ID: 1121363642

View in Genome Browser
Species Human (GRCh38)
Location 14:93286651-93286673
Sequence TAGGCTCAGGAATTTGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 357}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121363642_1121363646 -7 Left 1121363642 14:93286651-93286673 CCATGCCCAAATTCCTGAGCCTA 0: 1
1: 0
2: 3
3: 36
4: 357
Right 1121363646 14:93286667-93286689 GAGCCTAGAGTCAGAAGAGCTGG 0: 1
1: 1
2: 5
3: 26
4: 319
1121363642_1121363649 27 Left 1121363642 14:93286651-93286673 CCATGCCCAAATTCCTGAGCCTA 0: 1
1: 0
2: 3
3: 36
4: 357
Right 1121363649 14:93286701-93286723 GCTTCGTGACTTCCAAACCTGGG 0: 1
1: 0
2: 1
3: 16
4: 139
1121363642_1121363648 26 Left 1121363642 14:93286651-93286673 CCATGCCCAAATTCCTGAGCCTA 0: 1
1: 0
2: 3
3: 36
4: 357
Right 1121363648 14:93286700-93286722 AGCTTCGTGACTTCCAAACCTGG 0: 1
1: 0
2: 0
3: 3
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121363642 Original CRISPR TAGGCTCAGGAATTTGGGCA TGG (reversed) Intronic
901112554 1:6810127-6810149 ATGGGTCAGGCATTTGGGCAGGG + Intronic
904107110 1:28094557-28094579 TTGAGTCAGGAATTTGGGCAGGG + Intergenic
905196301 1:36280631-36280653 TAGGCCCTGGAGTTTGGGCCTGG + Intronic
905766700 1:40607518-40607540 TAGGGTGAGGAAGTGGGGCAGGG - Intergenic
907426130 1:54380308-54380330 AAGACTCAAGCATTTGGGCATGG - Intronic
907549339 1:55291119-55291141 GAGGATCAGGAATTCTGGCAGGG - Intergenic
908463484 1:64368860-64368882 CTGGGTCAGGAATTTGGGCCTGG + Intergenic
908973907 1:69873490-69873512 TAGTCTCAGGCGATTGGGCAAGG - Intronic
909423414 1:75492878-75492900 TGGGCACAGGAGATTGGGCAAGG + Intronic
910890540 1:92014912-92014934 TGAGCTCAGGAATTTGGGCCTGG + Intergenic
912050930 1:105526961-105526983 AAGGCTTAGGAATTTTGGAATGG - Intergenic
912654824 1:111476934-111476956 TCGGCTTGGGGATTTGGGCAGGG + Intronic
915264303 1:154705023-154705045 TAATCCCAGGACTTTGGGCAAGG - Exonic
916179953 1:162074679-162074701 ATGGCTCAGGAATTCAGGCAGGG + Intronic
916425482 1:164676040-164676062 TGGGCTCAGGAACTGGGGTAAGG - Intronic
916689667 1:167178346-167178368 TTGACACACGAATTTGGGCAGGG + Intergenic
920088493 1:203435361-203435383 AAGGCTAAGGAATTTGGCCAAGG + Intergenic
921287224 1:213620218-213620240 ATGGGTCAGAAATTTGGGCAGGG + Intergenic
921566487 1:216727786-216727808 TAGGCTCCATAATTTGGGAATGG - Intronic
921991593 1:221372870-221372892 TAGGCACAGGATTGGGGGCATGG + Intergenic
922052882 1:222011071-222011093 TAGGGTCAGGAATTTGGAAGTGG + Intergenic
922089535 1:222382486-222382508 TGGGCTCTGGAATATGGGAACGG + Intergenic
922882985 1:228996595-228996617 GTGGCTCATGAATTTGGACAAGG - Intergenic
923349045 1:233085904-233085926 ATGGGTCAGGAATTTGGGAAGGG - Intronic
923517441 1:234709545-234709567 CAGGCTCAGGGACTTGGGCTTGG + Intergenic
923558167 1:235018186-235018208 GTGGGTCAGGAATTTGGACAAGG + Intergenic
924461814 1:244266325-244266347 GTGGCTCAGGAATCTGGGCCTGG - Intergenic
1063460644 10:6213084-6213106 TCAGCTCAGGAATTTGGGGTTGG + Intronic
1064118014 10:12595479-12595501 TAGGCTCATGAACTTGGGCCTGG + Intronic
1065855965 10:29830276-29830298 TTGGCTCAGAAATTTGTACAAGG - Intergenic
1065880861 10:30036717-30036739 CAGGCTCAGGATTTTGTTCATGG - Intronic
1066368126 10:34796341-34796363 GTGGGCCAGGAATTTGGGCAGGG - Intronic
1066752551 10:38673304-38673326 GTGGGTCAGGAATCTGGGCATGG + Intergenic
1066964481 10:42249733-42249755 GTGGGTCAGGAATCTGGGCATGG - Intergenic
1067799689 10:49350487-49350509 GTGGGTCAGGAATTTGGGAATGG - Intergenic
1069662762 10:70134685-70134707 GAGGCTAAAGAATTTAGGCAAGG + Intergenic
1070821327 10:79356538-79356560 TAGGCTCAGGCCTTTGTGCAGGG - Intergenic
