ID: 1121343646

View in Genome Browser
Species Human (GRCh38)
Location 14:93119494-93119516
Sequence TACCTTATGAAGTAAGATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121343646_1121343650 15 Left 1121343646 14:93119494-93119516 CCTCTATCTTACTTCATAAGGTA No data
Right 1121343650 14:93119532-93119554 CAGGAGTTGAAAATACAGCCAGG No data
1121343646_1121343654 23 Left 1121343646 14:93119494-93119516 CCTCTATCTTACTTCATAAGGTA No data
Right 1121343654 14:93119540-93119562 GAAAATACAGCCAGGTGGGGTGG No data
1121343646_1121343652 19 Left 1121343646 14:93119494-93119516 CCTCTATCTTACTTCATAAGGTA No data
Right 1121343652 14:93119536-93119558 AGTTGAAAATACAGCCAGGTGGG No data
1121343646_1121343653 20 Left 1121343646 14:93119494-93119516 CCTCTATCTTACTTCATAAGGTA No data
Right 1121343653 14:93119537-93119559 GTTGAAAATACAGCCAGGTGGGG No data
1121343646_1121343651 18 Left 1121343646 14:93119494-93119516 CCTCTATCTTACTTCATAAGGTA No data
Right 1121343651 14:93119535-93119557 GAGTTGAAAATACAGCCAGGTGG No data
1121343646_1121343647 -4 Left 1121343646 14:93119494-93119516 CCTCTATCTTACTTCATAAGGTA No data
Right 1121343647 14:93119513-93119535 GGTAAACCTTGCTCCATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121343646 Original CRISPR TACCTTATGAAGTAAGATAG AGG (reversed) Intergenic
No off target data available for this crispr