ID: 1121342701

View in Genome Browser
Species Human (GRCh38)
Location 14:93115039-93115061
Sequence GGGACGCGGCGCCGGCGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 485
Summary {0: 1, 1: 0, 2: 2, 3: 53, 4: 429}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121342701_1121342711 8 Left 1121342701 14:93115039-93115061 CCCGGGCGCCGGCGCCGCGTCCC 0: 1
1: 0
2: 2
3: 53
4: 429
Right 1121342711 14:93115070-93115092 TGCACAGCTCGGCGAAGGCCTGG 0: 1
1: 1
2: 2
3: 8
4: 103
1121342701_1121342706 -3 Left 1121342701 14:93115039-93115061 CCCGGGCGCCGGCGCCGCGTCCC 0: 1
1: 0
2: 2
3: 53
4: 429
Right 1121342706 14:93115059-93115081 CCCTCCTTACCTGCACAGCTCGG 0: 1
1: 0
2: 2
3: 31
4: 201
1121342701_1121342709 3 Left 1121342701 14:93115039-93115061 CCCGGGCGCCGGCGCCGCGTCCC 0: 1
1: 0
2: 2
3: 53
4: 429
Right 1121342709 14:93115065-93115087 TTACCTGCACAGCTCGGCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121342701 Original CRISPR GGGACGCGGCGCCGGCGCCC GGG (reversed) Intronic
900117424 1:1034530-1034552 GGGGCGCAGAGCCGGAGCCCCGG + Intronic
900221487 1:1511733-1511755 CCGAGGCGGCACCGGCGCCCGGG - Intergenic
900243991 1:1629402-1629424 GGGGCGCGGCCCCGGGCCCCAGG + Exonic
900349396 1:2227661-2227683 CGGAGGCGGCGGTGGCGCCCGGG - Intergenic
900349545 1:2228154-2228176 GGGCCGCGGAGCCGGCGGGCGGG + Intergenic
900513014 1:3069318-3069340 GCGCCGCGCCGCCGGGGCCCGGG + Intronic
901483177 1:9539851-9539873 GGGCTACGGCGCCGGCGCTCGGG + Intronic
902067553 1:13700472-13700494 GGGACGAGGCGCGGGCCTCCGGG + Intronic
902478815 1:16701248-16701270 GGGGCGCGGAGCCGGCGGGCTGG - Intergenic
902600951 1:17539878-17539900 GAGGCGCGGCGCCGGCCGCCAGG + Exonic
903078037 1:20787092-20787114 TGGGAGCGGCGTCGGCGCCCCGG + Intronic
903628231 1:24745984-24746006 GGGGCCGGGCCCCGGCGCCCGGG - Intronic
904037926 1:27568698-27568720 CGGCCGCGGCGCGGGTGCCCGGG + Intronic
904768964 1:32870618-32870640 GGGGCGGGGGGCCGGCGCCGGGG - Intronic
905018131 1:34791468-34791490 GGGACCCGGCCCTGGGGCCCAGG + Intronic
905137178 1:35808475-35808497 GGGACCCGGGGCGGGCGGCCGGG + Intronic
905442733 1:38005402-38005424 GGGACGCGGCGCCCGGTTCCCGG - Exonic
905449163 1:38046227-38046249 GGGGGGCGGCGGCGGCGGCCTGG - Exonic
906317974 1:44800364-44800386 GCTACGCTGCGCTGGCGCCCAGG - Exonic
906960989 1:50419382-50419404 GTGAGGCCGCGCCGGCGCCAGGG - Exonic
907012689 1:50978107-50978129 GGGGCGCTGCGCCGGCGGCCGGG - Intergenic
907278088 1:53327951-53327973 GAGACGCGGCGGCGGCGGCGCGG - Exonic
907541019 1:55215384-55215406 GAGGCGCGGCCCCGCCGCCCGGG - Intergenic
908258112 1:62318957-62318979 GGGACGCGGCGCTGGGGACTGGG + Intronic
908272881 1:62437414-62437436 GGGAGGAGGGGCCGGCTCCCGGG + Intronic
908561383 1:65309873-65309895 GGGACTCCGCGCCGCTGCCCCGG - Exonic
908714284 1:67053735-67053757 GCGGCGCGGCGCCGGCTCCCTGG - Intronic
909433313 1:75614982-75615004 GGGTCGCAGAGCCGGCGCGCGGG - Intergenic
910200150 1:84690559-84690581 GGCCTGCGGCGCCGGCGCGCGGG - Intronic
910676499 1:89821378-89821400 GGGCCGCGGCGCCTGCGCCAGGG - Intronic
912915737 1:113812514-113812536 GGGACGCGGCGGGGGCGCGGCGG - Intergenic
914022825 1:143885093-143885115 GTGGCGCCGCGCCGGGGCCCGGG - Intergenic
914032389 1:143972723-143972745 GGGAAGCGGAGCCGGGGGCCTGG + Intergenic
914157056 1:145095244-145095266 GGGAAGCGGAGCCGGGGGCCTGG - Exonic
914661312 1:149793037-149793059 GTGGCGCCGCGCCGGGGCCCGGG - Intronic
915463425 1:156082509-156082531 GGGGCGCGCCGGGGGCGCCCGGG + Intergenic
916052376 1:161045502-161045524 GGGTCACGGCGCAGGCTCCCGGG - Intronic
920467867 1:206203607-206203629 GGGAAGCGGAGCCGGGGGCCTGG + Intronic
921010192 1:211133731-211133753 GAGCCGCGGCGCGGGCACCCAGG - Intronic
923918073 1:238530670-238530692 GGGAAGCTGCACCTGCGCCCAGG + Intergenic
1063115366 10:3068300-3068322 GGGACGCGGCGGGGGTGCGCGGG + Intronic
1064086522 10:12349740-12349762 GGGGCGCGGCGCGGGCGCAGAGG - Exonic
1065023199 10:21517330-21517352 GGCGCGCGGCGGCGGCGCCCGGG + Exonic
1065024286 10:21526242-21526264 GGGAGGGGGCGCCGGCCTCCCGG + Intergenic
1065024526 10:21527285-21527307 CGGGCGCGGGGCCGGCGCGCCGG + Intergenic
1065099552 10:22320710-22320732 GCGCCGCGGCGCCGGAGCCTGGG + Intronic
1065140529 10:22714650-22714672 GGGAGGCGGCTGCGGCGCCGCGG + Intergenic
1065367882 10:24952750-24952772 GGGGCGCAGCGCCGGGGCCATGG - Intergenic