1070907318 10:80084563-80084585 GAGTCTCTGGAATTTGGGGAAGG - Intronic
1071581777 10:86778356-86778378 TGAGCTCAGGAGTTTGGGAATGG - Intronic
1072798297 10:98373687-98373709 TTGGCTTAGGATTTTGAGCACGG - Intergenic
1073346003 10:102783421-102783443 TAGGTTCAGGACTTTGTGAAGGG + Intronic
1073439641 10:103544909-103544931 GAGGCTCTGGAATTTAGGGAGGG - Intronic
1073741569 10:106413962-106413984 TAAGCTAGGGAATTTAGGCATGG - Intergenic
1074209560 10:111317730-111317752 AAGGCTAAGGAATTTGTCCAAGG - Intergenic
1074406210 10:113182076-113182098 TGGGCTCAGGGATTGGGGCCAGG - Intergenic
1075081741 10:119388704-119388726 GTGGGTCAGGAATTTGGGCATGG + Intronic
1075481039 10:122782036-122782058 GAGGGTCAGGAATTCAGGCAGGG + Intergenic
1076317500 10:129552668-129552690 AAGTCTCAGGAACTCGGGCAAGG - Intronic
1076608772 10:131707284-131707306 TGTGCTCAGCAATTTGGGCTGGG - Intergenic
1078608115 11:12795471-12795493 GAGGATCAGTAATTTGGGTATGG + Intronic
1078825605 11:14927333-14927355 GTGGGTCAGGAATTTGGGTAGGG + Intronic
1078853512 11:15186919-15186941 AAGGGTCAGTAATTTGGACAGGG + Intronic
1079313738 11:19390063-19390085 TAGGCTCATAAATTTGTGGATGG + Intronic
1079574760 11:21989590-21989612 TGGACTCAGAAATTTTGGCAGGG - Intergenic
1080837920 11:35957580-35957602 TGAGCTCAGGAGTTTGGGCTGGG + Intronic
1081199774 11:40202041-40202063 TAAGCTATGGATTTTGGGCAAGG + Intronic
1082070801 11:47938106-47938128 TAAGGTCAGGAAGGTGGGCAGGG - Intergenic
1082672023 11:56045865-56045887 TTGACTCATGAATTTGGGCAGGG + Intergenic
1082779254 11:57273670-57273692 TTGGGTCAGGAATTTGGGCAGGG - Intergenic
1082780772 11:57285927-57285949 GTGGGTCAGGAACTTGGGCAGGG + Intergenic
1082929155 11:58580993-58581015 TAGGTTAAGGAATTTGCTCACGG - Intronic
1083261834 11:61527377-61527399 GAGGCTCAGGAACTTGCCCAAGG + Intronic
1083387475 11:62322337-62322359 TCGGCACAGGAATTTCAGCACGG + Intergenic
1084179967 11:67441276-67441298 TAGGCCCAGGACCTTGAGCAGGG - Intronic
1085051589 11:73382860-73382882 TCGGCCCAGGAAGTGGGGCAAGG + Intronic
1088980165 11:114855618-114855640 GTGAGTCAGGAATTTGGGCAGGG + Intergenic
1089547601 11:119241696-119241718 TGTGTTCAGGAATTTGGGCTTGG + Intronic
1089767885 11:120781768-120781790 CAGGTTCAGGACTTTGGGCTAGG + Intronic
1089773703 11:120821265-120821287 TAGGCTTTGGGATGTGGGCAGGG + Intronic
1090853018 11:130587159-130587181 GTGGGTCAGGAATTTGGACAGGG + Intergenic
1092040665 12:5381159-5381181 AGGGCTCAGGAATGAGGGCAGGG - Intergenic
1093426569 12:19034861-19034883 TAGGCTCAGGTATGTGGGAAGGG + Intergenic
1093660770 12:21753976-21753998 GAGGTTCAGAAATTTAGGCATGG - Intronic
1093755834 12:22850901-22850923 TAGGCACAGGATAGTGGGCAGGG + Intergenic
1095160719 12:38912016-38912038 TTGGGTCAGAAATTAGGGCACGG + Intergenic
1098035592 12:66298826-66298848 TAATCTCAGCACTTTGGGCAGGG + Intergenic
1098281949 12:68870816-68870838 ATAGGTCAGGAATTTGGGCAGGG - Intronic
1099698430 12:86053086-86053108 TAGGCTGAGGTATATTGGCAAGG - Intronic
1101599806 12:106199271-106199293 TGTGCACAGGAATTTGGGCAGGG - Intergenic
1101764200 12:107683209-107683231 GGGGGTCAGAAATTTGGGCAGGG + Intergenic
1102567728 12:113807980-113808002 TAGCCTTGTGAATTTGGGCAAGG + Intergenic
1102778048 12:115538036-115538058 GTTGGTCAGGAATTTGGGCAGGG - Intergenic
1103916917 12:124380505-124380527 GAGGCTCAGGATTCGGGGCAGGG - Intronic
1104172743 12:126298182-126298204 GAGGGTCAGGAATCTGGGAAAGG + Intergenic
1104224013 12:126813414-126813436 TAGGCCCAGGGCTTTGGGCAGGG + Intergenic
1104477522 12:129082937-129082959 TAAGCTCAGGAGTTTGAGCCTGG - Intronic
1104693940 12:130849121-130849143 GAGGGTCACGAATATGGGCAGGG - Intergenic
1107887292 13:44884435-44884457 ATGGGTCAGGAATTTGGACAGGG + Intergenic
