ID: 1121359204

View in Genome Browser
Species Human (GRCh38)
Location 14:93240826-93240848
Sequence CTTGAACTCCACTGGGACGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121359204_1121359208 28 Left 1121359204 14:93240826-93240848 CCAGCGTCCCAGTGGAGTTCAAG 0: 1
1: 0
2: 0
3: 11
4: 100
Right 1121359208 14:93240877-93240899 ATTTTTTTCCTTTTTTCTGTTGG 0: 1
1: 5
2: 31
3: 489
4: 5580

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121359204 Original CRISPR CTTGAACTCCACTGGGACGC TGG (reversed) Exonic
900117233 1:1033906-1033928 CTGGAACTCCCCGCGGACGCCGG + Intronic
902822858 1:18954131-18954153 CTTACACTCCACTGGGAGACGGG - Intronic
906137565 1:43510230-43510252 TATGAACTGCACTGGGGCGCAGG + Intergenic
907275163 1:53313000-53313022 CTTGCCCTCCACTGGGCCTCTGG - Intronic
907528725 1:55071382-55071404 CTTGGACTCCCCTGGCAAGCAGG + Intronic
916451702 1:164927186-164927208 TTTTAAGTCCTCTGGGACGCTGG - Intergenic
922896655 1:229106044-229106066 CTTGAGCCACACTGGGACACAGG - Intergenic
923010483 1:230084115-230084137 CTCACAGTCCACTGGGACGCAGG - Intronic
1064984348 10:21195011-21195033 CTTGAACACGAATGGGACACAGG + Intergenic
1065487141 10:26246477-26246499 CCTGAACTTCACAGGGACTCTGG + Intronic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1080351097 11:31386580-31386602 CTTGAACATCACTGGTACCCAGG + Intronic
1081496943 11:43621359-43621381 ATTGAACCCCTCTGGGAGGCTGG + Intronic
1087346933 11:96983387-96983409 CTGGAACTACACTGGTATGCTGG + Intergenic
1088835551 11:113575458-113575480 CTTGAACTCCACTGGTGAGCTGG - Intergenic
1090229626 11:125092344-125092366 TTAGAAATCCACTGGGAGGCTGG + Intergenic
1091487050 12:899631-899653 CTTGAATTCAACTGGGAACCGGG + Intronic
1101407068 12:104438090-104438112 CATGAACTCCTCGGGGATGCAGG + Intergenic
1103779968 12:123391912-123391934 CTTGATCTCCCCTGGTACACAGG + Intronic
1119928858 14:78524780-78524802 CTTGAACTCCACCTGGACCTAGG + Intronic
1121121306 14:91377426-91377448 CCTGAACTCCACTTGCTCGCTGG - Intronic
1121359204 14:93240826-93240848 CTTGAACTCCACTGGGACGCTGG - Exonic
1202852656 14_GL000225v1_random:30970-30992 CACGGACTCCCCTGGGACGCGGG - Intergenic
1202853722 14_GL000225v1_random:37263-37285 CACGGACTCCCCTGGGACGCGGG - Intergenic
1202858124 14_GL000225v1_random:64017-64039 CACGGACTCCTCTGGGACGCGGG + Intergenic
1202859432 14_GL000225v1_random:72304-72326 CACGGACTCCACTGGGACGTGGG + Intergenic
1202860597 14_GL000225v1_random:79135-79157 CATGGACTCCCCTGGGACGCGGG + Intergenic
1123935153 15:25190503-25190525 GATGAACTCCAGTGGGACACAGG - Intergenic
1132273174 15:100544386-100544408 CTTGACCTCCGCGGGGACACGGG + Intronic
1132542896 16:519579-519601 CTTGACCTCCACTGAGAGGCAGG + Intronic
1133930971 16:10231815-10231837 CTTGAACTCTGCTGGGAGACAGG - Intergenic
1135509917 16:23073515-23073537 AGTGAACTCCACTGGGCCACAGG + Intronic
