 CCGTGGGGCATCCTGGGTGCGGG - Intronic
1052997942 9:34561141-34561163 CCTTGAGGCATTCCAACTTCTGG + Intronic
1056680042 9:88709158-88709180 CTTGGGGGCTTTCTGGCTTTCGG - Intergenic
1056795057 9:89653042-89653064 CATTGGAGCATTCTGGATTTTGG - Intergenic
1057090765 9:92256160-92256182 CCCTGGGGAATTCTGTCTTTAGG - Intronic
1057503818 9:95616580-95616602 ACTTGAGGCATGCTGGCTTTAGG + Intergenic
1060164524 9:121399087-121399109 CCTATGGGCATTGTGGGTTCTGG + Intergenic
1060428481 9:123526525-123526547 CCTCGGGGCATTGTGGCTGGGGG - Intronic
1061284066 9:129612397-129612419 CCTTAGGGCAGCCTTGCTTCAGG + Exonic
1061289758 9:129643897-129643919 CCTTGATGCCTTCTTGCTTCTGG + Intergenic
1062614305 9:137389077-137389099 CCTGGTGGCCTTCTGGCGTCCGG + Intronic
1185460929 X:332530-332552 CCCTGGAACATCCTGGCTTCTGG + Intergenic
1186106850 X:6216509-6216531 CCTGGGGGCATTCTGGAGTGAGG - Intronic
1187483982 X:19684698-19684720 GTTTGGGGGATTCTGGCCTCTGG - Intronic
1187709365 X:22038512-22038534 CTTCGATGCATTCTGGCTTCAGG - Exonic
1189901819 X:45714216-45714238 AGTTGGGGCTTTCTGTCTTCTGG - Intergenic
1191123797 X:56933016-56933038 ACTGGTGACATTCTGGCTTCAGG + Intergenic
1192676194 X:73199295-73199317 CCTTGGGACTTGCTGGTTTCTGG + Intergenic
1195834901 X:109103047-109103069 CTTTGAGACATGCTGGCTTCAGG - Intergenic
1197112911 X:122797650-122797672 CCCTGAGACTTTCTGGCTTCAGG + Intergenic
1197261412 X:124322851-124322873 CCTTTAGGCCTTCTGGTTTCTGG + Intronic
1197435657 X:126425269-126425291 CCCTGAGACATTCTGGCTTCAGG - Intergenic
1197645779 X:129015223-129015245 CAGTGGTGCATTCTGGTTTCTGG - Intergenic
1199568671 X:149245900-149245922 TCCTGGGCTATTCTGGCTTCAGG - Intergenic
1200582213 Y:4963926-4963948 CTCTGAGGCTTTCTGGCTTCAGG - Intergenic
1200886816 Y:8279639-8279661 CCTTGAGGGGTTTTGGCTTCTGG - Intergenic
1201017833 Y:9623781-9623803 CCTTGTGGGGTTTTGGCTTCTGG - Intergenic
1201372233 Y:13278274-13278296 CCTCGGGCCATGCTGGCTTCAGG + Intronic
1201383597 Y:13413598-13413620 CTTTGGGGCTTTGTGGTTTCTGG + Intronic