1065660282 10:27998925-27998947 AGGCGGCGGCGGCGGCGCCCGGG - Intronic
1066220672 10:33334804-33334826 GAGCCGCGGAGCTGGCGCCCAGG + Exonic
1066221183 10:33336762-33336784 GGGAGGCGGCGACCGCGCGCGGG - Intergenic
1067110625 10:43397160-43397182 GAGCCGCCGCGCGGGCGCCCCGG - Intronic
1067295893 10:44975089-44975111 GGGGCGCGGCGCCGAGGCTCCGG + Intronic
1069703273 10:70441415-70441437 TGGACGCGGCGGAGGCGCCCCGG + Intronic
1071532560 10:86400944-86400966 GGAAGGCGGCGCCGACGCCGCGG + Intergenic
1071695440 10:87864139-87864161 GGGGTGCGGCGGCGGCGCACGGG - Exonic
1072021726 10:91409877-91409899 GGGACTCGGCGCCGCAGGCCAGG + Intergenic
1073251042 10:102120464-102120486 GGGAGCCGGCGCCGGCGCGAGGG - Intergenic
1075697622 10:124448115-124448137 GGGACGCCTGGCCGGCGCCTGGG + Exonic
1076145606 10:128117415-128117437 GGGGCGCTGCGCCTGCTCCCAGG - Intronic
1076719798 10:132388097-132388119 GGGAGGCGGGGCCTGCGTCCTGG - Intergenic
1076722040 10:132397017-132397039 GGGACGCGGCGGCGGCGGGCGGG + Intergenic
1076722222 10:132397594-132397616 GGGGCGCGGGGCCGGGGTCCCGG + Intronic
1076796129 10:132799303-132799325 GGGACACCGCGCCTGAGCCCGGG + Intergenic
1076796141 10:132799343-132799365 GGGACACCGCGCCTGAGCCCGGG + Intergenic
1076796147 10:132799363-132799385 GGGACACCGCGCCTGTGCCCGGG + Intergenic
1076796159 10:132799403-132799425 GGGACACCGCGCCTGAGCCCGGG + Intergenic
1076796165 10:132799423-132799445 GGGACACCGCGCCTGTGCCCGGG + Intergenic
1076796177 10:132799463-132799485 GGGACACCGCGCCTGAGCCCGGG + Intergenic
1076796183 10:132799483-132799505 GGGACACCGCGCCTGTGCCCGGG + Intergenic
1076796195 10:132799523-132799545 GGGACACCGCGCCTGAGCCCGGG + Intergenic
1076796212 10:132799583-132799605 GGGACACCGCGCCTGTGCCCGGG + Intergenic
1076796218 10:132799603-132799625 GGGACACCGCGCCTGAGCCCGGG + Intergenic
1076864434 10:133160113-133160135 GAGGGGCGGAGCCGGCGCCCAGG - Intergenic
1076911038 10:133389726-133389748 TGCAGACGGCGCCGGCGCCCAGG + Exonic
1077010361 11:376736-376758 CGCACGCGGCGCTGGGGCCCGGG - Exonic
1077028011 11:450331-450353 GGGTCGCGGCGCTGGCCCGCGGG - Exonic
1077058494 11:607537-607559 GGGATGCGGCCCCGGCCCACGGG + Exonic
1077081566 11:726761-726783 GGGGCGTGGCGCCGGAGCGCAGG - Intronic
1077285536 11:1763733-1763755 GGGTCGCGGCGCCGAGGTCCCGG - Intronic
1077323439 11:1952933-1952955 GAGACGCTGCGCTGGGGCCCAGG + Intronic
1077877502 11:6320420-6320442 GGGACCCCCCGCCGGCGCCTCGG + Exonic
1078594622 11:12675099-12675121 GGGGCGCGGCGCGGCCGGCCGGG - Intronic
1080386650 11:31814510-31814532 GAGGCGCAGCGCCGGCGCGCTGG + Intronic
1081773978 11:45665444-45665466 GGGACCCGGGGCCGGGGCTCAGG + Exonic
1081805047 11:45885844-45885866 GGGACGCGGCCCCCCCTCCCAGG - Exonic
1081831976 11:46121706-46121728 GGGCCGAGGCGCGGGGGCCCGGG - Intergenic
1081873112 11:46392056-46392078 GGGACGCGGCGCCCCCTCGCGGG + Intergenic
1083617920 11:64035650-64035672 GGGAGGCTGCGCCGCCGCGCGGG - Intronic
1083659810 11:64246791-64246813 GGGCGGCGGCGGGGGCGCCCGGG + Exonic
1083869365 11:65477490-65477512 GGGACGTGGCCCCGGCGCGGGGG + Intergenic
1083885770 11:65572834-65572856 GAGCCGCGCCGCCCGCGCCCCGG + Exonic
1083921077 11:65781528-65781550 GGGGCGAGGAGCCGGCGCCGCGG + Intergenic
1084516912 11:69642405-69642427 GGGAAACGCCGCCCGCGCCCAGG + Intronic
1085284600 11:75351629-75351651 GGTCCGCGGCGTCAGCGCCCAGG + Exonic
1087188688 11:95230712-95230734 GGGACGAGCCGCCCGAGCCCCGG + Intronic
1087672915 11:101128195-101128217 AGGACGCGCCGATGGCGCCCGGG - Exonic
1090699153 11:129279160-129279182 GGGACGCCGCGGCGGCGCGGCGG - Intronic
1091266620 11:134276568-134276590 CGGACCCGGCGCCCGCGCCTCGG + Intronic
1202806427 11_KI270721v1_random:8128-8150 GAGACGCTGCGCTGGGGCCCAGG + Intergenic
1091915343 12:4269228-4269250 GGGTCGCGGCGCTGGCTCCGGGG + Intergenic
1092108928 12:5945360-5945382 GCTGCGCGGCGCCGGCGGCCGGG - Intronic
1092383589 12:8018708-8018730 CGGGCGCGGCGGCGGCGGCCTGG - Intergenic
1094112773 12:26879055-26879077 GGCACACGGCGCCAGCACCCTGG - Intergenic
1097284242 12:57865388-57865410 GGAATGCGGGGCCGGCGCTCCGG - Intergenic
1097676068 12:62603467-62603489 GAGAGGCGGCGCCGGCGCCCGGG - Exonic
1100186368 12:92144969-92144991 GGGAAGCTGCGCCGCTGCCCCGG - Intronic
1100347042 12:93742481-93742503 GGGAGGCGGCGCCGACTGCCGGG + Intronic
1100565555 12:95790677-95790699 AGGAGGCGGCGGCGGCGGCCGGG - Exonic
1101606009 12:106248048-106248070 GGGAGGCGGGGTCGGCGCCGCGG - Intronic