1138212210 16:55173180-55173202 CCTGAAGTCAACTGGGAGGCAGG - Intergenic
1138410414 16:56835190-56835212 TTTGAACTCCACAGTGACCCTGG + Intronic
1146054603 17:29574795-29574817 CTGGAAGTCCACTGGGGCGCCGG + Exonic
1150754791 17:67901968-67901990 CTTCAACTCCACTGGTGCTCAGG - Intronic
1153468854 18:5419806-5419828 CTTGATCACCACTGTGACTCCGG - Exonic
1157057382 18:44246825-44246847 CTTTAACTCCATTGGCAAGCTGG - Intergenic
1157263883 18:46200002-46200024 CTTAAAATCCACAGGGCCGCAGG - Intronic
1159702416 18:71645428-71645450 CTTGAGCTGCACTGGTATGCAGG + Intergenic
1159992075 18:74920609-74920631 CCGGAACTCCACCGGGACGTTGG - Exonic
1160675595 19:389677-389699 TGTGAACTCGACTGGGCCGCAGG - Intergenic
1161231923 19:3178792-3178814 CATGAACGCCACGGGGACCCCGG + Exonic
1161627910 19:5337841-5337863 CCTGAAATCCCCTGGGAGGCAGG + Intronic
925055344 2:852990-853012 CCTGAACTCCACAGGGAGGAGGG + Intergenic
932623936 2:73283865-73283887 CCAGAACCCCACTGGGACTCTGG - Intronic
933809163 2:86021719-86021741 CTTGATCTCCACTGTGTCCCAGG - Exonic
937768726 2:125694267-125694289 CTTGGACTCCTCTGGGACCAGGG + Intergenic
937806004 2:126146416-126146438 CTTGAACTCCTCTGGGATTCTGG - Intergenic
943838454 2:192546272-192546294 CTTGAACTCCAGTGAGAAACTGG + Intergenic
948581623 2:238991077-238991099 CCTGAACTCCACGGGGACGAAGG + Intergenic
1168830716 20:844004-844026 TCTGGACTCCACTGGGGCGCGGG + Intronic
1169061450 20:2663540-2663562 CTGGAACTCCACTGGGACAGCGG + Exonic
1169300419 20:4437383-4437405 CTAGAACTCTACTTGGAAGCAGG + Intergenic
1169898998 20:10534202-10534224 TTAGAACTGCACTGGGACCCAGG + Intronic
1171456808 20:25276887-25276909 CTCGCTCTTCACTGGGACGCAGG - Intronic
1173800280 20:45890865-45890887 CGTGGACCCCTCTGGGACGCGGG - Exonic
1174077136 20:47945666-47945688 CTTGGACTTAACTGGGACCCTGG + Intergenic
1180058746 21:45374167-45374189 GCTGGACTCCCCTGGGACGCAGG + Intergenic
1180144557 21:45912109-45912131 CTGGCACTGCACCGGGACGCAGG - Intronic
1180414221 22:12693770-12693792 CACGGACTCCCCTGGGACGCGGG + Intergenic
1183230697 22:36580224-36580246 CTTGGACACCAGTGGGAGGCAGG - Intronic
950428936 3:12939900-12939922 CTTGAGCTCCACTGTGGCACAGG - Intronic
956559212 3:70555129-70555151 CTTGCACTCAACTGGGAGCCCGG - Intergenic
958786374 3:98600856-98600878 TTTGAACTCCATTGGGGAGCTGG + Intergenic
959353130 3:105293490-105293512 CTTGAGCTCCACTTGAAAGCTGG - Intergenic
964346687 3:155760862-155760884 CTTGTACTCCACTTAGACGGTGG - Intergenic
968124309 3:196147135-196147157 TCTGAACCCCACTGGGGCGCAGG - Intergenic
969444856 4:7239004-7239026 GCTGAACTCCACAGGGACGTGGG - Intronic
972348547 4:38213964-38213986 CTTAAACTCCACTGGGATATTGG + Intergenic
974392661 4:61292712-61292734 CTTGAAAGCCATTGGGAAGCTGG + Intronic
975752454 4:77538075-77538097 CATCAATTCCACTGGGACTCTGG - Intronic
