ID: 1121362500

View in Genome Browser
Species Human (GRCh38)
Location 14:93274439-93274461
Sequence GTTCACTCCCTTGCATCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 116}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121362500_1121362511 23 Left 1121362500 14:93274439-93274461 CCATGAGATGCAAGGGAGTGAAC 0: 1
1: 0
2: 0
3: 15
4: 116
Right 1121362511 14:93274485-93274507 ATGGAGGGATGGAAGGTGGTAGG 0: 1
1: 0
2: 14
3: 303
4: 3172
1121362500_1121362505 7 Left 1121362500 14:93274439-93274461 CCATGAGATGCAAGGGAGTGAAC 0: 1
1: 0
2: 0
3: 15
4: 116
Right 1121362505 14:93274469-93274491 TGGAAACACTTTTCCAATGGAGG 0: 1
1: 0
2: 1
3: 29
4: 846
1121362500_1121362508 16 Left 1121362500 14:93274439-93274461 CCATGAGATGCAAGGGAGTGAAC 0: 1
1: 0
2: 0
3: 15
4: 116
Right 1121362508 14:93274478-93274500 TTTTCCAATGGAGGGATGGAAGG 0: 1
1: 0
2: 0
3: 39
4: 366
1121362500_1121362509 19 Left 1121362500 14:93274439-93274461 CCATGAGATGCAAGGGAGTGAAC 0: 1
1: 0
2: 0
3: 15
4: 116
Right 1121362509 14:93274481-93274503 TCCAATGGAGGGATGGAAGGTGG 0: 1
1: 0
2: 3
3: 29
4: 362
1121362500_1121362507 12 Left 1121362500 14:93274439-93274461 CCATGAGATGCAAGGGAGTGAAC 0: 1
1: 0
2: 0
3: 15
4: 116
Right 1121362507 14:93274474-93274496 ACACTTTTCCAATGGAGGGATGG 0: 1
1: 0
2: 0
3: 16
4: 222
1121362500_1121362506 8 Left 1121362500 14:93274439-93274461 CCATGAGATGCAAGGGAGTGAAC 0: 1
1: 0
2: 0
3: 15
4: 116
Right 1121362506 14:93274470-93274492 GGAAACACTTTTCCAATGGAGGG 0: 1
1: 0
2: 1
3: 24
4: 216
1121362500_1121362504 4 Left 1121362500 14:93274439-93274461 CCATGAGATGCAAGGGAGTGAAC 0: 1
1: 0
2: 0
3: 15
4: 116
Right 1121362504 14:93274466-93274488 TATTGGAAACACTTTTCCAATGG 0: 1
1: 0
2: 2
3: 27
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121362500 Original CRISPR GTTCACTCCCTTGCATCTCA TGG (reversed) Intronic
906113553 1:43340114-43340136 GTTGACTCACCTGCATCTCCAGG - Exonic
906495536 1:46302185-46302207 GTTCACTCCCATTCAGCCCAAGG + Intronic
910840419 1:91555849-91555871 GATCCCTCCCTTGCCTCACAGGG - Intergenic
911400327 1:97366797-97366819 GTAGCCTCCCTGGCATCTCATGG - Intronic
914259111 1:145983979-145984001 GTTCACTCTCTTGTATCTTAGGG + Intergenic
914405934 1:147373078-147373100 TTTCAGTCTCTTTCATCTCAAGG - Intergenic
917886491 1:179390705-179390727 GTTCACTCACTTGTATGGCATGG + Intronic
918130447 1:181622842-181622864 GATCTCTCCCTTGCATCTTCTGG - Intronic
918396680 1:184120244-184120266 GTTCAATCCTTTTCATCTCATGG + Intergenic
920173321 1:204084769-204084791 ATTCACCCCCTTGCCTCTCAGGG + Intronic
924161374 1:241236061-241236083 GTTCTCTCCTTGTCATCTCATGG - Intronic
1072134719 10:92534211-92534233 GTTCATTTCCTTGCTTCTCAAGG - Intronic
1074267517 10:111919405-111919427 CTACACTCTCTGGCATCTCAAGG + Intergenic