1112503900 13:99962470-99962492 TAAGCTCAGCATTTTGGGCCAGG - Intergenic
1112835843 13:103513129-103513151 TTGGACCAGGAATTGGGGCAAGG + Intergenic
1114671091 14:24411478-24411500 TGGGCTCAGGGAGTTGGGCCTGG + Intronic
1115780737 14:36765378-36765400 GAGGGTTAGGAATTTGGGAAGGG - Intronic
1117440488 14:55754659-55754681 GTGGCTCAGGAATCTGGGCATGG + Intergenic
1117923671 14:60753150-60753172 GTGCATCAGGAATTTGGGCATGG + Intronic
1118099639 14:62582384-62582406 TTGGATCAGTAATTTGGGAAAGG - Intergenic
1118141920 14:63093249-63093271 TAGGGTGAGGCATGTGGGCAGGG - Intronic
1118432643 14:65736102-65736124 TAGGCTAAGCAATTTGTTCAAGG - Intronic
1118719437 14:68583783-68583805 TAGGCTCAGGGAATTGACCAGGG + Intronic
1119102296 14:71891234-71891256 CAGGGCCAGGAATTTGGGAAGGG + Intergenic
1119184488 14:72630272-72630294 TAGTCTCATGAGTGTGGGCATGG - Intronic
1119747685 14:77056028-77056050 GTGAGTCAGGAATTTGGGCAGGG + Intergenic
1119770913 14:77220220-77220242 GAGGCTGAGGAATTTGCTCAAGG - Intronic
1120696755 14:87653606-87653628 AAGGCTCAGGAAATTGGCCTGGG + Intergenic
1121261188 14:92567341-92567363 ATGGCTCAGCAATTTGGGCTGGG + Intronic
1121363642 14:93286651-93286673 TAGGCTCAGGAATTTGGGCATGG - Intronic
1121422984 14:93828776-93828798 TAGGCTCAGGCGAGTGGGCAGGG - Intergenic
1125034433 15:35107387-35107409 TTGGATGAGAAATTTGGGCAAGG - Intergenic
1125475226 15:40043401-40043423 TAGGGTCAGGAATTTGGTTAGGG + Intergenic
1126103336 15:45132890-45132912 AAGGTTCAAGACTTTGGGCAGGG - Intronic
1129353575 15:74972198-74972220 GTGGGTCAGGAATTTAGGCAGGG + Intronic
1130848037 15:87765778-87765800 GTGGGTCAGGAATCTGGGCATGG - Intergenic
1131751490 15:95512627-95512649 TCAGCTCAGGAAGTTGGCCATGG + Intergenic
1132378290 15:101347597-101347619 GAGGCTCAGCACTTTGGACATGG - Intronic
1135466679 16:22692660-22692682 GTGGGTTAGGAATTTGGGCATGG + Intergenic
1135572700 16:23561419-23561441 AAGACTCAGGCATTTGGGCCAGG + Intronic
1136068151 16:27772317-27772339 GAGGCTCAGTAATTTGCCCAAGG + Intronic
1136461005 16:30410059-30410081 AAAGCTCAGGACCTTGGGCAAGG + Intronic
1136730172 16:32403727-32403749 GTGGGTCAGGAATCTGGGCATGG - Intergenic
1138266211 16:55661669-55661691 TAGACTCAGGAATCAGGGGATGG + Intronic
1139223220 16:65206287-65206309 TAAAATAAGGAATTTGGGCAAGG - Intergenic
1139953961 16:70684716-70684738 TAGGCTAAGGAAAGGGGGCACGG + Intronic
1141036221 16:80628587-80628609 GTGGGTCAGGAATCTGGGCATGG - Intronic
1141396078 16:83706025-83706047 ATGGCTCAGGAATGTGAGCAGGG + Intronic
1141473436 16:84255018-84255040 GTGGGTCAGGACTTTGGGCAAGG + Intergenic
1141760957 16:86028363-86028385 TAAGCTCAGGAAGGTGGGAATGG - Intergenic
1141822040 16:86453115-86453137 GTGGGTCAAGAATTTGGGCAGGG - Intergenic
1202996229 16_KI270728v1_random:113581-113603 GTGGGTCAGGAATCTGGGCATGG + Intergenic
1203022916 16_KI270728v1_random:425923-425945 GTGGGTCAGGAATCTGGGCATGG + Intergenic
1142954952 17:3515318-3515340 TAGGCTCAGGCAGTTGGGTCAGG + Intronic
1143463295 17:7117796-7117818 CTGGGTCAGAAATTTGGGCAGGG - Intergenic
1143504510 17:7356306-7356328 AGGGCTCAGGGATCTGGGCAAGG - Intronic
1143598894 17:7931448-7931470 TAGCCTTGGGAATTTGGGGATGG - Intronic
1143624338 17:8100473-8100495 CTGGATCAGAAATTTGGGCAGGG - Intronic
1143700580 17:8656903-8656925 GTGGATCAGGAATTTGGGTAGGG - Intergenic
1146280503 17:31541357-31541379 TAGCCTCAGGGATTTGGGAGGGG - Intergenic
1146889330 17:36495862-36495884 TTGGCGCTGGAATTTGGGCTGGG - Exonic
1148030866 17:44619957-44619979 ATGTGTCAGGAATTTGGGCAGGG + Intergenic
1149157847 17:53654501-53654523 TAGCCTGAGGAATCTGGGCTGGG - Intergenic
1149425733 17:56552512-56552534 GTGGGTCAGGAATTTGGGCAGGG + Intergenic