1103433068 12:120904248-120904270 GGGCGGCGGCGGCGGCGGCCGGG + Exonic
1103488142 12:121296566-121296588 GGGAAACGGAGCGGGCGCCCGGG + Intronic
1103562772 12:121800805-121800827 GGGGCGCAGCGCTGGCGACCGGG - Intronic
1103649635 12:122422628-122422650 GTGACGCGCCGCCGCCGCCGCGG + Intronic
1103786466 12:123436595-123436617 GGGACGGTGCGCCGGGGCGCAGG - Exonic
1103856383 12:123973307-123973329 GGTGCGCGGCGCCCGCGGCCTGG + Exonic
1104961613 12:132490732-132490754 GGGGCGCGGGGGCGGCGCCTCGG - Exonic
1105690865 13:22838192-22838214 GGGTCGAGGCGCCAGCCCCCCGG - Intergenic
1106057725 13:26254312-26254334 GAGCGGCGGAGCCGGCGCCCAGG + Exonic
1106478031 13:30114805-30114827 GGGAGGCGGCGGCGGCGGCGGGG + Intergenic
1107468048 13:40666712-40666734 GGCATGCGGCACCGCCGCCCGGG + Intergenic
1110705919 13:78602140-78602162 GGGGGGCGGCGGCGGCGGCCCGG - Exonic
1110705930 13:78602161-78602183 GGGAGGCGGCGGTGGCGGCCCGG - Exonic
1113653496 13:112054280-112054302 GGGTCGCGTCTCCAGCGCCCCGG + Intergenic
1113656057 13:112068306-112068328 GGTGCGCGCCGCCCGCGCCCGGG - Exonic
1113787348 13:113009548-113009570 GGGACGGGGCGCTGGCCCCCAGG + Intronic
1114452739 14:22837534-22837556 GGGTCGCAGCGCCGGCGCGCTGG + Intronic
1115399144 14:32938833-32938855 GGGAGGCGGCGGCGGCGGCGGGG - Intronic
1115850734 14:37588144-37588166 GGGGCGCGGCGCCCCAGCCCGGG + Intergenic
1116886973 14:50231420-50231442 CGGAGGCGGCGCCGGCGGGCTGG + Exonic
1116905183 14:50396939-50396961 GGGGCGCGGCGGCCCCGCCCAGG - Intronic
1117424472 14:55580407-55580429 GGGAGGCGGCGCCGGCCGCGGGG + Intronic
1117680695 14:58200125-58200147 GGGCCGGGGCTCCGGCGCTCGGG - Exonic
1118137431 14:63045301-63045323 GGGGCGCGGCGGCGGCGACGGGG + Exonic
1119106755 14:71932328-71932350 GGGCCCAGGTGCCGGCGCCCAGG + Intergenic
1120993574 14:90398189-90398211 GGGAGGAGGCGGCGGCGCCGCGG + Intronic
1121342701 14:93115039-93115061 GGGACGCGGCGCCGGCGCCCGGG - Intronic
1122437343 14:101709283-101709305 GGGACACAGCCCCGCCGCCCTGG + Intergenic
1122722162 14:103728201-103728223 GGAACCCGGCGCCGGCGCTCGGG + Intronic
1122796903 14:104210641-104210663 GGGAAGCGGCACTGGGGCCCAGG + Intergenic
1122834320 14:104423592-104423614 GGGACGCCTCCCCAGCGCCCGGG + Intergenic
1123053552 14:105559188-105559210 GGGACGCGGCTCCGGAGCAGAGG - Intergenic
1123078130 14:105679603-105679625 GGGACGCGGCTCCGGAGCAGAGG - Intergenic
1125516664 15:40324486-40324508 AGGAAACGGCGGCGGCGCCCGGG + Intergenic
1127268041 15:57376751-57376773 GGGGCGCGGCGCGGGAGTCCGGG - Intronic
1128454188 15:67823456-67823478 GGCACGGGGCGCCGGGACCCCGG - Intronic
1129162237 15:73753209-73753231 GCGCCGCGCCGCCCGCGCCCCGG + Intergenic
1130411756 15:83653930-83653952 AGGGCGCGGTGCCGGCGCGCAGG + Intergenic
1130520681 15:84658471-84658493 GGGAAGCGGCTCCGCCGCCGGGG - Exonic
1132275309 15:100558826-100558848 GGCAGGCGGCTCCGGCGACCAGG + Intergenic
1132326448 15:100973898-100973920 GGGAGACCGCGGCGGCGCCCGGG + Exonic
1132365188 15:101251760-101251782 GGGACGCGGGGCCGGCACGACGG + Exonic
1132585806 16:705395-705417 GGGCCGCGCCGCCGCCGCCCGGG - Intronic
1132733131 16:1372750-1372772 GGGAGGCGGCGCCGGCCCACAGG - Intronic
1132805075 16:1771561-1771583 GGGGCGGGGCGGTGGCGCCCGGG + Exonic
1132978347 16:2721388-2721410 GGGGCGCGGCGCGGGCGGCCAGG + Intergenic
1133127596 16:3656554-3656576 GGGACGCGACGCCTGCCTCCTGG + Intronic
1133216271 16:4294275-4294297 GGGAAGGGGCACAGGCGCCCAGG + Intergenic
1133286552 16:4693472-4693494 CGGAGGCGGGGCCGCCGCCCAGG + Intergenic
1134134145 16:11668575-11668597 GGGCGGGGGCGCCGGGGCCCGGG + Intronic
1134527789 16:14957760-14957782 GGGAGGCGGCGGCGGCGCAGGGG - Intergenic
1136498736 16:30659330-30659352 CGGGGGCGGCGCCGGCTCCCCGG + Exonic
1136799735 16:33059823-33059845 TTGCCGAGGCGCCGGCGCCCCGG + Intergenic
1136913441 16:34161928-34161950 AGGACGCGGCGGCGCCGCCGTGG - Intergenic
1137926611 16:52547007-52547029 GGGGCGCGGCGCTGGGGCCCGGG + Exonic
1139385489 16:66566434-66566456 GGGACGCGACGCTGGTTCCCAGG + Exonic
1139750758 16:69107593-69107615 GAGGCGGGGCGCCAGCGCCCAGG + Exonic
1140221588 16:73048038-73048060 GGGGCGCGGCGCTGGCGTCCGGG + Exonic
1141608645 16:85169443-85169465 TGGGCGCGGCGGCGGCGGCCTGG + Intergenic
1141972449 16:87492747-87492769 GCGACGCCGCGCCCGCGGCCCGG - Intergenic
1142049936 16:87951614-87951636 GGGCTGCGGCGCGGGCGGCCCGG - Intronic