975825025 4:78310279-78310301 CTTTAAGTCCCCTGGGATGCTGG + Intronic
976310103 4:83603023-83603045 CTTGACCTCCACAGAGACACCGG - Intronic
979975646 4:127193070-127193092 CTTCAAGTCCAGTGGTACGCTGG + Intergenic
983937227 4:173510393-173510415 CTTCAACCCCACTAGGACCCAGG + Intergenic
992828162 5:80569782-80569804 CTTGGACTCCGCGGGGATGCGGG - Intronic
995027607 5:107442443-107442465 TTTGAACTACACTGGAAAGCTGG - Intronic
995406317 5:111800598-111800620 CATGAACTCCACTGGAATTCTGG - Intronic
999038703 5:148383687-148383709 CTTGATTTCCACTGGTACTCTGG - Intergenic
1002204343 5:177552979-177553001 TGTGAACTCCACAGGGACACAGG - Intronic
1002566795 5:180116676-180116698 CTTCATCTCCGCTGGGACACGGG - Intronic
1003408333 6:5841189-5841211 CTTGAGCTCCACTGGGATCCAGG + Intergenic
1003610908 6:7614373-7614395 CTCCAACTCCATGGGGACGCAGG - Intergenic
1005746403 6:28842139-28842161 TTTGAACTTCACTGGGACACTGG + Intergenic
1012860323 6:104551599-104551621 CTTGGCCTCCACTGGGACAGTGG - Intergenic
1015328203 6:131949396-131949418 CTTGAACTCCACCGGCAGGGTGG + Exonic
1017289709 6:152721849-152721871 CTTGAACTCCACTGTGAGATGGG - Exonic
1019145256 6:169971782-169971804 CTTGAAGCCGCCTGGGACGCTGG + Intergenic
1023090854 7:36616074-36616096 CCTGACCTCCACGGGGAAGCCGG + Intronic
1028784671 7:94778389-94778411 CATGAACTCCACTGGAACCTGGG - Intergenic
1029409657 7:100400728-100400750 CTTGAAGTCCTCTAGGACTCAGG + Intergenic
1032091676 7:128914601-128914623 CTGGGACTCCACTGGGGCCCTGG - Intergenic
1035353614 7:158264281-158264303 ATGGAACTGCACTGAGACGCTGG + Intronic
1036123369 8:6041481-6041503 CTTTCAATCCACTGGGACGCAGG - Intergenic
1040089312 8:43380513-43380535 CTTGAAACCCACTGGGAAGTGGG + Intergenic
1042293257 8:67192154-67192176 CTTGAACCCCACTGGGGCAGAGG - Intronic
1052088799 9:24300945-24300967 CTTGTACTCCACTGAGACAGTGG - Intergenic
1052915641 9:33922797-33922819 CTTGGGCTCCACTGGGCCCCTGG - Exonic
1053300616 9:36946738-36946760 CTTGAAATCCACTGGTGAGCTGG + Intronic
1057270553 9:93648236-93648258 CAGCAACACCACTGGGACGCTGG - Intronic
1058449500 9:105082943-105082965 CCTGAATTCCACTGGGAGGAAGG + Intergenic
1062005427 9:134236399-134236421 CCTGCCCTCCACTGGGACGCTGG - Intergenic
1062311272 9:135938786-135938808 CACGAACTCCACTGGCACGGGGG + Intronic
1187675358 X:21710999-21711021 CTTGAATTCTACCGGGACCCGGG - Intronic
1189233384 X:39469626-39469648 CTTGAGCTCTACTGGGACAGAGG - Intergenic
1192051702 X:67730280-67730302 CTTGGCCTCCACTGGGCAGCAGG + Exonic
1195206379 X:102603353-102603375 CTTGAACTCCCCTGTGCAGCTGG + Exonic
1199986423 X:152955345-152955367 CTTGAAACCCACTGGGAAACAGG + Intronic
1200158217 X:153989544-153989566 CTTGACCTCCACTGGGGCCTGGG + Intergenic
1201178202 Y:11322461-11322483 CGCGGACTCCCCTGGGACGCAGG - Intergenic
1201179786 Y:11333234-11333256 CACGGACTCCCCTGGGACGCGGG - Intergenic