1149469475 17:56904021-56904043 CTGGCTCAGGAATCTGGACATGG - Intronic
1149621338 17:58047515-58047537 AGGGCTCAGGAATCTGGGAAGGG + Intergenic
1150376928 17:64689178-64689200 ATGGCTCAGCAATTTGGGCTGGG + Intergenic
1150509854 17:65739244-65739266 TTGGATCAGAAATTTGGGCAGGG - Intronic
1150680882 17:67283490-67283512 GAAGCTCAGGATTTTGGGGAGGG + Intergenic
1153309509 18:3664319-3664341 TTGAATCAGGAATTTAGGCAGGG - Intronic
1154088923 18:11338230-11338252 AATGCTCAGAAATTTGGGTAAGG + Intergenic
1155270560 18:24138039-24138061 TAGGCTCAGGTATTTGGGCTGGG - Intergenic
1157395186 18:47335470-47335492 TATGGTCAGGGACTTGGGCAAGG + Intergenic
1157491539 18:48127218-48127240 TAGGCTCTGGAATCAGGGCCTGG - Intronic
1159563628 18:70023245-70023267 GTGGCTCAGGAATCTGGGCGTGG - Intronic
1161228520 19:3160098-3160120 GTGGGTCAGGAATTTGGGAAAGG + Intronic
1161327615 19:3671161-3671183 TAGAGTCAGGACTGTGGGCAGGG - Intronic
1162503409 19:11067664-11067686 AAGGGTCAGGAATGTGGGAAGGG - Intergenic
1163282643 19:16326522-16326544 AAGGCTCAGGACCTTGGGGAGGG + Intronic
1164600452 19:29559905-29559927 GTGGCTCAGCAATTTGGGCTGGG + Intronic
1165457939 19:35925698-35925720 TTGGGTCAGGAATTTAGGAAGGG - Intergenic
1165810881 19:38611019-38611041 TAGGCTGAGGATCTTGGGGAAGG + Intronic
1166932168 19:46308129-46308151 CAGGCTCATGAATTGGAGCAGGG + Intronic
1167830866 19:52021331-52021353 GTGGCTCAGGAATAAGGGCATGG - Intronic
925123101 2:1434691-1434713 TAGGCTGAGGTATTTGGTCCAGG + Intronic
925958039 2:8987557-8987579 TGGAATCTGGAATTTGGGCAAGG + Intronic
926656114 2:15408149-15408171 TAGGTTCAGGAATTAGGACATGG + Intronic
926671981 2:15585283-15585305 GGGGGTCAGGAATTTGGGCAGGG - Intergenic
927836769 2:26405117-26405139 TAGGTTCAGGAATTGGGCAAGGG + Intronic
929030714 2:37647972-37647994 GTGGGTCAGGAATCTGGGCAGGG - Intronic
929191184 2:39141641-39141663 CTGCCTCAGGAATTTGGGGATGG - Intergenic
929472924 2:42214614-42214636 GTGGGTCAGGAATTTGGGCAGGG + Intronic
929586558 2:43119461-43119483 GCGGATCAGGAATTTGGGTAGGG + Intergenic
930875448 2:56210493-56210515 GTGGCTCAGGAATTTGGACAAGG + Intronic
932504218 2:72213294-72213316 GTGGGTCAGGAATTTGGCCAGGG - Intronic
932609175 2:73186144-73186166 GGGGGTCAGGAATTTGGGCGGGG + Intergenic
933926995 2:87102374-87102396 GAGGATCAGGAATTCAGGCATGG - Intergenic
934186478 2:89681780-89681802 GTGGGTCAGGAATCTGGGCATGG - Intergenic
934315539 2:91915450-91915472 GTGGGTCAGGAATCTGGGCATGG + Intergenic
935339141 2:102044239-102044261 TTAGGTCAGGAATTTGGACAGGG - Intergenic
935424635 2:102907118-102907140 TATTCACAGGAATTAGGGCATGG - Intergenic
936505795 2:113104810-113104832 AAGGCCCAGTAACTTGGGCAAGG + Intergenic
936959768 2:118060942-118060964 GTGGCTCAGAAATTTAGGCAGGG + Intergenic
937876670 2:126831167-126831189 GAGGGTCAGGAATTTGGATAGGG - Intergenic
938403888 2:131016474-131016496 TAGAAACAGGAATCTGGGCATGG - Intronic
939279811 2:140048578-140048600 GTGGGTCAGGAATTTAGGCAAGG - Intergenic
939826008 2:147016512-147016534 TATGAGCAGGACTTTGGGCAAGG - Intergenic
941091277 2:161179265-161179287 TAGGATCAGCAATGTGGGAAGGG - Intronic
941366082 2:164613057-164613079 TAAGCTCAGGAAAATGGACAAGG + Intronic
942413498 2:175735224-175735246 GAGGCTCAGGAACTTGGGAGGGG + Intergenic
945933248 2:215877617-215877639 TTGGGTCAAGAATCTGGGCATGG - Intergenic
946076509 2:217077988-217078010 ATGGATCAGGAATTTGGGCAAGG + Intergenic
946452370 2:219791775-219791797 GTGGGTCAGGAATTTGGGAAAGG - Intergenic
947159594 2:227199003-227199025 GAGTCACAGGAATTAGGGCAAGG + Intronic
947346322 2:229193098-229193120 ATGGATCAGGAATATGGGCAGGG + Intronic
947771448 2:232673540-232673562 TAGGCAGAGGCATTTGGGTAGGG - Intronic