1074813234 10:117125942-117125964 TTTCCTTCCCTTGCGTCTCATGG - Intronic
1076324217 10:129608841-129608863 GGCCACTCCCTTTCATCTCCCGG + Intronic
1078153661 11:8779844-8779866 ATCCTCTCCCTTGCATGTCATGG + Intronic
1084382824 11:68824359-68824381 GTTCACTCTCTTCCCTTTCATGG + Intronic
1084580314 11:70019209-70019231 TTTCCCTCCCCTGCATCCCAAGG - Intergenic
1090113411 11:123940479-123940501 GATCACTTCCTTGTTTCTCAGGG - Exonic
1090622491 11:128573256-128573278 GTTCACTTCTTTGCATGGCAGGG + Intronic
1090879395 11:130820453-130820475 ATTCTCTCCCTTGCATCCCTGGG - Intergenic
1093259431 12:16917470-16917492 GTGCACTCCCATGCAGCCCAAGG + Intergenic
1097101242 12:56591128-56591150 TTTGACTCCCTTGCACTTCAAGG + Exonic
1099092522 12:78331297-78331319 GATCACACCCTTGCAATTCAGGG - Intergenic
1101757512 12:107632685-107632707 GTTCTCTGCCTAGAATCTCAAGG + Intronic
1102535986 12:113581912-113581934 GTTAACTCCCCTGCATTTCTGGG - Intergenic
1102790095 12:115637617-115637639 GTTCACTAACTGGCATCCCATGG + Intergenic
1104090555 12:125513130-125513152 CTTCACTCACCTGCAGCTCAGGG + Intronic
1104283096 12:127396472-127396494 CTTCACTCACCTGCAGCTCAGGG - Intergenic
1104872144 12:132007515-132007537 GTTCACTCCCCTTCCTCTCTTGG + Intronic
1106433793 13:29706476-29706498 GGTGCCTCCCTTGCTTCTCAAGG - Intergenic
1112870296 13:103962765-103962787 GTTGACTCTCTTGCATTTCCGGG - Intergenic
1113146777 13:107216644-107216666 GTCTATTCCCTTGCATTTCAGGG + Intronic
1115868482 14:37774556-37774578 GTAAACAACCTTGCATCTCAGGG + Intronic
1115977283 14:39011173-39011195 GTTACTTCCCTTGCATTTCATGG + Intergenic
1118250789 14:64158767-64158789 GTTCTCCACCTGGCATCTCAAGG - Exonic
1120757271 14:88256034-88256056 GCACACTCCCTCACATCTCAGGG + Intronic
1121362500 14:93274439-93274461 GTTCACTCCCTTGCATCTCATGG - Intronic
1122367057 14:101200567-101200589 CTGCACCCCCTTGCTTCTCAGGG - Intergenic
1122937875 14:104968226-104968248 GGTCAGTCCCTTGCATGCCAGGG + Intronic
1124379033 15:29149209-29149231 GTTGTCTCACTTGCATCTAATGG + Intronic
1128262129 15:66239834-66239856 ATTAACTCCCTTGCACCTCCGGG - Intronic
1128492116 15:68158085-68158107 TCTCATTCCCTTGCATTTCATGG + Intronic
1131997610 15:98147310-98147332 CCTCACTCCTTTGCCTCTCAAGG - Intergenic
1133344644 16:5061769-5061791 GCTCACCCCCATGCATCTGATGG + Intronic
1135405531 16:22194945-22194967 TGTCACTTCCTTGCTTCTCAGGG + Intergenic
1143386871 17:6536176-6536198 GTCCTCTCCCTCCCATCTCACGG - Intronic
1143581399 17:7829432-7829454 ATTCAATTCCTTGCATCTCCAGG + Intronic
1144724057 17:17492641-17492663 GTTCTCTCCGTTGCCTCTCGAGG + Exonic
1151948499 17:77332556-77332578 TTTCACACCTGTGCATCTCAGGG - Intronic
1153335099 18:3915416-3915438 GTTCACTGCAGTGCAGCTCATGG + Intronic
1157947208 18:51993626-51993648 GCTCACTCACTTGGATGTCAGGG + Intergenic
1160835190 19:1121663-1121685 GTTCACTCCCCAGCATCCCAGGG - Intronic
