ID: 1121349218

View in Genome Browser
Species Human (GRCh38)
Location 14:93160356-93160378
Sequence TTGTAGAAACAGGTGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121349218_1121349225 -2 Left 1121349218 14:93160356-93160378 CCCAGCACCACCTGTTTCTACAA No data
Right 1121349225 14:93160377-93160399 AAAAATAAGATAAATTGGGTGGG No data
1121349218_1121349224 -3 Left 1121349218 14:93160356-93160378 CCCAGCACCACCTGTTTCTACAA No data
Right 1121349224 14:93160376-93160398 CAAAAATAAGATAAATTGGGTGG No data
1121349218_1121349227 27 Left 1121349218 14:93160356-93160378 CCCAGCACCACCTGTTTCTACAA No data
Right 1121349227 14:93160406-93160428 AGCCCAGATCCAGACCAGTAAGG No data
1121349218_1121349222 -7 Left 1121349218 14:93160356-93160378 CCCAGCACCACCTGTTTCTACAA No data
Right 1121349222 14:93160372-93160394 TCTACAAAAATAAGATAAATTGG No data
1121349218_1121349223 -6 Left 1121349218 14:93160356-93160378 CCCAGCACCACCTGTTTCTACAA No data
Right 1121349223 14:93160373-93160395 CTACAAAAATAAGATAAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121349218 Original CRISPR TTGTAGAAACAGGTGGTGCT GGG (reversed) Intergenic
No off target data available for this crispr