1142395329 16:89828509-89828531 TGGACGCGGGTCCGGCGCGCGGG + Exonic
1142412481 16:89923599-89923621 GGGACGCGGGGCCCCCGCCCTGG + Intronic
1142474395 17:180817-180839 GGGGCGCGGCGCCGGCTCCGAGG + Intronic
1142586869 17:979472-979494 GGGACGCGGCGGCCGGGCCGGGG - Exonic
1142638264 17:1270923-1270945 GGGGCGCGGGGCTGGCGCGCAGG - Exonic
1142762425 17:2050235-2050257 CGGGCGCGGCGGCGGCGGCCGGG + Intergenic
1143099879 17:4499111-4499133 GAGCGGCGGCGCCGGCGCCGGGG + Exonic
1143375418 17:6464203-6464225 GTGCCGCGGCCCCGGCGCCTGGG - Exonic
1143487437 17:7262517-7262539 GGGGCGCGGCCCGCGCGCCCCGG + Intronic
1143513571 17:7408312-7408334 GGGTCCCGGCGGCGGCGCCCCGG + Exonic
1144764206 17:17724116-17724138 GACGCGCAGCGCCGGCGCCCGGG + Exonic
1144910054 17:18673029-18673051 CGGCGGCGGCGGCGGCGCCCGGG - Exonic
1146445397 17:32928414-32928436 GGGACGCGCCGCACGGGCCCCGG - Intronic
1146787360 17:35731798-35731820 GGGGGGCAGCGCCGGAGCCCGGG + Exonic
1146846100 17:36183029-36183051 CGGGCGCCGCGCCGGCTCCCCGG - Intronic
1146935127 17:36808435-36808457 AGCGCGCGGCGCCGGCGCCCTGG - Intergenic
1146955858 17:36936115-36936137 GAGGCGCGGCGCCGGCGCGGGGG - Intergenic
1147720441 17:42536470-42536492 GCGCCGCGCCGCCGCCGCCCAGG - Exonic
1147732034 17:42610016-42610038 GGGACTGGGCGCCTGCGTCCAGG - Intronic
1147793082 17:43025287-43025309 GGGAGGCGGCGGCGGGGCCCGGG + Exonic
1148021807 17:44558234-44558256 GGGGAGCGCCGCCGCCGCCCGGG - Exonic
1148233040 17:45949204-45949226 GGTGCGCGGCGGCGGAGCCCGGG + Intronic
1148556455 17:48581638-48581660 GGGCCGCTGGGCCGGCGGCCGGG + Intronic
1148945659 17:51260067-51260089 GGGTCACGGCGCAGGCGCGCTGG - Intronic
1149314027 17:55421959-55421981 GGGGCGGGGCGCAGGAGCCCCGG - Exonic
1150488865 17:65561237-65561259 GGTACGCGCCGGCCGCGCCCCGG + Intronic
1150802210 17:68291349-68291371 GCGACGCGGGGCCGGGGCGCGGG - Intronic
1150840377 17:68601002-68601024 GGCAGCCGGCGCCGGCGCCCCGG - Exonic
1151414572 17:73952897-73952919 GGGGCGCGGCCGCGGCGTCCGGG - Intergenic
1151708357 17:75784790-75784812 GTGGCGCGGCGCAGGCGCACTGG + Exonic
1151826805 17:76528387-76528409 GGGAGGCGGCGCTGGCTGCCTGG - Exonic
1152222211 17:79075062-79075084 CGGCCGCGGCGGCGGCGGCCGGG + Exonic
1152239216 17:79152838-79152860 GGAACACGGCGCCGGCCTCCGGG + Intronic
1152655954 17:81519323-81519345 GGGACGCGGCACCGGGGCTTCGG + Intronic
1152798749 17:82321574-82321596 GGGAGGCGGCGGCGGCGGCTCGG - Exonic
1152924134 17:83079820-83079842 GGGGCGCGGCGCGGGCGGCCTGG + Exonic
1154954354 18:21241178-21241200 GGGAGGCAGCCGCGGCGCCCAGG - Intergenic
1155007359 18:21741087-21741109 AGGAGGCGGCGCCGGCGCTTGGG + Intronic
1155297395 18:24397804-24397826 GGGACCCGGCGCCGGGACCACGG + Exonic
1157222388 18:45837452-45837474 GGGTCGAGGCGCCCGCACCCGGG - Intronic
1157493031 18:48137019-48137041 GGGACGCCGCGCTCGTGCCCGGG + Intronic
1158137563 18:54224143-54224165 GGAGCGCGGGGCCGGGGCCCAGG - Exonic
1160325266 18:77940768-77940790 GGGAGGCTGCGCGGGCACCCTGG + Intergenic
1160378369 18:78430622-78430644 GTGGCGCGGCGCCCGCGCTCCGG - Intergenic
1160500249 18:79398099-79398121 GGGACGCAGGGGAGGCGCCCAGG - Intronic
1160566398 18:79788811-79788833 GGGACGCGGCGACCGCCGCCGGG - Intergenic
1160577249 18:79863688-79863710 GGGTCCCGCCGCCGCCGCCCGGG - Exonic
1160679812 19:407520-407542 GTCAGGCGGCGCCGGCTCCCGGG + Exonic
1160719197 19:590077-590099 GGGGCGCGGGCCCGGGGCCCGGG - Exonic
1160738811 19:676606-676628 GGGGCGCGGCGGCGGCGGCGGGG + Intronic
1160804115 19:984264-984286 GGGCCGCGGGGCCGCCGCTCTGG + Exonic
1160853515 19:1205960-1205982 GGGACGCGCCGCCCGGGGCCCGG + Intronic
1160860448 19:1235246-1235268 GGGCCGCGGCACGGGCGGCCGGG + Intronic
1160860867 19:1236831-1236853 GGGGCGCGGGGGCGGCGGCCTGG + Intronic
1160897202 19:1408340-1408362 AGGCGGCGGCGACGGCGCCCTGG - Intronic
1160930558 19:1567918-1567940 AGGAGGCCGCGCCCGCGCCCCGG - Exonic
1160967599 19:1753478-1753500 GGGAGCGGCCGCCGGCGCCCGGG - Exonic
1160991816 19:1863269-1863291 GGGGCGCCGCGGCGGCGCCGGGG + Exonic
1161349905 19:3785815-3785837 GTGGCCCGGCGCTGGCGCCCAGG - Intronic
1161424891 19:4198171-4198193 AGGACGCGGCGCCGGGGGCCCGG - Intronic
1162535840 19:11262478-11262500 GGGAGGCGGCGGCGGCGGCGGGG - Intronic
1162731745 19:12722369-12722391 CGGGCGCGGCCCCGACGCCCGGG + Intronic
1162760462 19:12885695-12885717 GGGGCCCGGCGCCGGCTCCTCGG - Exonic