1161182015 19:2889941-2889963 GGTCACACCTTTGCATCTCTAGG + Intergenic
1163435034 19:17290416-17290438 GGTCTGTCCCTTGCATTTCAGGG + Intergenic
1166918577 19:46212998-46213020 GCTCACTCACCTGCAGCTCATGG - Intergenic
1167123282 19:47531846-47531868 CTTCTCTCTCCTGCATCTCAGGG + Intronic
928131882 2:28657696-28657718 CTTCACTCACATGCCTCTCATGG - Intergenic
935056263 2:99570178-99570200 GTTTTCTCTCTTGCATCTCCTGG + Intronic
937924250 2:127155334-127155356 GTTCAATCCCTGTCTTCTCAAGG - Intergenic
938025224 2:127941846-127941868 TTTCACGCCCTTGGATGTCATGG + Exonic
938188124 2:129251615-129251637 GTTCACTCTCTGGCATCTCTGGG - Intergenic
938467288 2:131532217-131532239 GTGCACTCTGTAGCATCTCAGGG - Intronic
939424092 2:142011747-142011769 GTTGACTCTCTTACATTTCATGG - Intronic
944457857 2:199914172-199914194 GTTCACTCCCTTCAGTCTCATGG + Intronic
948326330 2:237124812-237124834 GTTGCCTCCTCTGCATCTCATGG + Intergenic
948492804 2:238324393-238324415 GTTCCCTCCATTGCACCTGAAGG + Intronic
949072760 2:242035927-242035949 GCTCACACCCATCCATCTCAGGG - Intergenic
1170474331 20:16700091-16700113 CTTCAGTACCTTGCATCTTAAGG + Intergenic
1172530677 20:35629209-35629231 GCTCAGTCCCTTGGAACTCAGGG - Intronic
1176033009 20:63022842-63022864 GTTCAGTCACTTGCAACTGAAGG + Intergenic
1179839761 21:44063846-44063868 GTTCAATGCCTGGGATCTCAAGG - Intronic
1181575965 22:23795066-23795088 GTTTACTCCCTTGTACTTCAAGG - Intronic
1181734598 22:24871755-24871777 TTTCACTCCCTTCAGTCTCAAGG + Intronic
1184300402 22:43555459-43555481 GTTCATTCCCTGGCCTCTCAGGG - Intronic
953216865 3:40926936-40926958 GTTAACTCCCTTGCATTTCCAGG + Intergenic
954748301 3:52799390-52799412 GTGCACTTCTTTGCACCTCAAGG + Exonic
955238604 3:57161278-57161300 TTTCATTCACTTGCAGCTCATGG - Intronic
955571289 3:60309625-60309647 GCTCAAACCCTTGGATCTCAGGG - Intronic
956582166 3:70826193-70826215 TTTCTCTCCCTTTCATCTCTTGG + Intergenic
959537865 3:107507501-107507523 GTTAAATCCTTTGCAACTCAGGG - Intergenic
961813175 3:129533411-129533433 GCTCAGTCCCTGGCATCTCTAGG + Intronic
962170537 3:133097003-133097025 GTCCGCACCCTTGCATGTCACGG + Intronic
962647041 3:137450555-137450577 GTTCCCGTCCCTGCATCTCAGGG - Intergenic
964288621 3:155150312-155150334 GTTCATTCCCTTTCATCATATGG + Intronic
964783093 3:160362691-160362713 GTTGAATCCCTTGCATCCCAGGG - Intronic
965645398 3:170875268-170875290 GTTAACTCCCTTGCATTTTCAGG + Intergenic
967202994 3:187090765-187090787 TTTAACCACCTTGCATCTCAGGG + Intergenic
967853878 3:194101923-194101945 GTGCTCTCCCTTGCTTCTCCAGG - Intergenic
967978010 3:195046194-195046216 GCTCACCCTCCTGCATCTCAGGG + Intergenic
969246085 4:5933796-5933818 GCTCACTCCCATGCCTCCCAGGG - Intronic
969257195 4:6010338-6010360 GATATCTCCCTGGCATCTCAAGG + Intergenic