948166855 2:235869646-235869668 GTGGGTCAGGAGTTTGGGCAGGG + Intronic
948747549 2:240107399-240107421 GAGGAGCAGGAATGTGGGCACGG - Intergenic
1168759777 20:342107-342129 GTGGGTCAGGAATTTGGGAAGGG - Intergenic
1168797637 20:622167-622189 TATGCTTAGGAATTCGGGCCAGG - Intergenic
1168827289 20:822512-822534 TAGGCACTGGAAATGGGGCAAGG + Intergenic
1169140450 20:3224603-3224625 GAGGCTCAGGAGGCTGGGCAGGG - Intergenic
1169551743 20:6708204-6708226 CTGGGTCAGGAATTTGGGCAGGG - Intergenic
1169669658 20:8082287-8082309 TTGGGTCAGGAATTTGGGTGTGG - Intergenic
1169968805 20:11246881-11246903 TAGGCTCAGGTAGTGGGGCTGGG + Intergenic
1170210840 20:13844992-13845014 GTGGGTCAGGAATTTGGGCAGGG - Intergenic
1170535299 20:17335116-17335138 GTGGTTCAGGAATTTGGGAAGGG + Intronic
1170801802 20:19596596-19596618 GCGGCTCAGGAGGTTGGGCAGGG - Intronic
1172192324 20:33069390-33069412 CAGGCTCAGGTGTTTGGCCATGG - Intronic
1173123948 20:40319415-40319437 GAGAATCAGGAATTTGGGAAGGG - Intergenic
1173720338 20:45252920-45252942 GAGGCCCAGGCATATGGGCAGGG - Intronic
1173982385 20:47234577-47234599 GTGGGTCAGGAATCTGGGCATGG - Intronic
1174055885 20:47798140-47798162 TGAGCTCAGGAGTTTGAGCATGG + Intergenic
1174522961 20:51146061-51146083 CAGGATGAGGAATTTTGGCAGGG + Intergenic
1174678569 20:52381761-52381783 AAGGGTCAGGAATCCGGGCAAGG - Intergenic
1175190295 20:57207422-57207444 ATTGCTCAGGAATTTAGGCAGGG - Intronic
1177041500 21:16117089-16117111 AAGGCTCAAGAATTTGTGCCTGG + Intergenic
1177804297 21:25858666-25858688 AAGCCTCAGATATTTGGGCATGG + Intergenic
1177962114 21:27680113-27680135 TAGGCACAGGATGTGGGGCAGGG + Intergenic
1178551876 21:33547295-33547317 TAGTATCAGGAATTTGAGTATGG + Intronic
1180542309 22:16461335-16461357 GTGGGTCAGGAATCTGGGCATGG + Intergenic
1180877297 22:19180556-19180578 TACGCCCAGGAATGTTGGCACGG - Intronic
1182327046 22:29521155-29521177 TAGGCTTGGGCATTTGGGGATGG + Intronic
1182786989 22:32916271-32916293 GTGGGCCAGGAATTTGGGCAGGG - Intronic
1183101530 22:35587103-35587125 GAGGATCAGGAATTTGGGACTGG - Intergenic
1183669139 22:39262088-39262110 GTGGGTCAGGAATTTGGGAAGGG - Intergenic
1183739852 22:39663458-39663480 CAGGCTCAGGGATCTGGGCTGGG + Intronic
1184164282 22:42718720-42718742 TAGGCTCTGGGATCTGGACAAGG + Intronic
1184554840 22:45227547-45227569 TAGGCTAAGGCACTTGTGCAGGG - Intronic
1184926726 22:47646903-47646925 AAGGGTCAAGAATTTGGCCATGG + Intergenic
1185285695 22:49999167-49999189 CAGGCTCAGGGATTTAGGCTGGG + Intronic
949760267 3:7462823-7462845 TATGCTCTGGCATTTGGGAATGG + Intronic
949796381 3:7855769-7855791 CAGGCTCTGTTATTTGGGCAAGG + Intergenic
949930706 3:9076179-9076201 GTGGGTCAGCAATTTGGGCAGGG - Intronic
950584464 3:13882440-13882462 AGGGCTCAGGAAGTTGGGCAGGG - Intergenic
950970968 3:17187538-17187560 GTGGATCAGGAATTTGGGCAGGG - Intronic
951660268 3:25055740-25055762 GAGGCTCTGGAATTAGGGTAGGG + Intergenic
951952460 3:28215528-28215550 GTGGGTCAGGAATTTTGGCAGGG + Intergenic
952316415 3:32236624-32236646 TTGTGTCAGGAATTTGGGAAGGG - Intergenic
952615254 3:35263407-35263429 ATGGGTCAGGACTTTGGGCAGGG + Intergenic
953181800 3:40602581-40602603 GTGAGTCAGGAATTTGGGCAGGG + Intergenic
954070792 3:48141514-48141536 TGAGCTCAGGAATGAGGGCAGGG + Intergenic
954644473 3:52122558-52122580 ATGGCTCAGAACTTTGGGCATGG - Intronic
954917597 3:54162258-54162280 TGGGGTCAGGAATTTGGACACGG + Intronic
954948195 3:54445134-54445156 TCGGCTCAGGGATATAGGCAGGG + Intronic
955958415 3:64313919-64313941 TACTCTCAGAAATTGGGGCAAGG - Intronic
956030606 3:65033326-65033348 TAGGTTAAGGAATTTGTTCAAGG + Intergenic