1162861172 19:13506504-13506526 GGGGCGGGGCGCGGGGGCCCGGG + Intronic
1162893049 19:13747869-13747891 GGGGCGCGGAGAGGGCGCCCAGG + Intronic
1163118219 19:15200658-15200680 GGGAAGGGGCGCAGGAGCCCCGG - Intronic
1163142839 19:15362077-15362099 GAGACGCGGTGACGGGGCCCAGG + Intronic
1163158106 19:15449800-15449822 GGGAGGCGGCGCCGCCGGCCAGG + Exonic
1164834724 19:31349760-31349782 GGGACGCGCAGCCGCCGCCGCGG + Intergenic
1164989717 19:32675104-32675126 GGGAGGTGCCGCCGTCGCCCAGG - Exonic
1165454033 19:35900517-35900539 GGGACCCGGCGGCGGCTCCGCGG - Exonic
1165907791 19:39204176-39204198 CGGAGGCGGGGCAGGCGCCCTGG + Exonic
1166223993 19:41383744-41383766 GGGAGGCGGCCCCTGCCCCCTGG - Exonic
1166367303 19:42284195-42284217 GGGCGGCGGCGCCGGCAGCCGGG + Intronic
1166699599 19:44874562-44874584 GGGAGGCTGCGCCGCCGACCTGG + Intronic
1166852849 19:45768692-45768714 GTGAGGCGGCGGCGGCGGCCGGG - Exonic
1167483455 19:49746624-49746646 GGGACGTGGCGGCGGGGCCCAGG + Exonic
1167648870 19:50719208-50719230 GGGACGGGGCACCGGGGACCCGG + Intronic
1167648909 19:50719331-50719353 GGGAGGGGGCGAGGGCGCCCCGG - Intronic
1168058859 19:53879405-53879427 GGGACGCTGCGGCGGCGCCTGGG - Intronic
1202712834 1_KI270714v1_random:27079-27101 GGGGCGCGGAGCCGGCGGGCTGG - Intergenic
924962280 2:45969-45991 AGGACAAGGCGCCGGTGCCCCGG - Exonic
926101661 2:10122274-10122296 GGGAGGCGGGGCCGCGGCCCGGG + Intergenic
926718560 2:15942511-15942533 GGCTGGCGGCGCCGGCTCCCGGG - Exonic
928904519 2:36355916-36355938 GGGAGGAGGCGCCGCCGGCCCGG + Exonic
929452635 2:42047705-42047727 GGGAGGGGGCGGCGGCGGCCAGG - Intergenic
931382101 2:61763851-61763873 GGGAAGAGGCGCGGGCGACCGGG - Intergenic
931695173 2:64865716-64865738 GGGGCGCTGCGCCGCCGCCGAGG - Intergenic
931954024 2:67397696-67397718 GGGATGCGGCGCCGAAGCCAAGG - Intronic
932599196 2:73112484-73112506 CCGACGCGGGCCCGGCGCCCTGG - Exonic
932599256 2:73112742-73112764 GGGGCGCGGAGCCGGCGGCGGGG - Exonic
933666733 2:84970921-84970943 GCGACGCGGCGACGGCGGCTCGG - Intergenic
933858546 2:86441817-86441839 GTCACGCGGCGCTGGGGCCCGGG + Intronic
933953133 2:87348226-87348248 GGGGCACGGCGCCGGCGCAGAGG - Intergenic
934237364 2:90244571-90244593 GGGGCACGGCGCCGGCGCAGAGG - Intergenic
934296816 2:91749019-91749041 GGGCCGCGGCGGCGGCGGCGAGG - Intergenic
934566977 2:95346598-95346620 GGGGCGCGGCGGCGGCGGCGCGG - Intronic
934655945 2:96116848-96116870 GGGACGCGGAGCTAGCGCGCGGG + Intergenic
934921422 2:98347590-98347612 AGGACCTGGAGCCGGCGCCCCGG + Intronic
934966804 2:98730947-98730969 TGGGGGCGGCGCCGGCGGCCGGG - Intronic
938034740 2:128027200-128027222 GGATCGCGGCGGCGGCGCCCGGG + Exonic
938338908 2:130522756-130522778 GGGGCGCGGGGCTGACGCCCGGG + Intronic
938350930 2:130597994-130598016 GGGGCGCGGGGCTGACGCCCGGG - Intronic
938397844 2:130963942-130963964 GGGACGGGGCGCGCGAGCCCGGG - Intronic
939629759 2:144517166-144517188 CGGCGGCGGCGGCGGCGCCCAGG - Intronic
941808582 2:169734050-169734072 GGGACGCGGCGCTGGCCCGCGGG - Exonic
942947034 2:181683191-181683213 GCGTCGCGATGCCGGCGCCCCGG - Intergenic
942947321 2:181684302-181684324 CCGACGCGGCGCCTCCGCCCCGG + Intergenic
944221762 2:197310550-197310572 GGGCGGCGGCGCCGGCGGGCGGG - Intronic
944242694 2:197500663-197500685 GAGACGCTGCGCGTGCGCCCGGG - Intronic
946248566 2:218400231-218400253 GGGAGCCGCCGCCGCCGCCCCGG + Intronic
946747486 2:222860889-222860911 GGAGCGCGGCGCTGGCGGCCCGG - Intergenic
947774553 2:232697439-232697461 GGGACGCGGCGGCGGGGCCGGGG - Intronic
947800826 2:232927845-232927867 GGCACGCGGGGGCGGCGCGCCGG + Intronic
948438114 2:237967349-237967371 CGGAGGCGGCGTCGGCGGCCGGG + Intronic
948801506 2:240435528-240435550 GGGGCGCGGCGCGGGGGCGCGGG - Intergenic
948824634 2:240568371-240568393 GGGGCGCGGGGCCGGGGCGCCGG - Intronic
948874372 2:240819275-240819297 GCGGCGCGCCCCCGGCGCCCGGG - Intronic
948953975 2:241272832-241272854 GAGGCGCGGCGCCCGGGCCCCGG + Exonic
1168760725 20:347873-347895 GGGGCGGGGCGCAGGCACCCGGG - Intronic
1169113086 20:3045823-3045845 GGGACGCGGGTCCGGCCCCGCGG + Intergenic
1169213110 20:3778520-3778542 GGGACCGGCCGCCGGCGCCTCGG - Exonic
1172028955 20:31968267-31968289 GGGAGGCGGCGGCGGCGGCCGGG + Exonic
1172042001 20:32052465-32052487 GAGACGAGGAGCGGGCGCCCAGG + Exonic
1172661997 20:36574299-36574321 GGCGCGTGGGGCCGGCGCCCCGG + Intronic
1172702854 20:36863464-36863486 GGGACGCGGTGTCGGGGCCGAGG - Exonic