969485403 4:7469823-7469845 AATCACTGCCTGGCATCTCATGG + Intronic
969640317 4:8394414-8394436 GTCCACACCCCTGCCTCTCAAGG - Intronic
970375380 4:15451763-15451785 ATGCACTCCCCTGCCTCTCAAGG + Intergenic
972930992 4:44071592-44071614 GTCCTTTCCCTTGCAGCTCAAGG + Intergenic
973916371 4:55638046-55638068 GTTCACTTGCTTGCATCTGTAGG - Intergenic
976902780 4:90199582-90199604 GTTCTCTCCTTTGCCTCTCAAGG + Intronic
980264262 4:130494666-130494688 TGTCACTCCATTCCATCTCAGGG - Intergenic
982161608 4:152576073-152576095 GATTACTCCCTTGGATCTTAGGG + Intergenic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
991246842 5:64517590-64517612 CTTCACTCCTCTGCATGTCAAGG + Intronic
995646588 5:114319984-114320006 TTTCACTTCCTTGAAGCTCATGG + Intergenic
997260511 5:132462573-132462595 GTTCACTCCCCTGCACCTCCAGG + Exonic
999374365 5:151076481-151076503 TTTCACTCTCTGGCATCTCAGGG - Intronic
1003989078 6:11467893-11467915 GTTTAGTCCTTTGCATCTCAAGG + Intergenic
1005921260 6:30403912-30403934 GGTCACTCACTTGCTTTTCAGGG + Intergenic
1009894017 6:69724473-69724495 GAACCATCCCTTGCATCTCAGGG - Intronic
1013485402 6:110591519-110591541 GTTCACTGCCCTGGTTCTCAAGG - Intergenic
1016692299 6:146951616-146951638 ATTGCCTCCCTTGGATCTCAGGG + Intergenic
1019147112 6:169982667-169982689 GTTCAGTCCCTTGTGTATCAGGG + Intergenic
1019147685 6:169985451-169985473 GTTCAGTCCCTTGTGTATCAGGG - Intergenic
1022865710 7:34417633-34417655 ATTCAATCCCTTGCAGCTGAAGG + Intergenic
1024444237 7:49457778-49457800 GTTCACTGACTTGCCACTCAAGG - Intergenic
1026705506 7:72688512-72688534 GTTCAATTCCATGCAACTCAAGG - Intronic
1033215680 7:139491870-139491892 CATGAGTCCCTTGCATCTCAGGG - Intergenic
1037895543 8:22651300-22651322 GTTCTCTCCTTTGCATCTTCCGG + Intronic
1041724563 8:61005980-61006002 GTTCACTAGCTTGCAGGTCAGGG + Intergenic
1043502278 8:80869985-80870007 ATTCATTCCCTTGCATCTGTAGG - Intronic
1044930891 8:97250913-97250935 GTTCACTCCTTTCCCTCTCTTGG - Intergenic
1046175284 8:110567971-110567993 GTTCCCTCACTTGCAACTCCAGG - Intergenic
1051399847 9:16668906-16668928 GTCATCTCCTTTGCATCTCATGG - Intronic
1186074642 X:5864877-5864899 GTTCAATCATTTGCATTTCATGG - Intronic
1186908626 X:14137955-14137977 GTTCAGTCACTTGCATTTCAAGG - Intergenic
1187208975 X:17210212-17210234 ACTCACACCCTTGCTTCTCAAGG + Intergenic
1190574420 X:51818513-51818535 TTTCACTCCATTTGATCTCAAGG - Intronic
1191144203 X:57149077-57149099 GTTGACAGCCTTGCATCCCAGGG + Intergenic
1195407540 X:104532864-104532886 GTTCAGTCACTTGGATCTTATGG - Intergenic
1196659904 X:118258845-118258867 GTTAATTCCCCTGCATCTCTAGG + Intergenic
1197938213 X:131762315-131762337 GATCACTCAGTTTCATCTCATGG - Intergenic
1197939836 X:131778082-131778104 GATCACTCAGTTTCATCTCATGG - Intergenic
1198454053 X:136797929-136797951 GTTTCCTCATTTGCATCTCACGG - Intergenic