957591283 3:82201914-82201936 TAGGACCAGGAATTTGGACAGGG - Intergenic
957652616 3:83028367-83028389 TAAGATTAGAAATTTGGGCATGG + Intergenic
960028898 3:113038479-113038501 GTGGGTCAGGAATGTGGGCAGGG + Intergenic
960272908 3:115693868-115693890 TAGGATCAATAATTTGGACATGG + Intronic
961138789 3:124537792-124537814 TATGCTCAGGGATTTGGACCTGG + Intronic
961598653 3:128041785-128041807 TAGGTTCAGGAATTTGCCCAAGG - Intergenic
961793680 3:129394222-129394244 TGGCCTCAGGACATTGGGCAAGG + Intergenic
961803368 3:129470065-129470087 TAGGCTAAGGACATTGGGAATGG + Intronic
961809917 3:129515669-129515691 TGGCCTCAGGACGTTGGGCAAGG + Intronic
962341797 3:134592019-134592041 CAGGGTCAGGAATTTAGGAATGG + Intergenic
962918445 3:139929922-139929944 ATGGGTCAGGAATTTGGGCAGGG + Intergenic
963055067 3:141179519-141179541 GAGGCTTAGAAATTTGGTCAAGG + Intergenic
963140270 3:141941139-141941161 GAGGCTCAAGAAGCTGGGCATGG + Intergenic
963398247 3:144760817-144760839 TTAGCTCAGGAGTCTGGGCATGG + Intergenic
965294580 3:166927191-166927213 AAATCTCAGGAATTAGGGCATGG + Intergenic
965685992 3:171303303-171303325 TAGAGTCTGGAATTTGGGGAAGG - Intronic
967986710 3:195100621-195100643 TAGGCCCAGGAACTTGGGTCTGG - Intronic
968001135 3:195207546-195207568 TTGGCTAAGGAATTTGGGGAAGG - Intronic
969436186 4:7191014-7191036 GAGGCTCGGGAGTTTGGGGAAGG + Intergenic
970177967 4:13358260-13358282 AAAGCTAAGGAATTTGGCCAAGG + Intergenic
970271906 4:14357129-14357151 ACGGGTCAGGAATATGGGCAGGG - Intergenic
970588284 4:17535222-17535244 TGGGCTCAGGAAGCCGGGCATGG - Intergenic
971755620 4:30704332-30704354 GTGGGTCAAGAATTTGGGCAGGG + Intergenic
972449039 4:39178534-39178556 TGGGCCCAGGAATTTGAGAATGG - Intergenic
972978480 4:44666310-44666332 TTGGGTCAGGAAACTGGGCATGG - Intronic
973080699 4:45989250-45989272 AAGGATCAGTAACTTGGGCAAGG - Intergenic
974394354 4:61315450-61315472 GAGGCTCAGGATGTTAGGCAAGG + Intronic
974566693 4:63586699-63586721 GTGGTTCAGGAATTTGGGCAGGG - Intergenic
977275788 4:94975986-94976008 TGGGGTCAGGAATTTGTGTAGGG + Intronic
977947784 4:102933544-102933566 GTGGGTCAGGAATCTGGGCATGG + Intronic
978738085 4:112107036-112107058 GTGGATCAGGAATTTGGACAAGG - Intergenic
979016716 4:115443652-115443674 CAGGTTCAGGAGTTTGGACAAGG + Intergenic
980284228 4:130760851-130760873 TTGGCTCATACATTTGGGCAGGG - Intergenic
981101989 4:140839378-140839400 TATGCTCAGTAAGATGGGCACGG + Intergenic
981659019 4:147144733-147144755 TAGGGTCAGGAGTTTGAGAAGGG + Intergenic
985130590 4:186734845-186734867 TAGGGAGAGGTATTTGGGCATGG - Intergenic
985878090 5:2615919-2615941 TAGCACCAGGAATTTGGACAGGG + Intergenic
985908216 5:2858252-2858274 TGGAGTCAGGAATCTGGGCATGG - Intergenic
986149277 5:5112041-5112063 TATGCTTATGGATTTGGGCAGGG + Intergenic
986592109 5:9381740-9381762 TGGGGTCAGGAATCTGGGCAGGG - Intronic
987614729 5:20258959-20258981 TTGGGTCAGGAGTTTGGACACGG - Intronic
988713332 5:33800298-33800320 TAGACTAAGGTCTTTGGGCAGGG - Intronic
989015433 5:36926299-36926321 GTGGGTCAGGAATTTAGGCAGGG + Intronic
989773603 5:45174899-45174921 TAGGCTTAGGAAATAGGGAATGG + Intergenic
990490552 5:56298994-56299016 GAGGCTGAGAAATTTGGCCAAGG - Intergenic
991260929 5:64666914-64666936 ATGGGTCAGGAATCTGGGCAAGG - Intergenic
991645985 5:68800723-68800745 TATGCTCAGGAATCTGGGAGTGG - Intergenic
992009578 5:72513213-72513235 GAGGCTCTGGAAATTGGGGATGG - Intergenic
992623750 5:78618351-78618373 GTGGGTCAAGAATTTGGGCAAGG + Intronic
993706901 5:91181431-91181453 GAGGGTCAGGAATCTGGGAATGG + Intergenic
995969925 5:117955937-117955959 ATGGCTCAAGAATTTGGGAAGGG + Intergenic
996483403 5:124001388-124001410 CAGGCTCAGGAATTTTGTGAGGG + Intergenic
