ID: 1121344412

View in Genome Browser
Species Human (GRCh38)
Location 14:93124783-93124805
Sequence CCTGGCCAGGTGGTGTAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121344406_1121344412 -2 Left 1121344406 14:93124762-93124784 CCACAAGTATACACCATCATGCC No data
Right 1121344412 14:93124783-93124805 CCTGGCCAGGTGGTGTAATGTGG No data
1121344403_1121344412 22 Left 1121344403 14:93124738-93124760 CCTCAGTGTCCCAAGTAGCTGAG 0: 13
1: 454
2: 11772
3: 119077
4: 227060
Right 1121344412 14:93124783-93124805 CCTGGCCAGGTGGTGTAATGTGG No data
1121344404_1121344412 13 Left 1121344404 14:93124747-93124769 CCCAAGTAGCTGAGACCACAAGT 0: 20
1: 416
2: 5257
3: 35168
4: 133578
Right 1121344412 14:93124783-93124805 CCTGGCCAGGTGGTGTAATGTGG No data
1121344405_1121344412 12 Left 1121344405 14:93124748-93124770 CCAAGTAGCTGAGACCACAAGTA No data
Right 1121344412 14:93124783-93124805 CCTGGCCAGGTGGTGTAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121344412 Original CRISPR CCTGGCCAGGTGGTGTAATG TGG Intergenic
No off target data available for this crispr