ID: 1121342971

View in Genome Browser
Species Human (GRCh38)
Location 14:93115961-93115983
Sequence GCCTCTTAAAGGCGCCGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 4, 3: 2, 4: 40}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121342965_1121342971 -1 Left 1121342965 14:93115939-93115961 CCAGGGGGCAGCGCCGCCCGCCG 0: 1
1: 0
2: 1
3: 42
4: 304
Right 1121342971 14:93115961-93115983 GCCTCTTAAAGGCGCCGCGCCGG 0: 1
1: 0
2: 4
3: 2
4: 40
1121342955_1121342971 30 Left 1121342955 14:93115908-93115930 CCGCGGCGGCGAGGAAGCGGCGG 0: 1
1: 0
2: 0
3: 32
4: 189
Right 1121342971 14:93115961-93115983 GCCTCTTAAAGGCGCCGCGCCGG 0: 1
1: 0
2: 4
3: 2
4: 40
1121342964_1121342971 2 Left 1121342964 14:93115936-93115958 CCGCCAGGGGGCAGCGCCGCCCG 0: 1
1: 0
2: 4
3: 33
4: 266
Right 1121342971 14:93115961-93115983 GCCTCTTAAAGGCGCCGCGCCGG 0: 1
1: 0
2: 4
3: 2
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121342971 Original CRISPR GCCTCTTAAAGGCGCCGCGC CGG Intronic
911638828 1:100266130-100266152 TCGGCTTAAAGGAGCCGCGCTGG - Intergenic
924957689 1:248945023-248945045 CCCTCGCAAAGGCGGCGCGCCGG - Intergenic
1076847559 10:133076781-133076803 GGCTCCTAAAGGCGCCACCCAGG - Intronic
1076963537 10:133786537-133786559 CCCTCGCAAAGGCGGCGCGCCGG - Intergenic
1083662335 11:64257302-64257324 GCCTCTTAAAAGCACCCTGCAGG - Intronic
1091372990 11:135076372-135076394 CCCTCGCAAAGCCGCCGCGCCGG - Intergenic
1096102532 12:48978432-48978454 GCCTCTTATAGTTGCGGCGCTGG - Intronic
1106269262 13:28138394-28138416 TTTTCTTAAAGGGGCCGCGCGGG - Intergenic
1113989973 13:114353416-114353438 CCCTCGCAAAGGCGGCGCGCCGG - Intergenic
1116846416 14:49868323-49868345 GCCTCTTCACCGCGCCCCGCCGG - Intergenic
1121137302 14:91510293-91510315 GCCCCTCAAAAGCGGCGCGCGGG + Intronic
1121342971 14:93115961-93115983 GCCTCTTAAAGGCGCCGCGCCGG + Intronic
1131447284 15:92510999-92511021 GCCTCTCAGAGGTGCCTCGCTGG - Intergenic
1132604769 16:789061-789083 GCCTCTTCCTGGCGCCGCCCTGG - Exonic
1138460381 16:57144234-57144256 GTCTCTTAAAGGCACAGTGCTGG + Intronic
1141638862 16:85329702-85329724 GGTTATTAAAGGCTCCGCGCAGG + Intergenic
1142135999 16:88452405-88452427 GCCTCTCCAGGGCGCCCCGCAGG - Intergenic
1142762726 17:2051172-2051194 GCCTATAAAAGCCGCCGCGCCGG - Intergenic
1143373437 17:6454334-6454356 GGCTCTTAAAGGAGCCTCTCTGG - Exonic
1145243650 17:21253533-21253555 ACCTCTTAAAGGGGCCGCGCCGG + Intergenic
1151685450 17:75643567-75643589 GCCTCTTAAAGGAGCGGGCCAGG - Intronic
1152878943 17:82804491-82804513 GCTTCTTGAAGGCGCCGGCCTGG + Intronic
1163507936 19:17719436-17719458 GCCTCTTAAAGGGGCCGCACCGG - Exonic
1168728748 19:58607248-58607270 CCCTCGCAAAGGCGGCGCGCCGG - Intergenic
925121578 2:1422346-1422368 ACCTCGTGCAGGCGCCGCGCTGG + Intronic
925121583 2:1422373-1422395 ACCTCGTGCAGGCGCCGCGCTGG + Intronic
926689332 2:15722330-15722352 ACCTCTAAAAGTTGCCGCGCGGG - Intronic
934052027 2:88219200-88219222 GCCTCTTAGAGGGGCCGCAGGGG + Intergenic
936569830 2:113603707-113603729 CCCTCGCAAAGGCGGCGCGCCGG + Intergenic
1168991885 20:2102655-2102677 CCGTCTTAAAGGGGCCGCGGCGG + Intronic
1180264223 21:46699316-46699338 CCCTCGCAAAGGCGGCGCGCCGG - Intergenic
1183607158 22:38872431-38872453 GGCTCTTAAAGGGGCCGCGCGGG + Intergenic
1184766925 22:46577028-46577050 GCCCCTTTAAGGTGCGGCGCGGG + Intronic
1185181972 22:49368869-49368891 GGCTCTTAAAGGCACAGTGCTGG - Intergenic
1185430384 22:50807262-50807284 CCCTCGCAAAGGCGGCGCGCCGG - Intergenic
950024360 3:9810282-9810304 GCGTCTTGAAGGCGCCGCTGAGG - Exonic
954822927 3:53347317-53347339 GTCTCTTAAAGGGGCCGCGCGGG - Intronic
955365479 3:58306546-58306568 GCCTCTGTACGGCGCCGCGTAGG + Intronic
956179200 3:66501341-66501363 GCCTCTTAAAGGAGACACGCAGG + Intergenic
985466791 4:190203980-190204002 CCCTCGCAAAGGCGGCGCGCCGG - Intergenic
985467603 5:12454-12476 CTCTCGCAAAGGCGCCGCGCCGG + Intergenic
985749663 5:1667126-1667148 GCCTCTAAAGGGCGCTCCGCAGG + Intergenic
1019362158 7:610393-610415 GCCTCTTAAATGAGCCTCACTGG + Intronic
1029123122 7:98281546-98281568 GCCCCTTTAAGACGCCCCGCCGG + Intronic
1033673078 7:143511595-143511617 GCATCTGAAAGGCGCAGCTCAGG + Intergenic
1060897060 9:127225000-127225022 GCCTGTTACAGGCCCCGCCCCGG - Intronic
1198518098 X:137428327-137428349 GTCTCTTCAAGGCGCAGAGCGGG - Intergenic