ID: 1121353357

View in Genome Browser
Species Human (GRCh38)
Location 14:93192491-93192513
Sequence GGCGGCTCACACTGGCATGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 113}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121353350_1121353357 8 Left 1121353350 14:93192460-93192482 CCTTGAAATGTGGCTAACATGAG 0: 1
1: 1
2: 1
3: 25
4: 220
Right 1121353357 14:93192491-93192513 GGCGGCTCACACTGGCATGGCGG 0: 1
1: 0
2: 0
3: 9
4: 113
1121353346_1121353357 30 Left 1121353346 14:93192438-93192460 CCAACAGCTACCTGAAAGGGGCC 0: 1
1: 0
2: 0
3: 16
4: 114
Right 1121353357 14:93192491-93192513 GGCGGCTCACACTGGCATGGCGG 0: 1
1: 0
2: 0
3: 9
4: 113
1121353349_1121353357 9 Left 1121353349 14:93192459-93192481 CCCTTGAAATGTGGCTAACATGA 0: 2
1: 0
2: 6
3: 46
4: 278
Right 1121353357 14:93192491-93192513 GGCGGCTCACACTGGCATGGCGG 0: 1
1: 0
2: 0
3: 9
4: 113
1121353347_1121353357 20 Left 1121353347 14:93192448-93192470 CCTGAAAGGGGCCCTTGAAATGT 0: 1
1: 0
2: 0
3: 8
4: 136
Right 1121353357 14:93192491-93192513 GGCGGCTCACACTGGCATGGCGG 0: 1
1: 0
2: 0
3: 9
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121353357 Original CRISPR GGCGGCTCACACTGGCATGG CGG Intronic
900784289 1:4638039-4638061 AGTGGCCCACACTGGCGTGGAGG + Intergenic
902754726 1:18541424-18541446 GCCAGCTCACATGGGCATGGAGG + Intergenic
912458374 1:109814924-109814946 GGAGGCTCACACAGACAAGGAGG - Intergenic
919817123 1:201448591-201448613 AGCGGCTGACCCTGGCATGGGGG + Intergenic
920673785 1:208024790-208024812 GGCTGCTCAGACTGGCATCCAGG - Exonic
922168214 1:223133557-223133579 GGCAGCTCACGTGGGCATGGGGG - Intronic
922580716 1:226695833-226695855 GGGGGCTCACAGTGACATTGTGG - Intronic
922798139 1:228351629-228351651 GGGGGGTGACAGTGGCATGGTGG - Intronic
924485831 1:244482574-244482596 GGGGTCTCACTCTGTCATGGAGG - Intronic
1062925374 10:1312335-1312357 GGGGGCTCACTCTGACCTGGAGG - Intronic
1064320043 10:14296465-14296487 GGCGAGTCACAAAGGCATGGGGG - Intronic
1065195989 10:23266094-23266116 GGAGGCTCACCCTGACATGTTGG + Intergenic
1070393168 10:75988811-75988833 GGCCGCACCCACTGGCATGGAGG - Intronic
1074722090 10:116272435-116272457 GGCCGCTGACACGGGGATGGAGG + Intronic
1079151568 11:17904396-17904418 CGGGGCTCAGTCTGGCATGGTGG - Intronic
1083691499 11:64411585-64411607 AGTGGCTAAGACTGGCATGGAGG + Intergenic
1090748653 11:129727290-129727312 GCCGGCTCACATGGGGATGGAGG + Intergenic
1091550831 12:1533819-1533841 AGTGGCTCAAACTGGGATGGAGG - Intronic
1092525096 12:9305033-9305055 GGCGGCTGTCACAGGCATGTGGG - Intergenic
1092542170 12:9426785-9426807 GGCGGCTGTCACAGGCATGTGGG + Intergenic
1094510843 12:31095648-31095670 GGCGGCTGTCACAGGCATGTGGG - Intronic
1101199481 12:102419634-102419656 GGCGCCTCAGACAGGCATCGTGG - Exonic
1105872612 13:24518966-24518988 GGGGGCTGACACTAGTATGGAGG + Intergenic
1106519466 13:30484165-30484187 GGCAGCTCAGGCTGGGATGGGGG - Intronic
1112369892 13:98785213-98785235 GGTGGCTCCTACTGGCATGCTGG - Intergenic
1113769645 13:112899791-112899813 GGCCCGTCACACTGACATGGTGG - Intronic
1118558886 14:67056815-67056837 GGGGGGTCACTCAGGCATGGCGG + Intronic
1121353357 14:93192491-93192513 GGCGGCTCACACTGGCATGGCGG + Intronic
1122549214 14:102540671-102540693 GGCGGCTCACAATGAGAAGGCGG + Intergenic
