ID: 1121358461

View in Genome Browser
Species Human (GRCh38)
Location 14:93233913-93233935
Sequence TGTTTGGAAGAGCAGTTTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121358461_1121358467 11 Left 1121358461 14:93233913-93233935 CCGCCAAACTGCTCTTCCAAACA No data
Right 1121358467 14:93233947-93233969 AGGCTGACCCAACCCGCCTTAGG No data
1121358461_1121358463 -9 Left 1121358461 14:93233913-93233935 CCGCCAAACTGCTCTTCCAAACA No data
Right 1121358463 14:93233927-93233949 TTCCAAACACCTTCACCTTGAGG No data
1121358461_1121358468 12 Left 1121358461 14:93233913-93233935 CCGCCAAACTGCTCTTCCAAACA No data
Right 1121358468 14:93233948-93233970 GGCTGACCCAACCCGCCTTAGGG No data
1121358461_1121358469 13 Left 1121358461 14:93233913-93233935 CCGCCAAACTGCTCTTCCAAACA No data
Right 1121358469 14:93233949-93233971 GCTGACCCAACCCGCCTTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121358461 Original CRISPR TGTTTGGAAGAGCAGTTTGG CGG (reversed) Intergenic
No off target data available for this crispr