996557862 5:124797469-124797491 TAGGCACAGGATGTGGGGCAGGG - Intergenic
997036505 5:130198980-130199002 TTGGGTCAGGAATATGGGAAGGG + Intergenic
999222543 5:149992699-149992721 CAGGATGAGGCATTTGGGCAAGG + Intronic
999247972 5:150165530-150165552 AAGGCTGAGGGATTTGGGGAAGG - Intergenic
999280893 5:150365008-150365030 CAGACTCAGGAAGCTGGGCATGG - Intronic
999615333 5:153416912-153416934 GAGGATCAGGAATTTGGGGGCGG - Intergenic
999786043 5:154891598-154891620 CAGACACTGGAATTTGGGCAAGG + Exonic
999872929 5:155771326-155771348 TAAGCCCAGGAGTTTGAGCATGG - Intergenic
1000096091 5:157972007-157972029 GAGGGTCAGGAATCTGGGAATGG + Intergenic
1001357286 5:171040899-171040921 GAGGCACAGGAATTTCGGAATGG + Intronic
1002631921 5:180587965-180587987 TAGTCCCAGCACTTTGGGCATGG + Intergenic
1003440603 6:6138000-6138022 GTGGAACAGGAATTTGGGCAAGG + Intergenic
1003682425 6:8269258-8269280 ATGGGTCAGGGATTTGGGCAGGG + Intergenic
1004355247 6:14924663-14924685 TTAACTCAGGGATTTGGGCAGGG - Intergenic
1004558945 6:16728724-16728746 TAGGTTCAGGGACTTGGCCAAGG + Intronic
1004590919 6:17050778-17050800 TAGGGTCAGGCATATGGGAAGGG - Intergenic
1005163758 6:22895408-22895430 TAGACTCAGGTATTGGTGCATGG - Intergenic
1005404562 6:25472845-25472867 TTGGCTCAGGAGTCTGGGTACGG + Intronic
1005601758 6:27433132-27433154 GTGGGTCAGGAATTTGGACAGGG - Intergenic
1006105492 6:31713822-31713844 CAGGCTCAGGAATCTGGGAGAGG + Exonic
1008420615 6:51294886-51294908 TAGGCCCAGGCATTTGCACAAGG + Intergenic
1011335879 6:86259273-86259295 TAGGAGCTGGAATCTGGGCAGGG + Intergenic
1012016820 6:93863085-93863107 GTGGGTCAGGAATTTGGGTAGGG + Intergenic
1012031894 6:94080482-94080504 TAGGATAAGAAATTTGGGGATGG - Intergenic
1016012138 6:139148340-139148362 TAGGCAAAGCAGTTTGGGCATGG + Intronic
1017692821 6:156984055-156984077 TGGGATCAGGAAGTTGGGAAGGG + Intronic
1018045451 6:159962026-159962048 TGGGGTCAGGAATTTAGACAGGG - Intergenic
1023824234 7:43997924-43997946 TGGGCCCAGGACTTTGTGCAGGG + Intergenic
1024725833 7:52193041-52193063 ATGGGTCAGGCATTTGGGCAGGG - Intergenic
1026220677 7:68393682-68393704 TAGACTGAGGAAGTTGGGGAAGG - Intergenic
1027327863 7:77062509-77062531 TGGGCCCAGGACTTTGTGCAGGG - Intergenic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1028903018 7:96122207-96122229 AAGGCTGAGTGATTTGGGCAAGG - Intronic
1029220185 7:98982641-98982663 TAGGCTGAGGATTGTGGCCAGGG + Intronic
1029752499 7:102551253-102551275 TGGGCCCAGGACTTTGTGCAGGG + Exonic
1029770451 7:102650346-102650368 TGGGCCCAGGACTTTGTGCAGGG + Exonic
1029989586 7:104950883-104950905 ATGGGTCAGGAATTTGGGAAGGG - Intergenic
1032786996 7:135208807-135208829 GACGCTCAGGAAGTTGTGCAGGG + Exonic
1033302262 7:140196944-140196966 TTGGGTCAGGAGTCTGGGCATGG - Intergenic
1033568227 7:142600632-142600654 AATGCTCAGGACTTAGGGCATGG - Intergenic
1033838685 7:145347404-145347426 TGGGCACATGAATTTGGGCACGG - Intergenic
1036534527 8:9633939-9633961 GAGGGTCAGGAATCTGGGAATGG - Intronic
1036740469 8:11356809-11356831 TAGGTTCAGGACTCTGGCCAAGG - Intergenic
1037126110 8:15352020-15352042 GAGGCTAAGAAATTTAGGCAAGG + Intergenic
1037807928 8:22068839-22068861 AAGGCTGAGGACTTTGTGCAGGG + Intronic
1038275430 8:26117115-26117137 GAGGATCAGGAATTTGGGCAAGG - Intergenic
1038523425 8:28252926-28252948 ATGGGTCAGGCATTTGGGCAGGG - Intergenic
1038677133 8:29633415-29633437 GTGACTCAGGAATTTGGGCAAGG + Intergenic
1040653989 8:49482932-49482954 ATGGGTCAGGAATTTGGACAGGG - Intergenic
1041126404 8:54644614-54644636 TAGGCTCTGGAAATAGGCCAGGG - Intergenic
1043495241 8:80792915-80792937 GTGGGTCAGGAATCTGGGCATGG - Intronic
1043887034 8:85612745-85612767 TAGGTTCAGGAACTTGGAGATGG - Intergenic