1122601524 14:102924060-102924082 GGCGGACCCCACCGGCATGGAGG + Intronic
1122778046 14:104131484-104131506 GGCGCCGCACACTGGCTTGCAGG + Intergenic
1125404829 15:39341426-39341448 GGCTGCTCATCCCGGCATGGGGG + Intergenic
1129108196 15:73323082-73323104 GGCGGCTCAGGCTGCCGTGGGGG + Exonic
1132668047 16:1090853-1090875 GGCAGCACACACTGGCTGGGAGG - Intronic
1132804249 16:1768411-1768433 GGCGGCGGCCACTGGCATGCAGG - Intronic
1133049095 16:3106593-3106615 GGCAGCTCACCCTAGCTTGGCGG - Intergenic
1139463970 16:67144074-67144096 GGAGTCTCACTCTGTCATGGAGG - Intronic
1140015771 16:71182392-71182414 GGTGGCTTAAACTGGAATGGTGG + Intronic
1140015822 16:71183123-71183145 GGTGGCTTAAACTGGAATGGTGG + Intronic
1140274851 16:73499273-73499295 TGCCGCTCTCTCTGGCATGGTGG - Intergenic
1140914976 16:79484703-79484725 AGCTGCTCACACTGGCCTGCTGG + Intergenic
1146196826 17:30820511-30820533 GGTGGCTCACCCAGGCACGGTGG + Intronic
1149473741 17:56941287-56941309 GGTGGCTCACCCAGGCACGGTGG + Intronic
1151546584 17:74796997-74797019 AGCGGCTCGCACAGACATGGTGG + Intronic
1151745935 17:76011817-76011839 GGGGGCTGACACTGCCAGGGTGG + Exonic
1154100542 18:11468929-11468951 GGAGTCTCTCACTGGCCTGGAGG - Intergenic
1155219181 18:23669046-23669068 GGAGTCCCACACTGACATGGAGG + Intergenic
1157764550 18:50286697-50286719 CGGGGCTGACACTGGCAGGGTGG - Intronic
1160819672 19:1052210-1052232 GCAGGCTGACACTGACATGGAGG + Exonic
1161602323 19:5192011-5192033 GGCGGCTCAAACTGGAGTGATGG + Intronic
1164611801 19:29637366-29637388 GGTGGCCCACAATGGAATGGAGG + Intergenic
1167520352 19:49951156-49951178 GGTGGGTCACGCAGGCATGGGGG - Intronic
925917800 2:8619249-8619271 GGTGGCTCACACTGGCAGCATGG + Intergenic
926202749 2:10813116-10813138 GGGGGCGCACACAGGCAAGGAGG - Intronic
929032546 2:37662648-37662670 GTGGGCTCACCCTGGGATGGTGG - Intronic
930688744 2:54337109-54337131 GGAGGCTGACACTGGCACAGTGG - Intronic
941666169 2:168246556-168246578 GGCGGCGCACCCTGGCACGGAGG + Intronic
948135659 2:235634073-235634095 GGCGGGGCCCACAGGCATGGGGG + Intronic
1176856675 21:13980218-13980240 GGCGGCACGCACTGGCAGGTGGG + Intergenic
1180184355 21:46132074-46132096 GGCGGCTGACGCTGGCCCGGAGG + Exonic
1180616718 22:17133247-17133269 GCTGGCTCACATTTGCATGGTGG - Intergenic
1180782558 22:18529215-18529237 GGCGGAGCACAATCGCATGGGGG + Intronic
1181239448 22:21468553-21468575 GGCGGAGCACAATCGCATGGGGG + Intergenic
1183358214 22:37370556-37370578 GGCTGCCCTCCCTGGCATGGAGG + Exonic
1183429440 22:37756893-37756915 CGAGGCTCACAGTGGCAAGGGGG - Intronic
1184170937 22:42759386-42759408 GGGGGCAGACACTGCCATGGGGG - Intergenic
1185340040 22:50287101-50287123 GGGGCCTCACCCTGGCCTGGCGG + Exonic
953951574 3:47194694-47194716 GGTGGCTCACACTAGCATTTTGG - Intergenic
956678221 3:71754468-71754490 GGCGGCGCACACCAGCATGGCGG - Exonic
962532899 3:136300346-136300368 GGCTGCCCACACTGGGAAGGAGG + Intronic
963594664 3:147310351-147310373 GGCAGGTCAGACTGGCAGGGAGG + Intergenic
964477701 3:157111430-157111452 AGCGCCTCACACTGTGATGGGGG + Intergenic
969652840 4:8477989-8478011 GGCCACACACTCTGGCATGGGGG - Intronic
976012430 4:80507129-80507151 GGCTGCTCATACTCTCATGGAGG + Intronic
979686423 4:123515226-123515248 AGGTGCTCACAGTGGCATGGGGG - Intergenic
981730007 4:147887253-147887275 GGCAGCTCCCACAGGCAGGGAGG - Intronic