1173576639 20:44116291-44116313 GGCCCGCTGCGCCGGCGCCCCGG + Exonic
1173649039 20:44651530-44651552 GGGACGGGGGTCCGGCGCCTGGG - Intronic
1174054059 20:47785846-47785868 GGGACGCGCGGCCCGCGACCCGG + Exonic
1175108231 20:56629227-56629249 GGGCCTCCGCGCCGGCCCCCGGG + Intergenic
1175847000 20:62064788-62064810 CGGCTGCGGCGCCGGCGCCGGGG - Exonic
1175958800 20:62624607-62624629 GGGACGCGGGACCAGGGCCCTGG + Intergenic
1175994093 20:62804705-62804727 GGGGCGCGGGGCGGGCGTCCCGG + Intergenic
1176016638 20:62937456-62937478 GGGACGCGGCCAGGGCGCGCGGG - Intronic
1176184198 20:63769259-63769281 GGGAGGCTGTGCCGGCTCCCTGG + Intronic
1179529915 21:42011061-42011083 GGGACCCGGCGGCCGCGGCCAGG + Intergenic
1179626794 21:42653639-42653661 GGCGCGCGGCGGCGGCTCCCGGG + Intronic
1179675133 21:42975392-42975414 GGGAAGCGGTTCCGGCGTCCCGG + Intronic
1182576471 22:31276565-31276587 GGGCGGCGGCGGGGGCGCCCGGG - Intronic
1182604100 22:31489904-31489926 GGAAGGCGGCGCCGGGGCCAGGG - Intronic
1183149733 22:36028365-36028387 CGGGCCCGGCGCCGCCGCCCGGG - Exonic
1183739479 22:39662090-39662112 GGAGCGCGGCGGCGGCGCCCGGG + Exonic
1183780312 22:39995033-39995055 GGGACTCGGCCATGGCGCCCCGG - Exonic
1184121351 22:42452617-42452639 GGCAGGCGGCGCTGGGGCCCGGG - Intergenic
1184152986 22:42649265-42649287 GGGAGGGGGCGCCGGGGCCGCGG - Intronic
1184337440 22:43862132-43862154 TAGACGCCGCGCCCGCGCCCGGG - Intronic
1184361927 22:44024194-44024216 GGAGCGCGGCCCCGGCGTCCCGG - Intronic
1184472240 22:44702446-44702468 TGGGCGCGGCGCAGGCGGCCCGG + Intronic
1184759601 22:46537150-46537172 GGGCGGCGGCGGCGGCGCCATGG + Exonic
1185055367 22:48576143-48576165 GGGCCGCGGCGGCCGCCCCCCGG + Intronic
950316347 3:12004745-12004767 GGGCTGCGGCGCGGGCGCCGAGG - Exonic
951611342 3:24495140-24495162 GCGGCGCGGAGCAGGCGCCCCGG - Intronic
952484786 3:33799027-33799049 GGGACGGGGCGGCTCCGCCCAGG - Intronic
952942256 3:38453979-38454001 CGGACTCGGCCCCTGCGCCCGGG + Exonic
953801085 3:46023125-46023147 GGGTCGCGGCGGCGGCGCAGGGG + Intronic
954779147 3:53046256-53046278 GGCCCGCGGCGCCGGACCCCCGG - Intronic
961013016 3:123448477-123448499 AGACTGCGGCGCCGGCGCCCCGG - Exonic
961260100 3:125595347-125595369 GGGGCGGGACGCCGGCTCCCGGG + Intergenic
961688307 3:128650608-128650630 GGGACGTGGAGCCGCCGCCCAGG + Exonic
961743199 3:129046639-129046661 AGGAGGCGTCGCCGGGGCCCCGG + Intergenic
964819710 3:160756055-160756077 GGGAGGCGGCGCGGGCGGCAGGG + Intronic
966182246 3:177197690-177197712 GGGAGGCGGCGGCGGCGCGGCGG + Intergenic
966362829 3:179148527-179148549 GGGCGGCGGCGGCGGCGCCGAGG - Exonic
966732551 3:183162852-183162874 GGGACTCGGCGCAGCCGCCGGGG + Exonic
966874520 3:184314761-184314783 GCGCCGCCGCCCCGGCGCCCTGG + Intronic
968225522 3:196969820-196969842 TGGACGGAGAGCCGGCGCCCGGG + Intergenic
968382281 4:107425-107447 CGGCCGGGGCGCCGGGGCCCTGG - Intergenic
968542988 4:1177759-1177781 GGGGCGCGGCACAGGCACCCAGG + Intronic
968674976 4:1872039-1872061 GGGTCCCGGGGCCGGCGCCGGGG + Intronic
968729316 4:2262178-2262200 GGGAGGCGGCGTTCGCGCCCCGG + Exonic
968815192 4:2818279-2818301 GGGACGAGGCGGCGGCGGCCGGG + Exonic
973137315 4:46724423-46724445 GGGCCGCGGCGGCGGCGGCAGGG + Intergenic
975131935 4:70839740-70839762 GGCAGGCGGCGCCGGTGCGCCGG + Exonic
976595583 4:86892255-86892277 GCGAGCCGGCGCCGGCGGCCTGG + Intronic
977573985 4:98658334-98658356 GGGCCGCGGCGCTGGCGGCCTGG + Exonic
977693756 4:99946189-99946211 GGAACGCGGAGCCGGCGGGCAGG + Intronic
982573201 4:157076123-157076145 GGGCCGCGGAGCCTGCGCCGTGG - Exonic
983577006 4:169271016-169271038 GGGAGGCGGCGGCGGCGGCGTGG - Exonic
984668012 4:182448865-182448887 GGGAGGCGGCGGTGGCGGCCCGG + Intronic
985737773 5:1594554-1594576 GGGATGCCGCGCCTGCGCACGGG + Intergenic
986330816 5:6714633-6714655 GGGCCGCGGCGCCTGGGCCCCGG - Exonic
986721600 5:10564396-10564418 GGGACGCGGGGCGCGCGCCGAGG - Intronic
987193240 5:15500349-15500371 GGGACCCGGCGGCGGCGGCGCGG + Exonic
988254956 5:28809330-28809352 GGGACGCGGTGCCCGCCCTCCGG - Intergenic
989379240 5:40797824-40797846 AGGCCGCGGCGCCGTCGCCATGG + Intronic
990347449 5:54884129-54884151 GGGACGCGGGGCCGCCGCGGCGG - Intergenic
990545529 5:56816641-56816663 GGGGCGCGCCGCCTGCGTCCGGG - Intronic
992078903 5:73216150-73216172 AGGGCGCGGCGGCGGCGGCCAGG + Intergenic
992269789 5:75053054-75053076 GGGCCGCGGAGCCGGCTTCCTGG - Intergenic
