ID: 1121343120

View in Genome Browser
Species Human (GRCh38)
Location 14:93116431-93116453
Sequence GTGCGGGTCAGCGTCGGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121343116_1121343120 -10 Left 1121343116 14:93116418-93116440 CCCTTCCTCAGGGGTGCGGGTCA No data
Right 1121343120 14:93116431-93116453 GTGCGGGTCAGCGTCGGCGCCGG No data
1121343106_1121343120 4 Left 1121343106 14:93116404-93116426 CCGTCCCCGGAGACCCCTTCCTC No data
Right 1121343120 14:93116431-93116453 GTGCGGGTCAGCGTCGGCGCCGG No data
1121343110_1121343120 -1 Left 1121343110 14:93116409-93116431 CCCGGAGACCCCTTCCTCAGGGG No data
Right 1121343120 14:93116431-93116453 GTGCGGGTCAGCGTCGGCGCCGG No data
1121343108_1121343120 0 Left 1121343108 14:93116408-93116430 CCCCGGAGACCCCTTCCTCAGGG No data
Right 1121343120 14:93116431-93116453 GTGCGGGTCAGCGTCGGCGCCGG No data
1121343115_1121343120 -9 Left 1121343115 14:93116417-93116439 CCCCTTCCTCAGGGGTGCGGGTC No data
Right 1121343120 14:93116431-93116453 GTGCGGGTCAGCGTCGGCGCCGG No data
1121343112_1121343120 -2 Left 1121343112 14:93116410-93116432 CCGGAGACCCCTTCCTCAGGGGT No data
Right 1121343120 14:93116431-93116453 GTGCGGGTCAGCGTCGGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121343120 Original CRISPR GTGCGGGTCAGCGTCGGCGC CGG Intergenic