1044055012 8:87557965-87557987 AAGGCTCAGGAAATTGGGTTAGG - Intronic
1044331876 8:90929963-90929985 TAGTCTAAGGAATTTGGACTTGG + Intronic
1046254685 8:111680651-111680673 TAGCCTGAGGACTTTGGGGAAGG + Intergenic
1046847125 8:118930269-118930291 TAAGCAGAGGTATTTGGGCAGGG + Intronic
1049504637 8:142989465-142989487 TAGGGTGAGGAATTCGGGGAGGG - Intergenic
1052197079 9:25731217-25731239 GAGGGTCAGGAACTTGGGAAGGG + Intergenic
1052713244 9:32083183-32083205 TCAGATCAGGAATTTGGACATGG - Intergenic
1053147051 9:35718947-35718969 TATGCACAGGCATGTGGGCAGGG - Intronic
1054805507 9:69393085-69393107 GAGGTTCAGTAATTTGCGCACGG + Intergenic
1055502071 9:76911091-76911113 ATGGGCCAGGAATTTGGGCAGGG - Intergenic
1056109751 9:83383255-83383277 GTGGCTCAGGGATTTGAGCAGGG - Intronic
1056212673 9:84379784-84379806 TGGGCTCAGGAATTCAGGAATGG - Intergenic
1057569084 9:96190149-96190171 TATTGCCAGGAATTTGGGCAAGG + Intergenic
1057749964 9:97784483-97784505 GTGGGTCAGGAATTTGGGCCAGG - Intergenic
1058608928 9:106753952-106753974 GAGTCTCAGTAATTTGGCCAAGG - Intergenic
1059392264 9:114006649-114006671 TAGGGTCAAGAATTTGGATATGG + Intronic
1059410409 9:114128425-114128447 ATGGGTCAGGAATTTGGGCAGGG - Intergenic
1059456308 9:114402389-114402411 AAGGCTCAGGCATCTGGGGATGG + Exonic
1060040714 9:120298043-120298065 TTGGGTCAGGAATTTGGAAATGG - Intergenic
1060766251 9:126296716-126296738 GAGGCTCAGGAATGGGGTCAGGG - Intergenic
1061346195 9:130027597-130027619 ATGGGTCAGGAATTTGGACAGGG + Intronic
1061654291 9:132076788-132076810 TAGGCTCATGAATCTGGAAACGG - Intronic
1062556764 9:137116290-137116312 TGGGCACAGGGATGTGGGCAGGG - Intergenic
1186100878 X:6155330-6155352 CAAGCCCAGTAATTTGGGCAAGG - Intronic
1186449463 X:9660071-9660093 TAAGCCCAGGCATCTGGGCAAGG + Intronic
1186530119 X:10286874-10286896 ATGGGTCAGGAATTTGGGCAGGG + Intergenic
1186959349 X:14718504-14718526 TATGCTCAGGAATTTGTAAAAGG + Intronic
1187208073 X:17201711-17201733 TGAGGTCAGGAATTTGGACAGGG + Intergenic
1187639320 X:21271349-21271371 CAGGTTCAGGAATTTTGGTATGG - Intergenic
1187744884 X:22398499-22398521 ATGGGTCAGGAATTGGGGCAGGG + Intergenic
1188323784 X:28774348-28774370 GTGGGTCAGGAATCTGGGCATGG + Intronic
1188340806 X:28998960-28998982 CTAGCTCAGGAATTTAGGCAGGG + Intronic
1188983571 X:36750118-36750140 TAGGGTCAGCAATATGTGCATGG - Intergenic
1188992253 X:36836070-36836092 TAGGCTCATGAATTAGGTTATGG + Intergenic
1189261191 X:39679905-39679927 CAGGATCAGCAATTTGGGCAGGG + Intergenic
1189295294 X:39913520-39913542 GGGGGTCAGGAATTAGGGCAGGG + Intergenic
1189351043 X:40275985-40276007 CTGGGTCAGGAATTTGTGCAGGG + Intergenic
1190896275 X:54621503-54621525 TTGAGTCAGGAATTTGGGAAGGG - Intergenic
1191982193 X:66938508-66938530 GGGGGTCAAGAATTTGGGCAGGG + Intergenic
1194440374 X:93925586-93925608 GTGGGTCAGGAATTTGGACAGGG + Intergenic
1195690761 X:107622777-107622799 TGCAGTCAGGAATTTGGGCAGGG - Intergenic
1196048739 X:111282823-111282845 TAGGGACAGGAATTTGAGAAGGG + Intergenic
1196078801 X:111608686-111608708 ATGGGTCAGGAGTTTGGGCATGG + Intergenic
1197899404 X:131354057-131354079 TACGATAGGGAATTTGGGCACGG - Intronic
1198593871 X:138214960-138214982 AAGGCTCAGGGATATGGGGAAGG + Intergenic
1198706696 X:139456905-139456927 GTGGGTCAGGAATCTGGGCATGG + Intergenic
1198810987 X:140536133-140536155 GAGCCTGAGGAATTTGGGCAAGG + Intergenic
1199765673 X:150940231-150940253 TCAGCACAGGAATTTGGGAAAGG - Intergenic
1200971854 Y:9161200-9161222 TTGGCTCAGGAACTTGGCCCTGG + Intergenic
1201183204 Y:11370272-11370294 GTGGGTCAGGAATCTGGGCATGG + Intergenic
1202139172 Y:21703093-21703115 TTGGCTCAGGAACTTGGCCCTGG - Intergenic