994353873 5:98774015-98774037 GGGCGGCGGCGCGGGCGCCGTGG - Exonic
995853831 5:116573460-116573482 GTGACGCGGCGCCCCCGCCATGG - Intronic
996329380 5:122312116-122312138 GGGGAGCGGCGCCCGCGGCCGGG + Exonic
996404292 5:123090636-123090658 CGGCGCCGGCGCCGGCGCCCCGG - Intronic
997470626 5:134115119-134115141 GGGCCCCGGCGCCGGCCCCCGGG - Exonic
997975375 5:138438957-138438979 GGGGCGCGCCGCCGCCGCCGCGG + Intergenic
998374568 5:141682232-141682254 GGGAGGCGGGGCCGGCGCGGCGG - Intergenic
999300050 5:150485671-150485693 GGGACGCCGGGCAGCCGCCCCGG + Intergenic
999322652 5:150624856-150624878 GTGCCGAGGCGGCGGCGCCCGGG + Intronic
1002590913 5:180291525-180291547 GGGACGCGACCCCGGGCCCCTGG + Intronic
1002887589 6:1310921-1310943 GGGCCGAGGCGCCCGCTCCCTGG + Intergenic
1002991772 6:2245386-2245408 GGCACGCTGCCCCAGCGCCCGGG - Exonic
1003049334 6:2765759-2765781 GGCACGCGGAGCCCGCGGCCGGG + Exonic
1004614958 6:17281079-17281101 GGGGCGCGGCGGCGGGGCCAGGG - Intergenic
1005826260 6:29633099-29633121 AGGAGGCGGCGCCGGGGACCAGG + Exonic
1006634554 6:35452580-35452602 AGGGCGTGGAGCCGGCGCCCTGG + Exonic
1006788004 6:36680601-36680623 GGGAGGGGGCGCCGGCCTCCAGG - Intronic
1007154061 6:39725206-39725228 GCCCCGCCGCGCCGGCGCCCCGG + Intronic
1007414240 6:41682848-41682870 AGGAGGAGGCGCCAGCGCCCCGG + Intergenic
1007444529 6:41895048-41895070 GGACCGCGGCGCCGGCGGGCTGG - Intronic
1007451315 6:41941782-41941804 GGGAAGCGGCGCGCGCGCGCGGG - Exonic
1007451338 6:41941872-41941894 GGGGCGGGGCTGCGGCGCCCCGG + Intronic
1007751309 6:44073545-44073567 GGGAGGGGGAGGCGGCGCCCAGG + Intergenic
1007765155 6:44155543-44155565 GGGACCCGGCCCAGGTGCCCAGG - Intergenic
1007785648 6:44277799-44277821 AGGACGTGGGGCCAGCGCCCTGG - Exonic
1007967504 6:46015923-46015945 GGGACGCGGCGGGGACACCCCGG + Intronic
1013117470 6:107114444-107114466 GGCCCGCGGCGGCGGCGGCCGGG - Intronic
1013233112 6:108174766-108174788 GAGACCCGGAGCCGGCACCCGGG - Intronic
1013273258 6:108561084-108561106 AGGCGGCGGCGGCGGCGCCCGGG + Exonic
1015244613 6:131062818-131062840 GGGACGCGGCCCCGGTCCCCCGG + Intronic
1016329848 6:142945056-142945078 GGCGCGCGGCGCAGGCGGCCGGG - Intronic
1017738204 6:157381903-157381925 GGGCCGCGGCGCCGCGGCTCGGG + Exonic
1017954889 6:159169502-159169524 GGGACCCGACGGCGGCGCCTCGG + Exonic
1019279277 7:192182-192204 GGAGCGCGGGGCCGGGGCCCAGG - Intergenic
1019282495 7:207539-207561 GGGAAGCGGGGCGGGGGCCCTGG - Intronic
1019333661 7:472447-472469 GGGACTCGGCGCAGGTCCCCCGG + Intergenic
1019343615 7:519608-519630 GGAGCGCGGCGCCGGAGCCGAGG - Intronic
1019343754 7:519997-520019 CTGCCGCGGCGGCGGCGCCCGGG - Intronic
1019395721 7:816728-816750 GGGACGCGAGGCGGGGGCCCGGG + Intronic
1019531204 7:1504339-1504361 GGGTGGCGGCGGCGGCGCTCCGG - Exonic
1019563189 7:1667842-1667864 CGGCGGCGGCGCCGGCGTCCGGG + Intergenic
1019594986 7:1854315-1854337 GGGACGAGCTGCCGGGGCCCAGG - Intronic
1019711490 7:2520034-2520056 GGGCGGCGGCGGCGGCGCCCGGG + Exonic
1019828178 7:3301109-3301131 GGGAGGCGGCGCCCGCTCCCAGG - Intergenic
1020034842 7:4958764-4958786 GCGAGGAGGCGCGGGCGCCCCGG + Intronic
1020238525 7:6374699-6374721 GGGCCGCGGCGGCGGCGGCAGGG - Exonic
1020445432 7:8262332-8262354 GGGAGGCAGCGGCGGCGCCCAGG - Intronic
1021510447 7:21427852-21427874 AGGAGGCGGCCCCAGCGCCCCGG + Intergenic
1021668645 7:23013558-23013580 GGGCCGAGGCGGCGGCACCCGGG + Intronic
1022375216 7:29806405-29806427 GGGACACGGCCCCGGCGGGCGGG - Intergenic
1023405839 7:39833351-39833373 GGGCCGCGGCCCCATCGCCCTGG - Intergenic
1024579755 7:50792729-50792751 GGGCCGCGGCGCGCGCGCCCGGG - Intronic
1027421184 7:78019588-78019610 CGGACGCGGCGCGGGCGGGCGGG - Exonic
1027592538 7:80134700-80134722 GTGGCGCGGCGCCGGGGTCCGGG + Intronic
1029123188 7:98281717-98281739 GGGACGCGGCGGCGGCGGCGGGG - Exonic
1029287915 7:99478877-99478899 GGGACAGGGCGCCGGAGGCCTGG + Intronic
1029338044 7:99919163-99919185 AAGACGCAGCGCCGGCGCCTGGG - Exonic
1029372418 7:100158199-100158221 GGGCGGCGGCGCCGGCGACCAGG - Exonic
1029490127 7:100866359-100866381 GGCACGCAGCGCCAACGCCCTGG + Exonic
1029640230 7:101815813-101815835 GGGCCGCGGCCGCCGCGCCCTGG + Intergenic
1029927143 7:104329405-104329427 GGGACGAGGCGCCAGCGCCGGGG - Intronic
1031406862 7:121396383-121396405 GGGAAGCCGCGCCCGCCCCCTGG + Intergenic
1033159086 7:138981241-138981263 GGGGCGCGGCGCCGACGCCGAGG - Exonic