987076002 5:14382444-14382466 GGAGGCTCACACAGGCAAGCAGG + Intronic
988193173 5:27964967-27964989 GGGGGCTAACACTAGTATGGAGG - Intergenic
991640150 5:68743819-68743841 GGCGTATCTCAATGGCATGGAGG + Intergenic
993691027 5:91000731-91000753 AATGGCTCACACTGTCATGGAGG + Intronic
994107110 5:95960904-95960926 GGCGGCGCACACTGGAACGGCGG - Intronic
997531459 5:134584023-134584045 GGTGGCTCACACAGGCAGTGAGG + Intergenic
999954658 5:156687285-156687307 GGGGGCTCAGATTGGGATGGAGG + Intronic
1000662046 5:163949379-163949401 GGAGCCTCACACTGGCCTTGTGG - Intergenic
1002534083 5:179866574-179866596 GGCAACTCACCCTGGAATGGAGG + Intronic
1003030595 6:2597232-2597254 GGAGGCTGACTCTGACATGGGGG - Intergenic
1004908719 6:20261100-20261122 GGCGGGGCACACAGGCATGATGG - Intergenic
1007075350 6:39062592-39062614 GGGGGTCCACACTGGCAAGGGGG + Intronic
1010921730 6:81690780-81690802 GGCAGCTCACACTTGCATTTTGG + Intronic
1012763314 6:103331652-103331674 AGCTCCTCACACTGTCATGGAGG - Intergenic
1013431673 6:110061840-110061862 GTCGGCTCCCACTGGCCTGTTGG + Intergenic
1015158083 6:130120440-130120462 GGAGGCTAAGACTGGCTTGGGGG - Intronic
1017409403 6:154152485-154152507 GCCCCCTCACACTGTCATGGGGG + Intronic
1018708856 6:166483328-166483350 TGCGGCCCACAGTGGCATGGGGG - Intronic
1019286970 7:228510-228532 AGAGGCTGACACTGCCATGGGGG + Exonic
1019436988 7:1027677-1027699 GGCGGCCCCCACTGGCGCGGTGG - Intronic
1019579013 7:1750961-1750983 CGCGGCTCACCCTGGCCTGTGGG - Intergenic
1019748545 7:2714248-2714270 GGTGGCTCACACGGTTATGGAGG + Exonic
1022091446 7:27110375-27110397 GGCGGCTCTCCCAGGCTTGGAGG + Exonic
1022850245 7:34254112-34254134 GGAGGATCGCAATGGCATGGTGG - Intergenic
1028052299 7:86203003-86203025 GGTGGCTCACACGGGCCTGCTGG - Intergenic
1029170280 7:98625333-98625355 GGCGGCTCACAGGGGCGGGGTGG + Intronic
1034257636 7:149733325-149733347 GGCTTCCCACAGTGGCATGGCGG - Exonic
1034376919 7:150653644-150653666 GGAGTCTCACACTGGCATCCGGG - Intergenic
1038680810 8:29665154-29665176 GGCAGCTCACAGTGCCAGGGTGG + Intergenic
1041262766 8:56036212-56036234 AGGGGCTCACACTGGAATCGGGG + Intergenic
1041357318 8:57014334-57014356 GGCAGCTCACACTGGCCTGCAGG - Intergenic
1049020354 8:139952729-139952751 GTCGACTCACACTGCCAGGGTGG + Intronic
1049528608 8:143142381-143142403 GCCAGCTCACCCTCGCATGGGGG + Intergenic
1049528758 8:143142870-143142892 GCCAGCTCACCCTTGCATGGGGG + Intergenic
1049816589 8:144605935-144605957 GGTGTCTCAGACTGGCATGGGGG - Intergenic
1060611401 9:124968749-124968771 GGAGGTTCAAACTGGCATGGTGG + Intronic
1061178050 9:129009171-129009193 TGCGGGTCCCACTGGCAGGGGGG + Exonic
1061620307 9:131807507-131807529 GCCGGCTCCCTCTGGGATGGAGG + Intergenic
1062607899 9:137356220-137356242 GGCGGCTCTCCCTGGCCTGTGGG + Intronic
1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG + Intergenic
1190099892 X:47514468-47514490 CTCGGCTCAGCCTGGCATGGTGG - Intergenic
1195687808 X:107601805-107601827 GGCAGCTCCCCCTGGCTTGGTGG - Exonic
1195802679 X:108731630-108731652 GGCAGCTTACCCTGGAATGGTGG - Intronic
1196505514 X:116436603-116436625 GGTGGCTCACTCTGGCAGGTAGG + Exonic
1199733962 X:150666956-150666978 GGCAGCACACACCAGCATGGTGG - Intronic
1200002815 X:153071041-153071063 GGTGGCTCAGACAGGCATGCGGG + Intergenic
1200004908 X:153078968-153078990 GGTGGCTCAGACAGGCATGCGGG - Intergenic