1033299825 7:140176359-140176381 GGGGCGGGGCGGCGGCGGCCCGG + Intronic
1034228007 7:149497741-149497763 GGGCCGCGGCGCCGGCTCCCAGG - Exonic
1036432242 8:8702085-8702107 GGGTCCGGGCGCGGGCGCCCAGG - Exonic
1036562177 8:9906701-9906723 GGGAGGCTGCACCGGCGCTCAGG - Intergenic
1036910836 8:12755585-12755607 CGGGCTCGGCGACGGCGCCCGGG + Intronic
1040471434 8:47738257-47738279 GGGAAGGGGCGGGGGCGCCCTGG + Exonic
1043527353 8:81111655-81111677 GGCGCGCAGCGCCGCCGCCCCGG + Exonic
1043954200 8:86342626-86342648 AGGGCGCGGCGCCGGCGACGCGG + Intergenic
1044832261 8:96261858-96261880 GGGTCGCGGCGCCGCCACCGCGG - Exonic
1045211660 8:100106003-100106025 GCGACGCGGCGACGGCGCGCGGG + Exonic
1045500187 8:102738799-102738821 GGGAGGCGGCACCGGCACCGTGG + Intergenic
1047381878 8:124372079-124372101 GGGGCGCGGCGGCGGCGGCCGGG + Exonic
1048214351 8:132481160-132481182 GAGGCGGGGCGCCGCCGCCCGGG - Intergenic
1049379728 8:142305952-142305974 GGGACCCGAGGCCGGCGCTCAGG + Intronic
1049405533 8:142450384-142450406 GGGAGGAGGCGGCGGCGCCGAGG - Intronic
1049419576 8:142510837-142510859 GGGGCGCGGAGCCGCCGCTCGGG + Intronic
1049452399 8:142669362-142669384 GGAACTCGGCGCCGGCTCTCGGG - Intronic
1049548907 8:143247263-143247285 CGGCCTCGGGGCCGGCGCCCGGG - Exonic
1049641204 8:143716764-143716786 GGGAGGCTGGGCCCGCGCCCGGG + Intronic
1049675360 8:143886657-143886679 GGGAGGAGGGGCAGGCGCCCTGG + Intergenic
1049766637 8:144358210-144358232 TGGCCGCGGCGCTGGGGCCCCGG + Exonic
1049784514 8:144444135-144444157 GGGAGGCAGGGCCGGGGCCCGGG - Intronic
1050377001 9:4984587-4984609 GGGAAGTGGCGCCGGGGGCCGGG - Intergenic
1051079600 9:13279310-13279332 GGGAAGGTGCGCGGGCGCCCTGG - Intronic
1051780561 9:20684349-20684371 GGGTCGCGCCGCCTGCGGCCCGG + Intronic
1053050649 9:34958362-34958384 GGGACGCGGCTCCGGGGCGGCGG - Exonic
1053151929 9:35749092-35749114 GGGACCCGGTGCCGTGGCCCAGG - Exonic
1053412349 9:37923875-37923897 GGGATGCGGGGCCGGGGCTCTGG - Intronic
1053690293 9:40583684-40583706 GGGGCACGGCGCCGGCGCCAGGG - Intergenic
1054301544 9:63384645-63384667 GGGGCACGGCGCCGGCGCCAGGG - Intergenic
1056413560 9:86354872-86354894 GGGACGCGGAGCCAGCGGTCGGG + Intergenic
1057623268 9:96655230-96655252 GGTTAGCGGCGCCGCCGCCCTGG - Exonic
1057773162 9:97984464-97984486 GTGCCGCGGCGGCGGCGCCCGGG + Intronic
1057922066 9:99105407-99105429 AGGTGGCGGCGCCGGGGCCCGGG + Intronic
1058908099 9:109497932-109497954 GGGACGCGGCGCCGGAGCGTGGG - Intronic
1058991195 9:110256369-110256391 CGCGCGCGGCGCCGGCACCCTGG + Intronic
1059176766 9:112175253-112175275 GGGAGGAGGCGCGGGCGCGCCGG - Exonic
1059191605 9:112333066-112333088 GGGAGGCGGAGGCGGCGCGCGGG - Intronic
1059471151 9:114505511-114505533 GGGACGAGGGGGCGGGGCCCGGG - Intergenic
1059777197 9:117487768-117487790 GGGACGCGGCACCGGCCACCAGG - Intergenic
1060087272 9:120714185-120714207 TGGACGCGTCGCCGGGCCCCGGG - Exonic
1060283475 9:122228846-122228868 GGGCGGCGGGGCCGGCGCCTCGG - Intronic
1060478056 9:124000010-124000032 GGGGAGGGGCGCCGGGGCCCGGG - Intergenic
1061129864 9:128702799-128702821 GGGAAGCGGCGCCGGAGACGCGG - Exonic
1061134226 9:128724082-128724104 GGGCCGAGGCGATGGCGCCCTGG - Exonic
1061208456 9:129177419-129177441 GGGGCGCGGAGCAGGCGGCCGGG + Exonic
1061293635 9:129665945-129665967 GGGGCCCGGCGACTGCGCCCAGG + Exonic
1061961344 9:133990811-133990833 GGGAAGAGGCGCTGGCTCCCAGG + Intronic
1062306182 9:135908028-135908050 AGGTCTCGCCGCCGGCGCCCTGG + Intergenic
1062472383 9:136712298-136712320 GGGAGGCGGAGCCGGGGCCGGGG - Intergenic
1062472446 9:136712460-136712482 GGGTCGCGGCGGAGGCGCGCGGG - Intergenic
1062574718 9:137200775-137200797 GGGGCGTGGCCGCGGCGCCCAGG - Exonic
1062579189 9:137222051-137222073 CGGACGCGGCGCCCGCGCCTCGG + Intergenic
1062594940 9:137295395-137295417 GGGAGGCGGGGCGGGCGCCGGGG - Intergenic
1185457870 X:319630-319652 GGGACGCCGAGGCGGCGTCCAGG - Intergenic
1185471529 X:386716-386738 GGGGCGGGGCGCGGGCGTCCGGG - Intronic
1187281378 X:17860791-17860813 GGGAGGCGGCGCCGGCCGGCGGG - Intronic
1189325707 X:40109555-40109577 CGGACTCGGCGCCGGCCCCGCGG + Intronic
1189332882 X:40153947-40153969 GGGACGCAGCCCCGGCTTCCTGG + Intronic
1190008062 X:46758964-46758986 CAGCCGCGGCGGCGGCGCCCCGG + Exonic
1196001983 X:110795952-110795974 GGGCCGCCGCGCCCGCGCCTTGG - Intergenic
1199772734 X:150984361-150984383 GGGCGGCGGCGGCGGGGCCCGGG + Intronic